CN109810196B - Preparation method and application of rice Cu/Zn-SOD polyclonal antibody - Google Patents
Preparation method and application of rice Cu/Zn-SOD polyclonal antibody Download PDFInfo
- Publication number
- CN109810196B CN109810196B CN201910238592.3A CN201910238592A CN109810196B CN 109810196 B CN109810196 B CN 109810196B CN 201910238592 A CN201910238592 A CN 201910238592A CN 109810196 B CN109810196 B CN 109810196B
- Authority
- CN
- China
- Prior art keywords
- rice
- sod
- protein
- polyclonal antibody
- sodcp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
The invention discloses a preparation method and application of a rice Cu/Zn-SOD polyclonal antibody, belonging to the technical field of genetic engineering.A SODCP protein sequence after transfer signal peptide is removed is used for constructing recombinant plasmids by analyzing and predicting the epitope of a rice chloroplast Cu/Zn-SOD protein; preparing SODCP recombinant protein and using it as antigen; preparing the rice Cu/Zn-SOD polyclonal antibody through antigen immunoreaction. The polyclonal antibody prepared by the invention has high titer, strong affinity, good specificity, low preparation cost, high yield and feasibility of industrial production, and can generate specific binding reaction with the Cu/Zn-SOD protein of rice. The polyclonal antibody prepared by the invention can analyze and research the expression conditions of rice under different growth periods and different growth conditions, can be applied to the research of all metabolic mechanisms related to the action of the rice Cu/Zn-SOD protein, and provides technical support for detection and verification of the function and action mechanism of the rice Cu/Zn-SOD protein.
Description
Technical Field
The invention belongs to the technical field of genetic engineering, and particularly relates to a preparation method and application of a rice Cu/Zn-SOD polyclonal antibody.
Background
Throughout the life cycle, plants must respond to various biotic and abiotic stresses from the external environment. Environmental stress increases the production of reactive oxygen species in plant cells, thereby forming OH radicals (and their derivatives) that destroy proteins, membrane lipids, DNA and other cellular components. The antioxidant system evolved from the plant can eliminate toxic free radicals, protect plant cells from being poisoned by oxygen and resist the harmful effect of active oxygen. The activity of antioxidant enzymes is often used as a measure of oxidative stress mediated by reactive oxygen species. Superoxide Dismutase (SOD for short) is an important antioxidant enzyme in organisms, can resist and block damage to cells caused by oxygen free radicals, can repair damaged cells in time, and is a primary substance for eliminating free radicals in organisms. SOD is widely existed in various plants, such as higher plants of corn, rice, arabidopsis, sorghum, upland cotton, etc., and SOD gene has high homology.
The activity of SOD requires the participation of metal prosthetic groups which can be divided into three types according to the difference of the contained metal prosthetic groups, the first type contains copper-zinc metal prosthetic groups (Cu/Zn-SOD), which is the most common enzyme, is green and mainly exists in the cytoplasm of an organism; the second one contains manganese metal prosthetic group (Mn-SOD), is purple and exists in mitochondria and prokaryotic cells of eukaryotic cells; the third one contains iron metal prosthetic group (Fe-SOD), is yellowish brown, and exists in prokaryotic cell, and is mainly composed of Fe-SOD and Mn-SOD in lower plants, and Cu/Zn-SOD in higher plants.
Copper zinc superoxide dismutase (Cu/Zn-SOD) is the most abundant SOD in plant, can exist in the form of homodimer in cytoplasm, can exist in the form of tetramer in chloroplast and extracellular space, and has been reported to exist in the form of monomer in plant Cu/Zn-SOD, and the enzyme pair H in cytoplasm2O2The sensitivity of the chloroplast poly-beta-D-SOD is far higher than that of Cu/Zn-SOD in chloroplasts, two metal prosthetic groups of the Cu/Zn-SOD are connected in a disulfide bond mode, and the state of non-covalent combination of two SOD chains is maintained.
With the continuous and deep research on the Cu/Zn-SOD of rice, the change of the Cu/Zn-SOD belongs to extremely sensitive indexes in the stress resistance process of the rice, and the monitoring of the Cu/Zn-SOD at present is mainly based on the change of enzyme activity, the activity of the Cu-Zn-SOD is controlled by various factors as a special functional protein, the change of the activity can only explain the change of the function of the protein, and after the protein expression, a series of complex processes such as modification, assembly, activation and the like exist, but the change of the enzyme activity can not completely reflect the change of the protein expression in the regulation and control of the gene after transcription; secondly, the current enzyme activity detection mainly takes the detection of the total enzyme activity of superoxide dismutase as a main part, the superoxide dismutase has various types, and different genes are coded and coordinated with each other, so that the change of the total enzyme activity cannot be reflected. The detection of the rice Cu/Zn-SOD based on the enzyme activity can not completely reflect the change of the gene expression level in the view of molecular biology; in terms of sample extraction, the enzyme activity involves the protein activity and structure, so that the requirements on sample extraction, storage and detection environment are relatively strict, the sensitivity is low, and the difference of the Cu/Zn-SOD protein expression of the rice cannot be completely reflected.
Disclosure of Invention
The invention aims to provide a preparation method and application of a rice Cu/Zn-SOD polyclonal antibody, wherein the polyclonal antibody can specifically identify the rice Cu/Zn-SOD and accurately reflect the change of the gene expression of the rice Cu/Zn-SOD.
In order to achieve the purpose, the invention provides the following technical scheme:
the invention provides a preparation method of a rice Cu/Zn-SOD polyclonal antibody, which comprises the following steps:
(1) by analyzing and predicting the epitope of Cu/Zn-SOD protein of rice chloroplast, the SODCP protein sequence without transit signal peptide is used for constructing recombinant plasmid;
(2) constructing a SODCP recombinant plasmid, preparing SODCP recombinant protein, and taking the SODCP recombinant protein as an antigen;
(3) preparing the rice Cu/Zn-SOD polyclonal antibody through antigen immunoreaction.
Preferably, in the step (1), the peptide segments at 1-57 th positions in the SODCP protein sequence are transit peptides, and the peptide segments at 58-211 th positions are rice chloroplast Cu/Zn-SOD.
Preferably, in step (1), the amino acid sequence of the SODCP protein is as shown in SEQ ID NO:1, and the nucleotide sequence of the coding region is shown as SEQ ID NO:2, respectively.
Preferably, in the step (2), the method specifically comprises the following steps:
s1. from SEQ ID NO:2, intercepting a nucleotide sequence corresponding to a 58-211 bit peptide segment of the SODCP protein, and optimizing to obtain a nucleotide sequence shown in SEQ ID NO: 3;
s2, mixing the sequence shown in SEQ ID NO:3, carrying out gene synthesis, inserting the synthetic sequence into an escherichia coli expression vector, constructing recombinant plasmids, sequencing the recombinant plasmids, translating the base sequence of the recombinant protein coding region into an amino acid sequence, and obtaining a fusion protein with the sequence of SEQ ID NO: 4;
s3, introducing the recombinant plasmid obtained in the step S2 into an escherichia coli expression system for recombinant protein expression, optimizing expression conditions, and separating and purifying to obtain the SODCP recombinant protein.
Preferably, in the step (3), the preparation process of the rice Cu/Zn-SOD polyclonal antibody comprises the following steps:
immunizing an animal with the antigen, and separating and purifying serum from the immunized animal to obtain the polyclonal antibody with good specificity and strong sensitivity.
Further, the immune animal is any one of rabbit, mouse, rat and goat.
Further, the purification method is affinity chromatography purification.
The invention provides an application of a rice Cu/Zn-SOD polyclonal antibody, which is used for detecting rice Cu/Zn-SOD protein.
The polyclonal antibody can be applied to biotechnology for detecting target protein based on the antigen-antibody reaction principle, and comprises application technologies such as immune enzyme-linked reaction, immunoblotting, co-immunoprecipitation, immunohistochemistry and the like.
The invention also provides a reagent for detecting the Cu/Zn-SOD protein of the rice, which comprises the polyclonal antibody.
The main mechanism of the invention is as follows:
antibodies (antibodies) are proteins that protect the body from antigenic stimuli. Antibodies recognize a unique feature of a particular foreign object, referred to as an antigen. The unique biological activity of the antibody makes it play an important role in the diagnosis, immune control and basic research of diseases. Polyclonal antibodies are obtained mainly from animal immune sera, sera of convalescent patients or sera of immunized persons. The polyclonal antibody has the most advantages of comprehensive effects.
The immune enzyme-linked reaction and the Western Blot technology (Western Blot) utilize the specific combination of antigen and antibody to qualitatively and quantitatively detect a certain target protein in a complex sample, and have the advantages of high sensitivity, good specificity, simple and convenient operation, intuitive result and the like. Polyclonal antibodies, however, recognize more than monoclonal antibodies for proteins because they recognize multiple epitopes. In the process of preparing polyclonal antibodies, the requirement on the purity of antigens is quite high, and the selection and preparation of the antigens are always problems to be solved urgently when preparing the polyclonal antibodies.
The invention predicts a plurality of epitope sequences by analyzing the hydrophilicity, the surface exposure, the flexibility and the like of the Cu/Zn-SOD of rice chloroplast and the secondary structure. Comprehensively considering three Cu/Zn-SOD protein homologous regions of rice and homology with other types of SOD of the rice, constructing a recombinant expression plasmid by a rice chloroplast Cu/Zn-SOD sequence after removing a chloroplast transit signal peptide, expressing by fusing histidine, carrying out affinity chromatography on the prokaryotic expressed recombinant protein to obtain high-purity rice chloroplast Cu/Zn-SOD recombinant protein, and preparing a rice Cu/Zn-SOD polyclonal antibody by taking the recombinant protein as an antigen.
The invention has the beneficial technical effects that:
1) the polyclonal antibody prepared by the invention has high titer, strong affinity, good specificity, low preparation cost, high yield and feasibility of industrial production, and can generate specific binding reaction with the Cu/Zn-SOD protein of rice.
2) The polyclonal antibody prepared by the invention can analyze and research the expression conditions of rice under different growth periods and different growth conditions, can be applied to the research of all metabolic mechanisms related to the action of the rice Cu/Zn-SOD protein, and provides technical support for detection and verification of the function and action mechanism of the rice Cu/Zn-SOD protein.
3) The antibody of the invention is a functional protein which specifically recognizes an antigen. In most cases, the primary structure of a protein, i.e., its amino acid sequence with antigenicity, is mainly recognized. The antibody is adopted to identify the Cu/Zn-SOD of the rice, the content of protein can be accurately reflected, and the change of enzyme activity caused by the structural change due to improper sample treatment or storage conditions can be avoided.
4) The invention adopts the recombinant protein immunization to obtain the polyclonal antibody, can identify a plurality of antigenic determinants, and has the identification capability of both the spatial structure and the primary structure of the protein.
Drawings
FIG. 1 is an SDS-PAGE identification of SODCP recombinant protein purified in example 2.
FIG. 2 shows the results of the specificity test of the polyclonal antibody of example 5 for the Cu/Zn-SOD protein of rice.
Detailed Description
The present invention will be described in detail below with reference to specific examples. The experimental procedures in the following examples are conventional unless otherwise specified. The raw materials and reagents used in the following examples are all commercially available products unless otherwise specified.
Example 1: sequence analysis and analytical prediction of candidate epitopes
The Cu/Zn-SOD of rice has three corresponding genes according to the different cell positioning.
Os SODCC1(LOC4332846) located in the intercellular substance, the gene ID in GenBank is: 4332846, the nucleotide sequence of the coding region is as set forth in SEQ ID NO: 5, the full-length sequence of the coded amino acid is shown as SEQ ID NO: 6, the gene is located on the No. 3 chromosome of rice and has 8 exons.
Cytoplasmic-localized Os SODCC2(LOC4344210), with gene IDs in GenBank: 4344210, the nucleotide sequence of the coding region is as set forth in SEQ ID NO: 7, the full-length sequence of the coded amino acid is shown as SEQ ID NO: 8, the gene is located on the No. 7 chromosome of rice and has 8 exons.
Os SODCP localized to chloroplasts (LOC4346329), the gene ID in GenBank is: 4346329, the nucleotide sequence of the coding region is as set forth in SEQ ID NO:2, the full-length sequence of the coded amino acid is shown as SEQ ID NO:1, the gene is located on the No. 8 chromosome of rice and has 8 exons. (wherein the peptide segments at the 1 st to 57 th positions are transit peptides, and the peptide segments at the 58 th to 211 th positions are rice chloroplast Cu/Zn-SOD).
The protein homology of Os SODCC1 and Os SODCC2 is as high as 92%, and after the positioning signal peptide is cut off by Os SODCC in chloroplast, the homology of Os SODCC1 and Os SODCC2 is 75%. The three protein homologous sequences are concentrated at the carbon end of the protein, mainly in connection with the binding sites of their metal prosthetic groups (Cu and Zn) being concentrated mainly at the carbon end.
According to SEQ ID NO:1, analyzing the hydrophilicity, the surface exposure, the flexibility and the like of the amino acid sequence, analyzing and predicting the antigenicity of the rice chloroplast SODCP, comparing with the OsSODCC 1 and the OsSODCC 2 with high homology, the SODCP has a common sequence and a characteristic sequence, and in the homologous sequence and the non-homologous sequence, high immunogenicity regions exist. According to the principle that polyclonal antibodies can recognize a plurality of antigenic determinants, SODCP protein sequences (58-211 peptide segments) are selected to construct recombinant proteins when positioning signal peptides are removed, and the recombinant proteins are used as immune antigens.
The BLAST comparison with rice protein database confirms that the sequence only has homology with rice Cu/Zn-SOD, but has no homology with other types of SOD and has no antigenic determinant homologous region.
Example 2: construction of SODCP recombinant plasmid, and preparation of SODCP recombinant protein as antigen
S1. from SEQ ID NO:2, intercepting a nucleotide sequence corresponding to the 58-211 peptide fragment of the SODCP protein, and performing codon optimization on an escherichia coli expression system through software to obtain a nucleotide sequence shown in SEQ ID NO: 3;
s2, mixing the sequence shown in SEQ ID NO:3, carrying out gene synthesis, and mixing the synthesized SEQ ID NO:3 inserting the base sequence into a prokaryotic expression vector, constructing recombinant plasmid, sequencing the recombinant plasmid, translating the base sequence of the recombinant protein coding region into an amino acid sequence, and obtaining a fusion protein with the sequence of SEQ ID NO: 4;
s3, introducing the recombinant plasmid obtained in the step S2 into escherichia coli (BL21de3) for induction expression, performing multi-step separation and purification by using a histidine fusion tag on an expression vector to obtain SODCP recombinant protein with the purity of 90%, storing the SODCP recombinant protein in a TRIS buffer, and identifying SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) of the purified SODCP recombinant protein as shown in figure 1.
Example 3: preparation of polyclonal antibody serum
The immune animals are selected from healthy New Zealand white rabbits with the age of about three months and the weight of about 2.5kg, and the antigens prepared in the example 2 are used for animal immunization, and the specific steps are as follows:
before the first immunization, blood is taken through ear veins to serve as a negative control; antigen was treated with PBS (137mM NaCl, 2.7mM KCl, 10mM Na)2HPO4，2mM KH2PO4pH 7.4) to 1 mg. mL-1(calculated as carrier protein), subpackaging and storing at-20 ℃; 500. mu.L of 1 mg/mL-1Diluting antigen (0.5 mg, adding 300 μ L PBS, diluting again, adding equal volume of Freund's complete adjuvant (first immunization) or Freund's incomplete adjuvant (second to fourth immunization), mixing and emulsifying on a vortex instrument, performing subcutaneous multi-point injection on four limbs, oxter and back of rabbit, performing second immunization after three weeks of first immunization, boosting once every two weeks (4 times of immunization), taking blood via ear vein after 7 days of third immunization, determining antibody titer, bleeding carotid artery after 11 days of fourth immunization, collecting blood sample, standing blood sample at 4 deg.C overnight or 37 deg.C for 3h, centrifuging at 4 deg.C for 10min at 5000rpm, collecting serum, subpackaging, and storing at-80 deg.C.
Example 4: preparation of rice Cu/Zn-SOD protein polyclonal antibody
Ammonium sulfate precipitation method for concentrating protein samples: diluting 20mL of serum to 100mL by using TBS buffer solution, adding saturated ammonium sulfate solution while stirring the solution until the concentration of the ammonium sulfate solution reaches 50-60%, and stirring overnight by using a magnetic stirrer at 4 ℃; centrifuging the solution containing a large amount of precipitates the next day, discarding the supernatant, and retaining the precipitates; adding 10mL of PBS buffer solution containing sodium azide to dissolve the precipitate, and dialyzing with a dialysis bag (changing the dialysate every 4 hours for six times) to remove ammonium sulfate; after dialysis, the solution in the dialysis bag was centrifuged, and the supernatant was collected.
Affinity chromatography purification of anti-polypeptide antibodies: subjecting the dialyzed and centrifuged protein solution to centrifugation at a flow rate of 0.5 mL/min-1The protein is added into a chromatographic column (protein A FF), and the protein needs to be continuously loaded into the column twice to ensure the full combination of the antibody protein and the filler; washing the chromatographic column with TBS until A280nm of the eluent is less than 0.008, eluting with an elution buffer (50mM glycine, pH2.2) at the same speed, collecting the eluent with a centrifuge tube into which a neutralization buffer (1M Tris-HCl, pH9.0, 1.5M NaCl, 1mM EDTA) is added in advance, uniformly mixing, checking the pH of the solution with a pH test paper, adjusting the pH to about pH 7.4 with the neutralization buffer if the pH is less than 7.4 to prevent the antibody from being denatured, simultaneously detecting the concentration of the antibody, finally adding glycerol with the same volume, and storing at-20 ℃ to obtain the purified polyclonal antibody.
The highest concentration of the detected and purified antibody is 2 mg/mL-1And 23mg of antibody is co-purified by 20mL of serum, and the yield of the polyclonal antibody is higher.
Example 5: specificity test of polyclonal antibody on rice Cu/Zn-SOD protein
Taking 4 rice seeds of different strains, germinating in a tissue culture chamber, removing roots, quickly freezing with liquid nitrogen, and storing at-80 deg.C.
Taking 0.5g of leaf sample of each rice variety, fully grinding the leaf sample by using liquid nitrogen, and mixing the ground leaf sample with the liquid nitrogen according to the weight ratio of 1: 2, adding protein extraction buffer (50mM Tris-HCl, pH 8.0, 2mM EDTA, 1mM PMSF) precooled on ice, quickly mixing uniformly, placing on ice, incubating for 30min, and mixing uniformly by vortex every 10 min; centrifuging at 4 ℃ and 12000rpm for 20min, and taking the supernatant as the total protein of the rice leaf; after quantification of the protein by Bradford assay, the supernatant was mixed with an equal volume of SDS-PAGE loading buffer and stored at-80 ℃.
Carrying out SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) electrophoretic separation on the extracted rice protein, wherein the loading amount is 30 mu g; and (3) rapidly transferring the separated protein onto the nitrocellulose membrane by a groove type transfer printing system (with high electric field intensity), and sealing the nitrocellulose membrane for 1-2 h at room temperature by using a sealing solution (TBS [20mM Tris-HCl, pH7.5 and 500mM NaCl ] containing 5% skimmed milk powder). Using the polyclonal antibody prepared in example 4, the blocking solution containing 0.05% Tween-20 was mixed at a ratio of 1: 2500% dilution, incubation with blocked membranes for 1h at 37 deg.C, washing the membranes 5 times with TTBS (20mM Tris-HCl, pH7.5, 500mM NaCl, 0.05% Tween-20) for 10min each, washing the membranes with blocking solution containing 0.05% Tween-20 at a temperature of 1: an HRP-labeled goat anti-rabbit secondary antibody (ABCAM, ab6721) is diluted at a ratio of 20000, and incubated with the washed membrane at 37 ℃ for 1h, and the membrane is washed 5 times with TTBS for 10min each time. The membrane was blotted dry with filter paper, placed in the instrument, and the luminescent solution (Thermo Pierce chemiluminesced ECL photobase, NCI4106) was added, machine exposed, and the pictures were saved.
The result of the specificity test of the polyclonal antibody on the rice Cu/Zn-SOD protein is shown in figure 2, and the antibody is expressed by the ratio of 1: 2500 dilution can still detect Cu/Zn-SOD in four rice samples, which shows that the prepared antibody has higher titer, strong affinity, only one main band, molecular weight of about 19kD, consistent with theoretical results and very high specificity.
Sequence listing
<110> Hunan agriculture university
<120> preparation method and application of rice Cu/Zn-SOD polyclonal antibody
<160>8
<170>SIPOSequenceListing 1.0
<210>1
<211>211
<212>PRT
<213> SODCP amino acid sequence ()
<400>1
Met Gln Ala Ile Leu Ala Ala Ala Met Ala Ala Gln Thr Leu Leu Phe
1 5 10 15
Ser Ala Thr Ala Pro Pro Ala Ser Leu Phe Gln Ser Pro Ser Ser Ala
20 25 30
Arg Pro Phe His Ser Leu Arg Leu Ala Ala Gly Pro Ala Gly Ala Ala
35 40 45
Ala Ala Arg Ala Leu Val Val Ala Asp Ala Thr Lys Lys Ala Val Ala
50 55 60
Val Leu Lys Gly Thr Ser Gln Val Glu Gly Val Val Thr Leu Thr Gln
6570 75 80
Asp Asp Gln Gly Pro Thr Thr Val Asn Val Arg Val Thr Gly Leu Thr
85 90 95
Pro Gly Leu His Gly Phe His Leu His Glu Phe Gly Asp Thr Thr Asn
100 105 110
Gly Cys Ile Ser Thr Gly Pro His Phe Asn Pro Asn Asn Leu Thr His
115 120 125
Gly Ala Pro Glu Asp Glu Val Arg His Ala Gly Asp Leu Gly Asn Ile
130 135 140
Val Ala Asn Ala Glu Gly Val Ala Glu Ala Thr Ile Val Asp Lys Gln
145 150 155 160
Ile Pro Leu Ser Gly Pro Asn Ser Val Val Gly Arg Ala Phe Val Val
165 170 175
His Glu Leu Glu Asp Asp Leu Gly Lys Gly Gly His Glu Leu Ser Leu
180 185 190
Ser Thr Gly Asn Ala Gly Gly Arg Leu Ala Cys Gly Val Val Gly Leu
195 200 205
Thr Pro Leu
210
<210>2
<211>636
<212>DNA
<213> SODCP coding sequence ()
<400>2
atgcaagcca tcctcgccgc tgccatggcc gcccagaccc tcttgttctc cgccaccgcc 60
cctcccgcct cccttttcca gtccccttcc tctgcccgcc ctttccactc gctccgcctc 120
gccgccggcc ccgcgggcgc cgccgctgcc agggcgctcg tcgtcgccga cgccaccaag 180
aaggccgtcg ccgtgctcaa gggcacctcc caggttgagg gagtcgtcac cctcacccag 240
gatgaccaag gtcctacaac agtgaatgtc cgtgtgacgg gacttactcc tggacttcac 300
ggcttccacc tccacgagtt tggcgatact acgaatgggt gcatatcaac aggaccacat 360
tttaacccaa acaatttgac gcacggtgca ccagaagatg aagtccgtca tgcgggtgac 420
ctgggaaaca ttgttgccaa tgctgaaggt gtagctgagg caaccattgt tgataagcag 480
attcctctga gtggcccaaa ttctgttgtt gggagagcat tcgttgttca tgagcttgaa 540
gatgatttgg ggaagggtgg ccatgagctt agtctcagta ctggaaatgc tggtgggcga 600
cttgcatgcg gtgttgttgg gctgaccccg ttgtag 636
<210>3
<211>462
<212>DNA
<213> Artificial sequence ()
<400>3
gcaaccaaaa aagcggtcgc ggttctgaaa ggtaccagtc aggttgaagg cgttgttacc 60
ctgacccaag acgatcaagg tccgaccacc gttaatgttc gcgttaccgg tctgaccccg 120
ggtctgcacg gttttcatct gcacgaattc ggcgatacca ccaacggttg tattagtacc 180
ggtccgcatt tcaacccgaa taatctgacc catggtgcac cggaagacga agttcgtcac 240
gcaggcgatc tgggtaatat tgttgcgaac gcagaaggcg ttgcagaagc aaccattgtt 300
gacaaacaga ttccgctgtc tggtccgaat agcgttgttg gtcgcgcatt tgttgtccat 360
gaactggaag acgatctggg taaaggcggt catgaactga gtctgagtac cggtaacgct 420
ggcggtcgtc tggcttgcgg cgttgttggt ctgacgccgc tg 462
<210>4
<211>181
<212>PRT
<213> amino acid sequence of fusion protein ()
<400>4
Met Ala Ser Met Thr Gly Gly Gln Gln Met Gly Arg Gly Ser Ala Thr
1 5 10 15
Lys Lys Ala Val Ala Val Leu Lys Gly Thr Ser Gln Val Glu Gly Val
20 25 30
Val Thr Leu Thr Gln Asp Asp Gln Gly Pro Thr Thr Val Asn Val Arg
35 40 45
Val Thr Gly Leu Thr Pro Gly Leu His Gly Phe His Leu His Glu Phe
50 55 60
Gly Asp Thr Thr Asn Gly Cys Ile Ser Thr Gly Pro His Phe Asn Pro
65 70 75 80
Asn Asn Leu Thr His Gly Ala Pro Glu Asp Glu Val Arg His Ala Gly
85 90 95
Asp Leu Gly Asn Ile Val Ala Asn Ala Glu Gly Val Ala Glu Ala Thr
100 105 110
Ile Val Asp Lys Gln Ile Pro Leu Ser Gly Pro Asn Ser Val Val Gly
115 120 125
Arg Ala Phe Val Val His Glu Leu Glu Asp Asp Leu Gly Lys Gly Gly
130 135 140
His Glu Leu Ser Leu Ser Thr Gly Asn Ala Gly Gly Arg Leu Ala Cys
145 150 155 160
Gly Val Val Gly Leu Thr Pro Leu Lys Leu Ala Ala Ala Leu Glu His
165 170 175
His His His His His
180
<210>5
<211>459
<212>DNA
<213> SODCC1 coding sequence ()
<400>5
atggtgaagg ctgttgttgt gcttggtagc agtgagattg ttaagggcac tatccacttt 60
gtccaagagg gagatggtcc caccactgtg actggaagtg tctctggcct caagcctggt 120
ctccatgggt tccatattca tgcacttggt gacaccacca atggttgcat gtcaactggg 180
ccacactaca atcctgccgg aaaggagcat ggagcaccag aagatgagac ccgccatgct 240
ggtgatcttg gaaatgtcac cgctggagaa gatggtgttg ctaatatcca tgttgttgac 300
agtcagattc cacttactgg accaaattca atcattggca gagccgtcgt tgtgcatgcc 360
gatcctgatg atcttggaaa gggtgggcac gagctgagcaagaccaccgg aaacgctggt 420
ggccgtgttg cttgcgggat catcggactt caaggctga 459
<210>6
<211>152
<212>PRT
<213> SODCC1 amino acid sequence ()
<400>6
Met Val Lys Ala Val Val Val Leu Gly Ser Ser Glu Ile Val Lys Gly
1 5 10 15
Thr Ile His Phe Val Gln Glu Gly Asp Gly Pro Thr Thr Val Thr Gly
20 25 30
Ser Val Ser Gly Leu Lys Pro Gly Leu His Gly Phe His Ile His Ala
35 40 45
Leu Gly Asp Thr Thr Asn Gly Cys Met Ser Thr Gly Pro His Tyr Asn
50 55 60
Pro Ala Gly Lys Glu His Gly Ala Pro Glu Asp Glu Thr Arg His Ala
65 70 75 80
Gly Asp Leu Gly Asn Val Thr Ala Gly Glu Asp Gly Val Ala Asn Ile
85 90 95
His Val Val Asp Ser Gln Ile Pro Leu Thr Gly Pro Asn Ser Ile Ile
100 105 110
Gly Arg Ala Val Val Val His Ala Asp Pro Asp Asp Leu Gly Lys Gly
115 120 125
Gly His Glu Leu Ser Lys Thr Thr Gly Asn Ala Gly Gly Arg Val Ala
130 135 140
Cys Gly Ile Ile Gly Leu Gln Gly
145 150
<210>7
<211>458
<212>DNA
<213> SODCC2 coding sequence ()
<400>7
atggtgaagg ctgttgctgt gcttgctagc agtgagggtg tcaagggcac catctttttc 60
tcccaagagg gagatggtcc gacctctgtg acgggaagtg tctctgggct caagccaggg 120
ctccatggat tccatgtgca cgcgctcggt gacaccacta tggctgcatg tcaactggac 180
cacacttcaa tcctactggg aaggaacatg gggcaccaca agatgagaac cgccatgccg 240
gtgatcttgg aaatataaca gctggagcag atggtgttgc taatgtcaat gtctctgaca 300
gccagatccc ccttactgga gcacactcca tcattggccg agctgttgtt gtccatgctg 360
atcctgatga tcttggcaag ggtggacatg agcttagcaa gaccactgga aatgctgggg 420
gccgagttgc ttgcggaatc atcggactcc agggttag 458
<210>8
<211>152
<212>PRT
<213> SODCC2 amino acid sequence ()
<400>8
Met Val Lys Ala Val Ala Val Leu Ala Ser Ser Glu Gly Val Lys Gly
1 5 10 15
Thr Ile Phe Phe Ser Gln Glu Gly Asp Gly Pro Thr Ser Val Thr Gly
20 25 30
Ser Val Ser Gly Leu Lys Pro Gly Leu His Gly Phe His Val His Ala
35 40 45
Leu Gly Asp Thr Thr Asn Gly Cys Met Ser Thr Gly Pro His Phe Asn
50 55 60
Pro Thr Gly Lys Glu His Gly Ala Pro Gln Asp Glu Asn Arg His Ala
65 70 75 80
Gly Asp Leu Gly Asn Ile Thr Ala Gly Ala Asp Gly Val Ala Asn Val
85 90 95
Asn Val Ser Asp Ser Gln Ile Pro Leu Thr Gly Ala His Ser Ile Ile
100 105 110
Gly Arg Ala Val Val Val His Ala Asp Pro Asp Asp Leu Gly Lys Gly
115 120 125
Gly His Glu Leu Ser Lys Thr Thr Gly Asn Ala Gly Gly Arg Val Ala
130 135 140
Cys Gly Ile Ile Gly Leu Gln Gly
145 150
Claims (7)
1. A preparation method of a rice Cu/Zn-SOD polyclonal antibody is characterized by comprising the following steps:
(1) by analyzing and predicting the epitope of Cu/Zn-SOD protein of rice chloroplast, the SODCP protein sequence without transit signal peptide is used for constructing recombinant plasmid;
(2) constructing a SODCP recombinant plasmid, preparing SODCP recombinant protein, and taking the SODCP recombinant protein as an antigen;
(3) preparing a Cu/Zn-SOD polyclonal antibody of rice by antigen immunoreaction;
in the step (1), peptide segments at 1-57 th positions in the SODCP protein sequence are transit peptides, and peptide segments at 58-211 th positions are rice chloroplast Cu/Zn-SOD; the amino acid sequence of the SODCP protein is shown as SEQ ID NO. 1, and the nucleotide sequence of the coding region is shown as SEQ ID NO. 2;
in the step (2), the specific method is as follows:
s1, intercepting a nucleotide sequence corresponding to the 58-211 bit peptide segment of the SODCP protein from SEQ ID NO. 2, and optimizing to obtain SEQ ID NO. 3;
s2, carrying out gene synthesis on SEQ ID NO. 3, inserting the synthetic sequence into an escherichia coli expression vector, constructing a recombinant plasmid, sequencing the recombinant plasmid, translating the base sequence of the recombinant protein coding region into an amino acid sequence, and obtaining a fusion protein sequence of SEQ ID NO. 4;
s3, introducing the recombinant plasmid in the step S2 into an escherichia coli expression system for recombinant protein expression, optimizing expression conditions, and separating and purifying to obtain the SODCP recombinant protein.
2. The method for preparing a rice Cu/Zn-SOD polyclonal antibody according to claim 1, wherein in the step (3), the rice Cu/Zn-SOD polyclonal antibody is prepared by the following steps: immunizing an animal with the antigen, and separating and purifying serum from the immunized animal to obtain the polyclonal antibody with good specificity and strong sensitivity.
3. The method for preparing a rice Cu/Zn-SOD polyclonal antibody according to claim 2, wherein the immunized animal is any one of rabbit, mouse, rat, and goat.
4. The method for producing a polyclonal antibody against Cu/Zn-SOD of rice as claimed in claim 2, wherein the purification method is affinity chromatography.
5. The rice Cu/Zn-SOD polyclonal antibody prepared by the method for preparing the rice Cu/Zn-SOD polyclonal antibody according to any one of claims 1 to 4.
6. The use of the rice Cu/Zn-SOD polyclonal antibody according to claim 5, wherein the rice Cu/Zn-SOD polyclonal antibody is used for detecting rice Cu/Zn-SOD protein.
7. A reagent for detecting a rice Cu/Zn-SOD protein, which comprises the rice Cu/Zn-SOD polyclonal antibody of claim 5.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910238592.3A CN109810196B (en) | 2019-03-27 | 2019-03-27 | Preparation method and application of rice Cu/Zn-SOD polyclonal antibody |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910238592.3A CN109810196B (en) | 2019-03-27 | 2019-03-27 | Preparation method and application of rice Cu/Zn-SOD polyclonal antibody |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109810196A CN109810196A (en) | 2019-05-28 |
| CN109810196B true CN109810196B (en) | 2020-08-25 |
Family
ID=66610488
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910238592.3A Expired - Fee Related CN109810196B (en) | 2019-03-27 | 2019-03-27 | Preparation method and application of rice Cu/Zn-SOD polyclonal antibody |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109810196B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114703154B (en) * | 2022-03-30 | 2024-01-09 | 云南大学 | Polypeptide, protein containing same and application |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1301744A (en) * | 1999-12-27 | 2001-07-04 | 上海博德基因开发有限公司 | New polypeptide-Cu/Zn SOD protein family 9 and polynucleotide coding such polypeptide |
-
2019
- 2019-03-27 CN CN201910238592.3A patent/CN109810196B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN109810196A (en) | 2019-05-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| LeDizet et al. | Identification of an acetylation site of Chlamydomonas alpha-tubulin. | |
| EP2756077B1 (en) | Endoglycosidase from streptococcus pyogenes and methods using it | |
| Marmagne et al. | Identification of new intrinsic proteins in Arabidopsis plasma membrane proteome | |
| CN111349617B (en) | Hybridoma cell strain secreting anti-Tau or pTau-181/231/396 monoclonal antibody and application thereof | |
| CN105829348A (en) | Fusion protein for protein detection, and method for detecting protein | |
| CN109810196B (en) | Preparation method and application of rice Cu/Zn-SOD polyclonal antibody | |
| CN109627306B (en) | Epitope of glutelin GluA2 subunit of rice grain, antibody and application thereof | |
| CN108179149B (en) | S100B mutant and application thereof | |
| CN110845582B (en) | Preparation of feline parvovirus recombinant protein and monoclonal antibody thereof | |
| CN113004386B (en) | Grass carp anaphylactic toxin C5a recombinant protein and polyclonal antibody thereof | |
| CN113832132B (en) | Solder tip SVMP protein specific short peptide, solder tip SVMP protein antibody and snake bite detection kit | |
| KR101962865B1 (en) | Method for manufacturing the antigen and the antibody for diagnosing stress and composition and kit for diagnosing stress | |
| CN112094853A (en) | White spot syndrome virus VP28 gene, recombinant protein, polyclonal antibody, preparation method and application | |
| CN116082512B (en) | Monoclonal antibody for CDKn1A_p21CIP1 protein, and preparation method and application thereof | |
| CN114230661B (en) | Antibody for detecting tomato yellow mottle related virus as well as preparation method and application thereof | |
| CN112553233B (en) | Tulp2 polyclonal antibody and preparation method and application thereof | |
| CN111763260B (en) | PTEN-Long polyclonal antibody, preparation method and application thereof | |
| CN108840914B (en) | Polypeptide with immunogenicity, preparation method and application of antibody thereof | |
| CN108396013B (en) | Gold-labeled test strip for detecting global regulatory factor IrrE protein and transgenic crops thereof | |
| AU2021103418A4 (en) | Preparation method of spvd recombinant double cp fusion protein and method for detecting spvd | |
| CN116813767A (en) | FGF21 protein polyclonal antibody preparation method | |
| Berzborn et al. | Protein sequence and structure of N-terminal amino acids of subunit delta of spinach photosynthetic ATP-synthase CF1 | |
| CN112014559A (en) | Double-antibody sandwich enzyme-linked immunosorbent assay kit for rice stripe virus and preparation and detection methods thereof | |
| CN105886475B (en) | Monoclonal antibody of catalytic subunit of DNA-dependent protein kinase and application | |
| Ramírez-Sotelo et al. | An ELISA-based method for Galleria mellonella apolipophorin-III quantification |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20200825 Termination date: 20210327 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |