CN108396013B

CN108396013B - Gold-labeled test strip for detecting global regulatory factor IrrE protein and transgenic crops thereof

Info

Publication number: CN108396013B
Application number: CN201810119675.6A
Authority: CN
Inventors: 周正富; 张维; 刘奇; 郑健; 陈明; 林敏�
Original assignee: Biotechnology Research Institute of CAAS
Current assignee: Biotechnology Research Institute of CAAS
Priority date: 2018-02-06
Filing date: 2018-02-06
Publication date: 2020-11-27
Anticipated expiration: 2038-02-06
Also published as: CN108396013A

Abstract

The invention provides a pair of hybridoma cell strains, which comprise a first hybridoma cell strain and a second hybridoma cell strain which are independently stored; the preservation number of the first hybridoma cell strain is CGMCC NO. 12270; the preservation number of the second hybridoma cell strain is CGMCC NO. 12271. The invention also provides a pair of paired monoclonal antibodies secreted by the two hybridoma cells, application of the paired monoclonal antibodies in detection of transgenic crops transformed with IrrE, an immune colloidal gold test strip and a method for detecting transgenic crops transformed with IrrE. Through the technical scheme, the immune colloidal gold test strip can achieve the sensitivity of 1ng/mL for the detection of IrrE protein, does not show cross reaction for 28 non-transgenic crops and 16 various non-IrrE transgenic crops with different sources, and has higher sensitivity and specificity.

Description

Gold-labeled test strip for detecting global regulatory factor IrrE protein and transgenic crops thereof

Technical Field

The disclosure relates to the technical field of agricultural biology, in particular to a hybridoma cell pair, a monoclonal antibody pair, application of the monoclonal antibody pair in detection of IrrE protein and an immune colloidal gold test strip.

Background

Deinococcus radiodurans (Deinococcus radiodurans) are bacterial strains that have been found to be very resistant to a variety of DNA damaging agents including ionizing radiation, hydrogen peroxide, ultraviolet radiation, mitomycin C, and drought. The genome research institute in the United states in 1999 completes the whole genome sequencing of deinococcus radiodurans, and lays an important theoretical foundation for the research of the resistance mechanism of the deinococcus radiodurans.

Research shows that irrE gene in deinococcus radiodurans encodes a deinococcus specific protein, is a switch gene of a DNA repair and protection pathway which is unique to the genus and extremely important, and plays an important role in repairing DNA damage. The gene mutation causes the loss of various stress resistances of the strain. The irrE gene is considered to be a novel promoter responsible for extreme stress resistance, and plays a central regulatory role in various DNA damage repair and protection pathways of extreme stress reactions. IrrE is constitutively expressed in Escherichia coli, so that the ionizing radiation resistance of the Escherichia coli is improved by about 1.6 times. IrrE induces the expression of RecA protein in E.coli following ionizing radiation. Meanwhile, the activity of catalase KatG in the cells after ionizing radiation is enhanced, and the scavenging capacity of the cells to oxygen free radicals is further improved. The results of abiotic stress experiments such as 3M sorbitol impact, 1% hydrogen peroxide impact, 53 ℃ high temperature impact and the like show that IrrE has the function of improving the osmotic stress, the oxidative stress and the high temperature stress of escherichia coli. Meanwhile, IrrE is found to improve the salt tolerance of Escherichia coli. IrrE protein is over-expressed in rape by using cauliflower mosaic virus 35S promoter. The transgenic rape expressing IrrE has no difference with the control plant in the growth processes of germination, growth, flowering, seed setting and the like, but shows excellent salt and drought resistance. Transgenic plants were able to normally flower knots 6 weeks after 350mM sodium chloride treatment, whereas control plants were all dead at 2 weeks of treatment. Researches find that the expression of stress-induced proteins CBF1 and CBF3, plasma membrane sodium transporter SOS1 and superoxide dismutase SOD in transgenic plants expressing IrrE under the stress of high-concentration salt is obviously up-regulated. The global regulatory factor IrrE is presumed to improve the salt-tolerant and drought-resistant capability of transgenic plants by directly or indirectly up-regulating the expression of the proteins.

The development of modern biotechnology provides a way for cultivating new crops by using exogenous genes. During the development, screening or safety evaluation of transgenic products, transgenic biological detection technology is needed to perform qualitative or semi-quantitative determination on the transferred exogenous gene. The existing detection technologies, such as an enzyme immunoassay method and an radioimmunoassay, require special instruments (an enzyme labeling instrument, an radioimmunoassay, a centrifuge, etc.) and special fields, are long in detection time (the enzyme immunoassay time needs 2 hours, and the radioimmunoassay needs about 3 hours), high in detection cost, and limited in practical popularization and application space, and require professional operators for detection. Therefore, a device which is simple and convenient to operate, accurate and reliable in result and capable of rapidly detecting IrrE protein in transgenic plants is needed.

The immune combination colloidal gold chromatography is an application form formed by combining an immune gold labeling technology and antigen-antibody reaction. The immune-binding colloidal gold chromatography utilizes the principle of antigen-antibody reaction, and comprises implementation methods such as a double-antibody sandwich method, a double-antigen sandwich method, a capture method and a competition inhibition method, wherein the double-antibody sandwich method is most widely applied.

The double antibody sandwich method utilizes a pair of antibodies directed against different epitopes to detect biomolecules having multiple antigenic sites. The technical scheme of the specific implementation is as follows: firstly, coating known specific antibody (monoclonal antibody or polyclonal antibody) on a microporous membrane according to a certain concentration as a detection zone, and coating a secondary antibody capable of being combined with a gold standard on the membrane as a quality control zone. And (3) labeling another monoclonal antibody matched with the coated antibody by using colloidal gold, coating the formed gold-labeled conjugate on a gold-labeled pad, and drying. The membrane and the sample pad are connected to the two ends of the dried gold label pad respectively. The other side of the membrane is stuck with a water absorption pad. During detection, a certain amount of liquid sample is added on the sample pad, and the sample moves towards the water absorption pad by virtue of capillary action. Firstly, drying a gold-labeled pad, redissolving a gold-labeled conjugate, and carrying out antigen-antibody reaction to form a complex A (gold particles-antibody-antigen) if an antigen to be detected is in a specimen; when the sample continues to move to reach the position of the detection zone, the sample and the coating antibody react again to form a complex B (gold particle-antibody-antigen-coating antibody), the complex B is gathered at the position of the detection zone and finally reaches the macroscopic degree, and if no antigen to be detected exists in the sample or the concentration of the antigen to be detected is lower than the detection range, a macroscopic red strip cannot be formed. The free gold-labeled conjugate or complex a crosses the detection zone to reach the quality control zone, and reacts with the secondary antibody to form complex C (gold particle-antibody-secondary antibody), which aggregates and produces a red band visible to the naked eye. The quality control band shows a red band regardless of whether the sample contains the substance to be detected.

The immune-binding colloidal gold chromatography has the advantages of simple and rapid operation, single-part detection and no need of special equipment. However, the existing immune-binding colloidal gold chromatography generally has certain defects, such as low sensitivity, insufficient quality control capability, overlarge variation coefficient among batches, in batches and among different reagents, and the like. Therefore, improving the sensitivity and specificity of the anti-monoclonal antibody pair is an important means for making up the defects of the immune binding colloidal gold chromatography.

Disclosure of Invention

The invention aims to provide a method for detecting IrrE-transferred transgenic crops by a sensitive and specific immune-binding colloidal gold chromatography.

In order to achieve the above objects, in one aspect, the present invention provides a hybridoma cell pair, wherein the hybridoma cell pair includes a first hybridoma cell line and a second hybridoma cell line which are independently stored; the preservation number of the first hybridoma cell strain is CGMCC NO. 12270; the preservation number of the second hybridoma cell strain is CGMCC NO. 12271.

In yet another aspect, the present invention provides a monoclonal antibody pair comprising a first monoclonal antibody and a second monoclonal antibody stored separately; the first monoclonal antibody is produced by a first hybridoma cell strain; the second monoclonal antibody is produced by a second hybridoma cell strain; the preservation number of the first hybridoma cell strain is CGMCC NO. 12270; the preservation number of the second hybridoma cell strain is CGMCC NO. 12271.

In still another aspect, the invention also provides the use of the monoclonal antibody pair as described above in the detection of IrrE-transgenic crops.

On the other hand, the invention also provides immune colloidal gold test paper which comprises a water absorption pad, a basal membrane, a gold label pad and a sample pad which are sequentially connected; the membrane is characterized in that a quality control line (C line) and a detection line (T line) are arranged on the basement membrane, an anti-mouse IgG antibody is coated on the C line, a first monoclonal antibody is coated on the T line, a colloidal gold labeled second monoclonal antibody is contained in the gold labeled pad, and the first monoclonal antibody and the second monoclonal antibody form a monoclonal antibody pair, wherein the monoclonal antibody pair is the monoclonal antibody pair.

In still another aspect, the present invention provides a method for detecting an IrrE-transformed transgenic crop, wherein the method comprises the steps of: s1, extracting holoprotein from the crops to be detected; s2, carrying out immune colloidal gold test paper detection or double-anti sandwich enzyme linked immune detection on the whole protein by using the monoclonal antibody pair; s3, if the positive result of IrrE appears in the result of immune colloidal gold test paper detection or double-anti-sandwich enzyme linked immune detection, indicating that the crop to be detected is the transgenic crop which is transferred with the IrrE.

By the technical scheme, the immune colloidal gold test paper can achieve the sensitivity of 1ng/mL for detecting IrrE protein, does not show cross reaction for 28 non-transgenic crops and 16 various non-IrrE transgenic crops with different sources, and has higher sensitivity and specificity.

Additional features and advantages of the invention will be set forth in the detailed description which follows.

Biological material preservation

The first hybridoma cell strain is obtained by self-fusion screening of the inventor, the preservation number is CGMCC NO.12270, the preservation date is 2016, 04, 07 days, the preservation unit is the common microorganism center of China Committee for culture Collection of microorganisms, the address is the microorganism research institute of China academy of sciences No.3, North Cheng West Lu No.1, of the sunward area in Beijing, and the first hybridoma cell strain is named as an anti-IrrE monoclonal antibody hybridoma cell strain in a classified manner.

The second hybridoma cell strain is obtained by self-fusion screening of the inventor, the preservation number is CGMCC NO.12271, the preservation date is 2016, 04, and 07 days, the preservation unit is the common microorganism center of China Committee for culture Collection of microorganisms, the address is the microorganism research institute of China academy of sciences No.3, North Cheng West Lu No.1, of the sunward area in Beijing, and the second hybridoma cell strain is named as an anti-IrrE monoclonal antibody hybridoma cell strain in a classified manner.

Drawings

The accompanying drawings, which are included to provide a further understanding of the disclosure and are incorporated in and constitute a part of this specification, illustrate embodiments of the disclosure and together with the description serve to explain the disclosure without limiting the disclosure. In the drawings:

FIG. 1 is a graph showing the expression and purification results of His-Tag IrrE fusion protein in example 1.

FIG. 2 is a graph showing the results of qualitative or semi-quantitative detection using the color shade of the signal generated by colloidal gold in example 2.

FIG. 3 is a graph showing the results of specific detection experiments performed on 28 non-transgenic crops and 16 transgenic crops (Table 1) from different sources using the color shade of signals generated by colloidal gold in example 2.

FIG. 4 is a schematic diagram of an assembly structure of the immuno-colloidal gold test strip.

Description of the reference numerals

1 sample pad 2 is padded by substrate plate 3 colloidal gold

4T line 5C line 6 cellulose membrane

7 absorbent pad

Detailed Description

The following detailed description of specific embodiments of the present disclosure is provided in connection with the accompanying drawings. It should be understood that the detailed description and specific examples, while indicating the present disclosure, are given by way of illustration and explanation only, not limitation.

In one aspect, the invention provides a hybridoma cell pair, wherein the hybridoma cell pair comprises a first hybridoma cell strain and a second hybridoma cell strain which are independently stored; the preservation number of the first hybridoma cell strain is CGMCC NO. 12270; the preservation number of the second hybridoma cell strain is CGMCC NO. 12271.

In still another aspect, the invention also provides the monoclonal antibody and the application of the monoclonal antibody pair in the detection of transgenic crops with IrrE.

Wherein, optionally, the crop is broccoli, canola, cotton, corn, rice, or soybean.

The IrrE protein is a protein encoded by the IrrE Gene, and the IrrE Gene is a Gene having NCBI Gene ID of 1798483 (Gene No.: DR-0167).

On the other hand, the invention also provides immune colloidal gold test paper which comprises a water absorption pad, a basal membrane, a gold label pad and a sample pad which are sequentially connected; the basal membrane is provided with a C line and a T line, the C line is coated with an anti-mouse IgG antibody, the T line is coated with a first monoclonal antibody, the gold-labeled pad contains a second monoclonal antibody labeled by colloidal gold, and the first monoclonal antibody and the second monoclonal antibody form a paired monoclonal antibody. Wherein the paired monoclonal antibodies are the pairs of monoclonal antibodies described above.

Wherein the first monoclonal antibody is produced by a first hybridoma cell line; the second monoclonal antibody is produced by a second hybridoma cell strain; the preservation number of the first hybridoma cell strain is CGMCC NO. 12270; the preservation number of the second hybridoma cell strain is CGMCC NO. 12271.

The detection principle of the immune colloidal gold test paper may include: dripping a sample to be detected into a sample pad, wherein if IrrE protein exists in the sample, the IrrE protein in the sample to be detected is firstly combined with a second monoclonal antibody marked by colloidal gold, due to capillary action, a complex formed by the IrrE protein and the second monoclonal antibody marked by the colloidal gold swims forwards along a basement membrane, and meets a first monoclonal antibody coated on a cellulose nitrate base membrane when reaching a detection line, and as the first monoclonal antibody and the second monoclonal antibody can be respectively combined with different antigen epitopes of the IrrE protein, a complex of the second monoclonal antibody marked by the colloidal gold, the IrrE protein and the first monoclonal antibody is formed, so that the colloidal gold is enriched on the detection line, and a specific red chromatographic line is formed; the second monoclonal antibody which is not combined with the IrrE protein and marked by the colloidal gold directly passes through the detection line, reaches the quality control line and is captured by goat anti-mouse IgG on the quality control line, so that the colloidal gold is enriched on the quality control line to form a red chromatography line, and the result is judged to be positive; if no IrrE protein exists in the sample, the complex of the second monoclonal antibody marked by the colloidal gold, the IrrE protein and the first monoclonal antibody cannot be formed on the detection line, so that the detection line cannot generate macroscopic color reaction, the second monoclonal antibody marked by the colloidal gold and not combined with the IrrE protein directly passes through the detection line and is captured by goat anti-mouse IgG on the quality control line after reaching the quality control line, and the colloidal gold is enriched on the quality control line to form a red chromatography line, namely, the result is judged to be negative.

In the present invention, the method for preparing and purifying the first monoclonal antibody and the second monoclonal antibody, respectively, using the hybridoma cell line having the collection number of CGMCC NO.12270 and the hybridoma cell line having the collection number of CGMCC NO.12271 may be a method which is conventional in the art, such as a mouse ascites method and an affinity chromatography method.

In the present invention, the method for labeling a monoclonal antibody with colloidal gold may be a method that is conventional in the art, and may include, for example: 0.01% by weight of HAuCl₄Heating the solution to boil, adding 1 wt% trisodium citrate solution until the solution color is completely transparent red, continuously refluxing for 10min, stopping heating, and cooling to room temperature to obtain colloidal gold; 1mL of prepared colloidal gold is taken and added with 1 weight percent of K₂CO₃Adjusting the pH value to 8.0, adding 15 mu g of monoclonal antibody, mixing uniformly, and reacting at room temperature for 40 min; adding 5 wt% BSA to a final concentration of 0.1 wt%, and standing for 30 min; centrifuging at low speed (1500 Xg) for 15min to remove precipitate formed by the coagulated gold particles; then centrifuging for 30 minutes by 10000 Xg; the supernatant was carefully aspirated off, and the pellet was redissolved with 0.1mL of 0.1M PBS containing 1% BSA (pH7.4), and 5% sodium azide was added to a final concentration of 0.05% and stored at 4 ℃.

In the present invention, the method for preparing the immune colloidal gold test strip may be a method conventional in the art, and may include, for example: spraying the first monoclonal antibody and goat anti-mouse IgG on a nitrocellulose membrane by using a gold spraying and film spotting machine to form a detection T line and a quality control C line which are parallel to each other, and then drying; uniformly spraying the second monoclonal antibody marked by the colloidal gold on the gold mark pad by using a gold spraying and spotting machine; then the sample pad, the gold label pad, the base film (nitrocellulose film) sprayed with the T line and the C line and the absorbent paper are sequentially connected and assembled, and then the sample pad, the gold label pad, the base film sprayed with the T line and the C line and the absorbent paper are cut and packaged for standby.

Optionally, the second monoclonal antibody labeled with colloidal gold contained in the gold-labeled pad is obtained by spraying a solution of the second monoclonal antibody labeled with colloidal gold at a spraying speed of 0.5-5 μ L/cm onto the gold-labeled pad through a gold spraying spotting film machine and drying the gold-labeled pad.

Optionally, the first monoclonal antibody coated on the T-line is obtained by spraying a 0.2-5mg/mL first monoclonal antibody solution on the T-line at a spraying speed of 0.2-4 μ L/cm through a gold spraying and spotting machine, and drying.

Optionally, the goat anti-mouse IgG antibody coated on the C line is obtained by spraying a 0.2-5mg/mL goat anti-mouse IgG antibody solution on the C line at a spraying speed of 0.2-4 μ L/cm through a gold spraying membrane machine and drying.

The method according to any of the above, optionally wherein the crop plant is broccoli, canola, cotton, corn, rice or soybean.

The invention is illustrated in further detail by the following examples:

example 1

And (4) inducible expression and purification of IrrE protein.

According to published genome sequence information of the deinococcus radiodurans, a specific primer is designed to amplify a target gene fragment. Extracting the genome DNA of the deinococcus radiodurans by using a rhizobacteria genome extraction kit. The extracted and purified genome DNA of the deinococcus radiodurans is taken as a template, a specific primer IrrE (F)/IrrE (R) is utilized to carry out PCR reaction, the IrrE gene sequence of the deinococcus radiodurans is amplified, and high-fidelity polymerase is utilized to carry out amplification in the PCR reaction so as to ensure the accuracy of DNA fragments. Primers used for PCR were IrrE (F): 5'-CACAGGAGGACCCCATATGCCCAGTGC-3' (SEQ ID NO.1) and IrrE (R):5'-ACCAAGCTTAGTTCACTGTG-3' (SEQ ID NO. 2).

The upstream and downstream of the PCR product contain Nde I and Hind III restriction enzyme cutting sites respectively. The obtained PCR product was purified and recovered, and then digested with restriction enzymes Nde I and Hind III. The E.coli high expression vector pET28a was similarly digested with restriction enzymes Nde I and Hind III. And purifying and recovering the enzyme digestion product, connecting the enzyme digestion product under the action of T4DNA ligase, transforming the connection product into a common protein expression host strain BL21(DE3) through heat shock, and coating the recombinant strain on an LB solid culture medium containing kanamycin. Selecting a plurality of single colonies, sequentially transferring the single colonies to the same resistant plate, simultaneously transferring the single colonies to an LB liquid culture medium containing antibiotics for culture, and extracting plasmid DNA contained in thalli for enzyme digestion and PCR verification; the recombinant strain was also verified in the experiment using colony PCR technique. The obtained correct recombinant plasmid pET-IrrE is further verified by DNA sequencing. The sequencing result shows that the coding sequence of the IrrE gene is shown as SEQ ID NO.3, and the amino acid sequence of the coded protein is shown as SEQ ID NO. 4.

SEQ ID NO.4 is: MPSANVSPPCPSGVRGGGMGPKAKAEASKPHPQIPVKLPFVTAPDALAAAKARMRDLAAAYVAALPGRDTHSLMAGVPGVDLKFMPLGWRDGAFDPEHNVILINSAARPERQRFTLAHEIGHAILLGDDDLLSDIHDAYEGERLEQVIETLCNVAAAAILMPEPVIAEMLERFGPTGRALAELAKRAEVSASSALYALTEQTPVPVIYAVCAPGKPPREQAASDEDAGPSTEKVLTVRASSSTRGVKYTLASGTPVPADHPAALALATGMEVREESYVPFRSGRKMKAEVDAYPSRGIVAVSFEFDPARLGRKDSEQADRDEPQDAAQ, respectively; see in particular the sequence listing.

SEQ ID NO.3 is: ATGCCCAGTGCCAACGTCAGCCCCCCTTGCCCCTCTGGGGTAAGGGGCGGGGGGATGGGGCCAAAAGCTAAAGCTGAAGCCTCCAAGCCCCACCCCCAAATCCCTGTTAAGCTCCCATTCGTGACCGCCCCCGACGCCCTCGCCGCCGCCAAAGCCAGGATGCGCGACCTGGCGGCGGCCTACGTGGCGGCCCTGCCCGGACGCGACACCCACAGCCTGATGGCGGGGGTGCCCGGCGTAGACCTCAAATTCATGCCGCTCGGCTGGCGCGACGGGGCGTTCGACCCCGAGCACAACGTCATCCTCATCAACTCGGCGGCCCGCCCCGAACGCCAGCGCTTCACCCTCGCCCACGAAATCGGGCACGCGATTTTACTCGGCGACGACGACCTGCTCTCCGACATCCACGACGCCTACGAGGGCGAGCGGCTCGAACAGGTCATCGAAACGCTGTGCAACGTGGCGGCGGCGGCGATTTTGATGCCCGAACCCGTCATCGCGGAAATGCTGGAACGCTTCGGCCCCACCGGGCGCGCCCTCGCCGAACTCGCCAAGCGGGCCGAAGTCAGCGCGTCGTCGGCGCTCTACGCCCTGACCGAGCAGACCCCGGTGCCCGTCATCTACGCGGTCTGTGCGCCGGGCAAGCCTCCGCGTGAGCAGGCCGCAAGCGACGAGGACGCTGGCCCAAGCACAGAAAAAGTCCTGACGGTCCGCGCCAGCAGCTCGACGCGGGGCGTCAAGTACACCCTGGCGAGCGGCACGCCGGTACCCGCCGACCACCCGGCGGCGCTTGCCCTCGCCACGGGCATGGAAGTGCGCGAGGAAAGCTACGTGCCCTTTCGCTCGGGCCGGAAAATGAAGGCGGAGGTGGACGCCTACCCGTCGCGCGGCATCGTGGCCGTCAGTTTCGAGTTCGACCCCGCCCGCCTGGGCCGCAAGGACAGCGAGCAGGCCGACCGGGACGAGCCGCAGGACGCTGCACAGTGA, respectively; see in particular the sequence listing.

The gene in the constructed vector pET-IrrE for efficiently expressing the IrrE protein contains a stop codon, and the amino end of the expressed fusion IrrE protein carries 6His-Tag which can be used for separating and purifying the protein. BL21(DE3) strain containing the recombinant plasmid pET-IrrE was activated and transferred to fresh medium. The strain grows until the OD value is about 0.6, IPTG with the final concentration of 0.5mM is added into the culture medium, and the culture is carried out for 12h at the temperature of 16 ℃, and cells are induced to express IrrE protein. The fusion protein is purified by affinity chromatography by using His-Tag contained at the amino terminal of the IrrE fusion protein and NTA resin coupled with Ni-NTA. The target protein in the eluate of 40mM imidazole was collected and detected by SDS-PAGE, and the results are shown in FIG. 1. In FIG. 1, lane M is the molecular weight marker, lane 1 is the control strain whole cell protein; lane 2 shows the expression of IrrE cell soluble protein after IPTG induction; lane 3 shows the expression of IrrE cell-insoluble protein after IPTG induction; lane 4 is soluble protein loading effluent; lane 5 is NTA-0 eluate; lane 6 is purified His-Tag IrrE fusion protein, which is shown to have a higher purity.

Example 2

Preparation and identification of IrrE protein monoclonal antibody

Mixing 8W⁺The BALB/c female mice were divided into four groups by dose, and immunized 3 times by dose of 50, 100, 150, 200. mu.g/mouse (i.e., IrrE protein obtained in example 1). Taking eye blood before primary immunization as negative control, and adding equivalent volume of Freund's complete adjuvant for subcutaneous multi-point injection during primary immunization; one immunization was performed four weeks later, and multiple subcutaneous injections of the same dose of recombinant antigen plus an equal volume of Freund's incomplete adjuvant were performed. Coating the ELISA plate with the recombinant antigen about 10 days after the third immunization, and measuring the antibody titer of the mouse serum by indirect ELISA; three days before fusion the highest titer (1: 10) was obtained for the antibody⁵Above) mice tail vein injection of 50 ug recombinant IrrE protein to strengthen immunity. Cell fusion was performed three days after the booster immunization.

One day prior to cell fusion, feeder layer cells were prepared as follows: 1) mixing 8W⁺Healthy male BALB/c mice, sacrificed by cervical dislocationSoaking in 75% ethanol for 3-5 min; 2) moving into a super clean bench, cutting skin with sterile scissors, exposing peritoneum, and sterilizing peritoneum with 75% ethanol; 3) gently pulling up the peritoneum by using hemostatic forceps, injecting 10mL of pre-warmed 1640 liquid culture medium into the abdominal cavity by using an injector, gently kneading the abdominal cavity for 1-2min by using a cotton ball, sucking out cell suspension, and putting the cell suspension into a centrifugal tube; 4) centrifuging: 1000 Xg, 5min, abandoning the supernatant; 5) mixing the cells with 10mL HAT medium containing serum, counting the cells, and adjusting the cell density to 2 × 10⁵Per mL; 6) the cell suspension was added to a 96-well cell culture plate at 100. mu.L/well, and the cell density was 2X 10⁴A hole; 7) standing at 37 deg.C for 5% CO₂And (5) culturing in an incubator for the next day of fusion experiment.

Preparation of myeloma cell SP 2/0: 1) harvesting SP2/0 cells in logarithmic growth phase, washing with 1640 liquid culture medium for 3 times, centrifuging at 1000 Xg for 5min, and discarding the supernatant; 2) resuspend cells in 1640 liquid medium. 100 μ L of cell suspension was taken, stained with 0.2% trypan blue, cell counting was performed, cell viability > 95% was required, and cell density was adjusted for use.

Preparation of spleen cell suspension: 1) removing eyeball from BALB/c mouse immunized by impact 3 days ago, bleeding, cutting neck, killing, and soaking in 75% ethanol for 2 min; 2) moving the abdominal skin into a super clean bench, cutting the abdominal skin, and peeling the abdominal skin to two sides to expose the abdominal wall; the scissors and the forceps are changed, the peritoneum is cut open, the spleen is taken out, the fat and the connective tissue are removed, and the spleen is washed by a 1640 culture medium; 3) placing spleen on 200 mesh sieve, and lightly grinding with injector core; while washing with culture solution, collecting spleen cell suspension, centrifuging at 1000 Xg for 5min, and discarding supernatant; 4) resuspend cells in 1640 medium, centrifuge wash 2 times: 1000 Xg, 5min, abandoning the supernatant; 5) resuspend with 10mL incomplete medium. 100 μ L of the cell suspension was taken, stained with 0.2% trypan blue, requiring cell viability > 95%, and spleen cells were counted. The remaining cells are adjusted for cell density until use.

Cell fusion and culture: 1) mixing splenocytes and SP2/0 myeloma cells at a ratio of 5:1 in a 50mL centrifuge tube, centrifuging at 1000 Xg for 5min, discarding supernatant, and flicking the bottom of the centrifuge tube to loosen cell precipitate; 2) while uniformly rotating the centrifugal tube, 1mL of 50% PEG 4000 pre-warmed at 37 ℃ is added dropwise by a suction tube,is finished within 1 min; 3) adding 1mL of 1640 culture medium preheated at 37 ℃ to finish the process within 1 min; 4) adding 10mL of 1640 culture medium preheated at 37 ℃ to finish the process within 5 min; 5) centrifuging at 800 Xg for 8 min; resuspend the cell pellet with 100mL HAT medium; 6) the sensitivity of the cells to HAT was observed by transferring the cell suspension at 100. mu.L/well to feeder cells-seeded cell culture plates while leaving 2 wells with unfused SP2/0 cells as a control. The culture plate was incubated at 37 ℃ with 5% CO₂Culturing in an incubator; 7) after 3 days of fusion, 100. mu.L of fresh HAT medium was added to each well. Half a half of HAT culture solution is replaced every 3-5 days; 8) after 2 weeks, half the volume of HT medium was changed; 9) after 3-4 weeks, the medium was changed to complete medium to maintain the culture.

ELISA screening positive hybridoma cells: 1) when the fused cells grew to 1/4 of the bottom area of the culture well (about 12-15 days of culture), the supernatant was collected and tested for specific reaction and cross reaction by indirect ELISA, and hybridoma cells were selected. The recombinant protein IrrE is a coating antigen, and the coating concentration is 5 mug/mL of the conventional coating ELISA plate. 100 μ L/well of cell culture supernatant was added to the coated ELISA plates, and the positive control was immune mouse serum diluted 1:100 in PBS and the negative control was SP2/0 cell well culture supernatant. The cell supernatant and the coated ELISA plate are incubated at 37 ℃ for 30min, after full washing, 100 mu L/hole of goat anti-mouse IgG antibody (diluted by 1: 10000) marked by HRP is added, incubation is carried out at 37 ℃ for 30min, and the secondary antibody is discarded. After washing the plate thoroughly, 100. mu.L of TMB was added to each well for color development for 15min, and 50. mu.L of 1N H was added to each well₂SO₄The reaction was terminated. Determination of OD₄₅₀The value is obtained. 2) Screening by ELISA to obtain 98 cell strains secreting IrrE monoclonal antibody; the monoclonal antibodies secreted by the cell strains of the 98 IrrE monoclonal antibodies have positive reaction to recombinant IrrE protein. Selecting 37 strains of cells with the strongest positive reaction for further subcloning culture, directly performing amplification culture on the rest cell strains, freezing and storing and producing a small amount of ascites.

Cloning culture by limiting dilution method: 1) mixing the cells to be cloned by pipetting, diluting with HT selection culture medium containing 20% serum to density of 1 cell/well, adding into cell plate containing existing feeder cells, and placing in 5% CO₂Culturing in an incubator at 37 ℃; 2) cultured until day 4, and observed under an inverted microscopeAnd recording the cell monoclonal growth pores; culturing for about 1 week, sucking 100 μ L of the supernatant of the cell culture solution which has become yellow, and detecting the cell culture supernatant by the ELISA method; 3) subcloning the cells in the hole which are detected to be strong positive for 2-3 times until the ELISA detection result of the supernatant of the culture hole in which only one cell colony grows is positive at the last time; 4) and (4) cloning and culturing the hybridoma cell with the best ELISA detection result after the last limiting dilution, and freezing and storing.

Preparing ascites: 1) selecting 10-week-old BALB/c mice, and injecting 0.5mL of liquid paraffin into the abdominal cavity per mouse; 2)7 days later, positive hybridoma cells cultured to log phase diluted in PBS were intraperitoneally inoculated, 5X 10 cells per mouse⁵a/mL hybridoma cell; 3) observing after 5 days, when the abdomen of the mouse is obviously swollen, collecting ascites by using a No.12 injection needle once every 3 days until the mouse dies; 4) centrifuging ascites at 7000 Xg for 10 min; the supernatant is left for split charging and then stored in a refrigerator at minus 80 ℃.

Purification of monoclonal antibodies (protein a affinity chromatography): 1) column assembling: wetting the column with Equilibration Buffer (50mM Tris-HCl, 150mM NaCl, pH8.6), checking if the column is clogged, adding 5mL Protein AAgarose to the column; 2) adding 10 column volumes of Equilibration Buffer to equilibrate the column; 3) slowly loading the ascites; 4) add 10 column volumes of Equilibration Buffer and collect the permeate to OD 4-5 mL/tube₂₈₀<0.1; 5) a collection tube is prepared, and a tube for collecting eluent is added with a neutralization buffer (20mM phosphate buffer, pH 7.7) according to 500 mu L per tube; 6) eluting with 5 column volumes of Elution Buffer (50mM glycine, 0.5M NaCl, pH 2.3), and collecting the eluate at 1.5 mL/tube until OD₂₈₀<0.1; 7) the column was washed and equilibrated with 5 column volumes of Equilibration Buffer.

And (3) monoclonal antibody pairing screening: combining the obtained 98 purified monoclonal antibodies pairwise to obtain (98 multiplied by 98) pairs of combinations, respectively coating the nitrocellulose membrane and marking colloidal gold by two antibodies in each pair of combinations, preparing a colloidal gold test strip, screening the sensitivity of IrrE recombinant antigen and IrrE transgenic crops, screening the specificity of non-transgenic crops and non-IrrE transgenic crops, and finally screening the paired monoclonal antibodies only aiming at the high specificity and high sensitivity of IrrE. The method comprises the following specific steps:

preparing the colloidal gold particles by adopting a trisodium citrate reduction method. The method comprises preparing chloroauric acid into 0.01% water solution with ultrapure water, mixing 100mL with 1.2mL 1% trisodium citrate water solution, and heating to boil for 5 min. After cooling, the volume was restored to the original volume with ultrapure water, and colloidal gold particles having a particle diameter of about 30nm were prepared.

Determining the optimal stable amount of the colloidal gold-labeled antibody: the amount of antibody required to label 1mL of colloidal gold was determined to be 15. mu.g using the classical MEY method.

Coating of nitrocellulose membrane (NC): the purified mAb was diluted to 2mg/mL with 0.0l M PBS buffer pH 7.2 for coating the T-line, and goat anti-mouse IgG was diluted to lmg/mL with 0.0l PBS buffer pH 7.2 for coating the C-line. Spraying the solution on a nitrocellulose membrane at a speed of 30mm/s by using an XYZ3050 working system of BIODOT company to form a detection T line and a quality control C line which are parallel to each other, and drying at 37 ℃.

Assembling immune colloidal gold test paper: the nitrocellulose membrane 6 coated with the C line 5 and the T line 4, the absorption pad 7, the colloidal gold pad 3 and the sample pad 1 are sequentially adhered to the non-water-absorbing PVC substrate plate 2, and the immune colloidal gold test paper is assembled as shown in FIG. 4.

Pairing and screening of monoclonal antibodies: 98 monoclonal antibodies are combined to obtain a 98 × 98(9604) group of monoclonal antibodies, and 9604 colloidal gold test strips are combined. Screening for pairings with ddH₂O is used as a negative sample, 1 mu g/mL of recombinant IrrE protein, 0.2g/mL of IrrE rape seed extract is used as a positive sample, 0.2g/mL of each of CP4-EPSPS Soybean RR Soybean and BT corn BT2836 seed extracts is used as a cross reaction detection sample, and each test strip is tested. 25 strains and 33 pairs of matched monoclonal antibodies which are positive to the recombinant IrrE protein and negative to other samples are screened out to be used as candidate matched monoclonal antibodies. For the 33 pairs of candidate paired monoclonal antibodies, the detection sensitivity of the paired monoclonal antibodies to recombinant IrrE and trans-IrrE crops and the specificity of the paired monoclonal antibodies to other common non-transgenic crops and non-IrrE transgenic crops are further screened and detected. Selectively detecting recombinant IrrE proteinThe sensitivity reaches 1ng/mL level, the detection on the IrrE crop seeds reaches 0.2 mug/mL level, and the matched monoclonal antibody which has no cross reaction with the non-transgenic and non-IrrE transgenic crops is used as the matched monoclonal antibody for preparing the double-antibody sandwich method detection kit. The experiment finally obtained the first monoclonal antibody 3FK7 and the second monoclonal antibody 6EA 2.

Identification of monoclonal antibody subclasses: the subclass identification of each monoclonal antibody was carried out using an immunoglobulin standard subclass identification kit (Sigma), and the specific test method was as follows: 1) adding 1:1000 times PBS diluted goat anti-mouse IgG (IgM, IgA, IgG) into the enzyme label plate₁、IgG_2a、IgG_2bAnd IgG₃)100 mu L/hole, standing for 1h at 37 ℃; 2) discarding the liquid in the ELISA plate, and washing with PBST for 3 times; 3) adding purified monoclonal antibody (antibody concentration is 2-5 mu g/mL) diluted by PBS into 100 mu L/hole, and incubating for 1h at room temperature; PBST wash 3 times; 4) 100. mu.L/well of HRP-labeled goat anti-mouse IgG antibody (1:10000 dilution) was added and incubated at room temperature for 30 min. 5) Washing the plate thoroughly, adding 100 μ L of TMB into each well, developing for 15min, and adding 50 μ L of 1N H into each well₂SO₄The reaction was terminated. Determination of OD₄₅₀The value is obtained. Finally, the antibody subclasses of the first monoclonal antibody 3FK7 and the second monoclonal antibody 6EA2 are both IgG 1.

Paired antibody sensitivity evaluation: the selected paired monoclonal antibodies: the detection sensitivity of the first monoclonal antibody 3FK7 and the second monoclonal antibody 6EA2 on the recombinant IrrE protein reaches 1 ng/mL; the detection sensitivity for the IrrE rape seeds can reach 0.2 mu g/mL; there was a weak response to IrrE rape leaf as shown in Table 1, FIG. 2.

TABLE 1

Membrane-coated antibody (first monoclonal antibody)	3FK7
		Colloidal gold-labeled antibody (second)Monoclonal antibody	6EA2
ddH₂O	-
		rIrrE 1μg/mL	+++
rIrrE 100ng/mL	++
		rIrrE 10ng/mL	++
rIrrE 1ng/mL	+
		IrrE rape seed 0.2g/mL	+++
IrrE rape seed 20 mu g/mL	++
		IrrE rape seed 2 mug/mL	+
IrrE rape seed 0.2 mug/mL	±
		IrrE rape leaf 0.2g/mL	±

Evaluation of paired antibody specificity: paired monoclonal antibodies screened in this experiment: the first monoclonal antibody 3KF7 and the second monoclonal antibody 6EA2 were tested for specificity for 28 non-transgenic crops and 16 different sources of various non-IrrE transgenic crops (Table 2). The results are shown in Table 2 and FIG. 3. The paired monoclonal antibody 3FK7-6EA2 had no cross-reactivity to all non-transgenic and non-IrrE transgenic crops tested. In conclusion, the test strip prepared by the matched monoclonal antibody 3FK7-6EA2 has no cross reaction on most non-transgenic and non-IrrE transgenic crops. The hybridoma cell strain producing the 3FK7 monoclonal antibody is preserved, and the preservation number is CGMCC NO. 12270; the hybridoma cell strain producing the 6EA2 monoclonal antibody is preserved, and the preservation number is CGMCC NO. 12271.

TABLE 2

According to the embodiment 2, the screening method has the advantages that a pair of monoclonal antibodies are screened, the detection sensitivity of the monoclonal antibodies to recombinant IrrE protein can reach 1ng/mL through immune colloidal gold test paper, the detection sensitivity of the monoclonal antibodies to IrrE crop seeds can reach 2 mu g/mL, the monoclonal antibodies do not have cross reaction to 28 non-transgenic crops and 16 various non-IrrE transgenic crops with different sources, and the monoclonal antibodies have high sensitivity and specificity.

The preferred embodiments of the present disclosure are described in detail with reference to the accompanying drawings, however, the present disclosure is not limited to the specific details of the above embodiments, and various simple modifications may be made to the technical solution of the present disclosure within the technical idea of the present disclosure, and these simple modifications all belong to the protection scope of the present disclosure.

It should be noted that, in the foregoing embodiments, various features described in the above embodiments may be combined in any suitable manner, and in order to avoid unnecessary repetition, various combinations that are possible in the present disclosure are not described again.

In addition, any combination of various embodiments of the present disclosure may be made, and the same should be considered as the disclosure of the present disclosure, as long as it does not depart from the spirit of the present disclosure.

Sequence listing

<110> institute of biotechnology of Chinese academy of agricultural sciences

<120> a gold-labeled test strip for detecting a global regulatory factor IrrE protein and transgenic crops thereof

<130> 8990CAAS_B

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

cacaggagga ccccatatgc ccagtgc 27

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

accaagctta gttcactgtg 20

<210> 3

<211> 987

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atgcccagtg ccaacgtcag ccccccttgc ccctctgggg taaggggcgg ggggatgggg 60

ccaaaagcta aagctgaagc ctccaagccc cacccccaaa tccctgttaa gctcccattc 120

gtgaccgccc ccgacgccct cgccgccgcc aaagccagga tgcgcgacct ggcggcggcc 180

tacgtggcgg ccctgcccgg acgcgacacc cacagcctga tggcgggggt gcccggcgta 240

gacctcaaat tcatgccgct cggctggcgc gacggggcgt tcgaccccga gcacaacgtc 300

atcctcatca actcggcggc ccgccccgaa cgccagcgct tcaccctcgc ccacgaaatc 360

gggcacgcga ttttactcgg cgacgacgac ctgctctccg acatccacga cgcctacgag 420

ggcgagcggc tcgaacaggt catcgaaacg ctgtgcaacg tggcggcggc ggcgattttg 480

atgcccgaac ccgtcatcgc ggaaatgctg gaacgcttcg gccccaccgg gcgcgccctc 540

gccgaactcg ccaagcgggc cgaagtcagc gcgtcgtcgg cgctctacgc cctgaccgag 600

cagaccccgg tgcccgtcat ctacgcggtc tgtgcgccgg gcaagcctcc gcgtgagcag 660

gccgcaagcg acgaggacgc tggcccaagc acagaaaaag tcctgacggt ccgcgccagc 720

agctcgacgc ggggcgtcaa gtacaccctg gcgagcggca cgccggtacc cgccgaccac 780

ccggcggcgc ttgccctcgc cacgggcatg gaagtgcgcg aggaaagcta cgtgcccttt 840

cgctcgggcc ggaaaatgaa ggcggaggtg gacgcctacc cgtcgcgcgg catcgtggcc 900

gtcagtttcg agttcgaccc cgcccgcctg ggccgcaagg acagcgagca ggccgaccgg 960

gacgagccgc aggacgctgc acagtga 987

<210> 4

<211> 328

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 4

Met Pro Ser Ala Asn Val Ser Pro Pro Cys Pro Ser Gly Val Arg Gly

1 5 10 15

Gly Gly Met Gly Pro Lys Ala Lys Ala Glu Ala Ser Lys Pro His Pro

20 25 30

Gln Ile Pro Val Lys Leu Pro Phe Val Thr Ala Pro Asp Ala Leu Ala

35 40 45

Ala Ala Lys Ala Arg Met Arg Asp Leu Ala Ala Ala Tyr Val Ala Ala

50 55 60

Leu Pro Gly Arg Asp Thr His Ser Leu Met Ala Gly Val Pro Gly Val

65 70 75 80

Asp Leu Lys Phe Met Pro Leu Gly Trp Arg Asp Gly Ala Phe Asp Pro

85 90 95

Glu His Asn Val Ile Leu Ile Asn Ser Ala Ala Arg Pro Glu Arg Gln

100 105 110

Arg Phe Thr Leu Ala His Glu Ile Gly His Ala Ile Leu Leu Gly Asp

115 120 125

Asp Asp Leu Leu Ser Asp Ile His Asp Ala Tyr Glu Gly Glu Arg Leu

130 135 140

Glu Gln Val Ile Glu Thr Leu Cys Asn Val Ala Ala Ala Ala Ile Leu

145 150 155 160

Met Pro Glu Pro Val Ile Ala Glu Met Leu Glu Arg Phe Gly Pro Thr

165 170 175

Gly Arg Ala Leu Ala Glu Leu Ala Lys Arg Ala Glu Val Ser Ala Ser

180 185 190

Ser Ala Leu Tyr Ala Leu Thr Glu Gln Thr Pro Val Pro Val Ile Tyr

195 200 205

Ala Val Cys Ala Pro Gly Lys Pro Pro Arg Glu Gln Ala Ala Ser Asp

210 215 220

Glu Asp Ala Gly Pro Ser Thr Glu Lys Val Leu Thr Val Arg Ala Ser

225 230 235 240

Ser Ser Thr Arg Gly Val Lys Tyr Thr Leu Ala Ser Gly Thr Pro Val

245 250 255

Pro Ala Asp His Pro Ala Ala Leu Ala Leu Ala Thr Gly Met Glu Val

260 265 270

Arg Glu Glu Ser Tyr Val Pro Phe Arg Ser Gly Arg Lys Met Lys Ala

275 280 285

Glu Val Asp Ala Tyr Pro Ser Arg Gly Ile Val Ala Val Ser Phe Glu

290 295 300

Phe Asp Pro Ala Arg Leu Gly Arg Lys Asp Ser Glu Gln Ala Asp Arg

305 310 315 320

Asp Glu Pro Gln Asp Ala Ala Gln

325

Claims

1. A hybridoma cell pair, comprising a first hybridoma cell line and a second hybridoma cell line stored independently; the preservation number of the first hybridoma cell strain is CGMCC number 12270; the preservation number of the second hybridoma cell strain is CGMCC number 12271.

2. A monoclonal antibody pair comprising a first monoclonal antibody and a second monoclonal antibody stored separately; the first monoclonal antibody is produced by a first hybridoma cell strain; the second monoclonal antibody is produced by a second hybridoma cell strain; the preservation number of the first hybridoma cell strain is CGMCC number 12270; the preservation number of the second hybridoma cell strain is CGMCC number 12271.

3. Use of the monoclonal antibody pair of claim 2 in the detection of IrrE-transformed transgenic crop plants.

4. Use according to claim 3, wherein the crop plant is cauliflower, rape, cotton, maize, rice or soybean.

5. An immune colloidal gold test strip comprises a water absorption pad, a basal membrane, a gold label pad and a sample pad which are connected in sequence; the base membrane is provided with a C line and a T line, the C line is coated with an antibody of goat anti-mouse IgG, and the T line is coated with a first monoclonal antibody; the gold-labeled pad contains a second monoclonal antibody labeled by colloidal gold; the first monoclonal antibody and the second monoclonal antibody constitute a monoclonal antibody pair, characterized in that the monoclonal antibody pair is the monoclonal antibody pair according to claim 2.

6. The immune colloidal gold test strip according to claim 5, wherein the colloidal gold labeled second monoclonal antibody contained in the gold label pad is obtained by spraying a colloidal gold labeled second monoclonal antibody solution of 5-100 μ g/mL on the gold label pad at a spraying speed of 0.5-5 μ L/cm through a gold spraying and spotting machine and drying.

7. The immune colloidal gold test strip of claim 5 or 6, wherein the first monoclonal antibody coated on the T line is obtained by spraying a 0.2-5mg/mL first monoclonal antibody solution on the T line at a spraying speed of 0.2-4 μ L/cm through a gold spraying and spotting machine and drying.

8. The immune colloidal gold test strip of claim 5, wherein the goat anti-mouse IgG antibody coated on the C line is obtained by spraying a 0.2-5mg/mL goat anti-mouse IgG antibody solution on the C line at a spraying speed of 0.2-4 muL/cm through a gold spraying spotting machine and drying.

9. A method of detecting an IrrE-transformed transgenic crop plant, comprising the steps of:

s1, extracting holoprotein from the crops to be detected;

s2, carrying out immune colloidal gold test paper detection or double-antibody sandwich enzyme-linked immunoassay on the whole protein by using the monoclonal antibody pair of claim 2.

10. The method of claim 9, wherein the crop plant is broccoli, canola, cotton, corn, rice, or soybean.