CN103451301A - Deafness susceptible gene SLC26A4 2168A>G and IVS7-2A>G mutant detection kit - Google Patents
Deafness susceptible gene SLC26A4 2168A>G and IVS7-2A>G mutant detection kit Download PDFInfo
- Publication number
- CN103451301A CN103451301A CN2013104108383A CN201310410838A CN103451301A CN 103451301 A CN103451301 A CN 103451301A CN 2013104108383 A CN2013104108383 A CN 2013104108383A CN 201310410838 A CN201310410838 A CN 201310410838A CN 103451301 A CN103451301 A CN 103451301A
- Authority
- CN
- China
- Prior art keywords
- probe
- seq
- ivs7
- slc26a4
- detected
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The invention discloses a deafness susceptible gene SLC26A4 2168A>G and IVS7-2A>G mutant detection kit which comprises amplification reagents and a series of standard substances, wherein the amplification reagents comprise a reaction mixture of a PCR (polymerase chain reaction) buffer solution, MgCl2 and dNTPs (deoxyribonucleotide triphosphates), Taq enzyme, ultrapure water, and high-specificity amplified SLC26A4; and the series of standard substances comprise a 2168A>G typing standard substance and an IVS7-2A>G typing standard substance. By using the 2 deafness susceptible gene sites as the detection objects, the deafness susceptible gene sites are subjected to amplification and fluorescence quantitative detection and are compared with the genotyping standard substances to screen out individuals containing the site mutants and determine the genotype. The kit has important meanings for screening deafness susceptible genes and especially newborn deafness genes.
Description
Technical field
The present invention relates to deaf sick tumor susceptibility gene SLC26A42168A > G, IVS7-2A > the G mutation detection kit, belong to technical field of biological.
Background technology
The paathogenic factor research of the hearing and speech handicapped person being carried out in world wide shows, about 60-80% patient's the cause of disease is relevant with inherited genetic factors, and wherein the clinical study data of developed country show, hereditary hearing impairment accounts for 80% in deafness patient.Therefore in recent ten years, the pathogenesis of hereditary hearing impairment and the research of molecular epidemiology thereof become one of most important content of deaf sick research.Along with the Human Genome Project completes, the location of deaf ospc gene and clone have obtained huge progress, and the molecule genetics research of deaf disease and the data of molecular epidemiology make investigators progressively recognize that deaf sick susceptibility gene mutation safeguarding that hearing is healthy and finding the importance of hearing in abnormal.
In the deaf-related gene of having located and having cloned at present, the large vestibular aqueduct syndrome that SLC26A4 gene and arc are vertical and Pendred syndrome (aqueductus vestibuli enlarges or companion's inner ear malformations, nerve deafness and thyrocele) in close relations, show as clinically congenital or acquired character is deaf, deaf occur or increase the weight of with wound, catch a cold relevant.In 95 routine single patient's aqueductus vestibulis enlarge the patient of family, 97.9% (93/95) the sudden change with SLC26A4 gene, in 38 kinds of mutation types finding, IVS7-2A > G, 2168A > G enlarges in patient SLC26A4 transgenation and occupies higher ratio at Chinese aqueductus vestibuli.The gene type result of these chromosome mutations has very important directive significance for seriousness and the guidance fertility heredity of analysing patient's condition.
Gene tester commonly used has at present: direct Sequencing (direct sequencing, DS), Ligase detection reaction (ligase detection reaction, LDR), restriction fragment length polymorphism analysis (restriction fragment length polymorphism, RFLP), dhplc analysis (denaturing high performance liquid chromotography, DHPLC), gene chip.All there is different defects in these methods, such as complex operation, result, are difficult for the problems such as interpretation, poor repeatability, false negative false positive be many.For the gene type of chromosome mutation, general fluorescence quantitative kit often needs same sample is carried out to the multitube detection, could obtain the somatotype information more than 2.
It is detected object that above-mentioned 2 deaf sick susceptibility locis are take in the present invention, and amplification and fluorescent quantitation by above-mentioned deaf susceptibility loci detect, and with the contrast of genotyping standard product, can filter out the individuality that contains above-mentioned site mutation, determine genotype simultaneously.To the detection of deaf sick tumor susceptibility gene, especially significant to the examination of newborn infant's deaf gene; Utilize first the method for four-way/tetra-look dyestuff-fluorescence quantitative PCR detection to realize the target that 2 site somatotypes detect, and contain internal reference with the monitoring and detection process.Stopped pipe detects and to have prevented the pollution of uncapping and detecting operation and producing, for clinical diagnosis and association area scientific research provide reliable method.
Summary of the invention
The object of the invention is to provide and a kind ofly can in 1 hour, detects deaf sick tumor susceptibility gene SLC26A42168A simultaneously > G, IVS7-2A > the G sudden change, distinguish genotype and also contain internal reference with the monitoring and detection process.
To achieve these goals, the technical scheme of taking: a kind of deaf sick tumor susceptibility gene SLC26A42168A > G, IVS7-2A > the G mutation detection kit, this test kit comprises amplifing reagent and series of standards product;
Described amplifing reagent comprises: PCR damping fluid, MgCl
2reaction mixture with dNTPs, the Taq enzyme, ultrapure water, high specific amplification SLC26A4:2168A>G, IVS7-2A>primer mixture of G, above-mentioned site is carried out to the probe mixture of specific detection, the general probe mixture that the human gene group DNA is detected, internal reference and the primer probe mixture that internal reference is detected;
Described series of standards product comprise: 2168A > G somatotype standard substance (2168A of 10ng/uL > G heterozygous mutation DNA sample 1 pipe), IVS7-2A > G somatotype standard substance (IVS7-2A of 10ng/uL > G heterozygous mutation DNA sample 1 pipe).
Described for to SLC26A4:2168A > G, IVS7-2A > the G sudden change carries out the probe of specific detection, the general probe that the human gene group DNA is detected, the probe that internal reference is detected is divided into four groups, adopt respectively four kinds of different luminophores to carry out mark to 5 ' end of each group probe, the quenching group of 3 ' end can be identical or different fluorescence dye.
Four groups of being divided into of described probe are: for to SLC26A4:IVS7-2A > the G sudden change probe that carries out specific detection adopts same group of luminous-quenching group; For to 2168A > the G sudden change probe that carries out specific detection adopts same group of luminous-quenching group; The general probe that the human gene group DNA is detected adopts same group of luminous-quenching group; Adopt same group of luminous-quenching group for the probe that internal reference is carried out to specific detection.
Described 5 ' the fluorescence dye of holding different luminophores to use can be: ALEXA Fluor350, FAM, TET, HEX/JOE/VIC, Cy3, TAMRA, ROX ,/Texas Red, Cy5; 3 ' the fluorescence dye of holding identical or different quenching group to use can be: BHQ1, BHQ2, TAMRA, DABCYL.
Use described test kit to carry out the condition of PCR composite amplification reaction: the pH value of pcr amplification system is 8.0-9.0, magnesium ion concentration is 1.5-3.5mM, the final concentration of 4 kinds of dNTP is respectively 200-300 μ M, the consumption of Taq enzyme is 0.1-0.4U/ μ L, and the primer in the primer probe mixture, the final concentration of probe are 0.2-0.4 μ M.
While using described test kit to carry out pcr amplification, the amplification elementary reaction SLC26A4:2168A that simultaneously increases in a composite amplification reaction system > G, IVS7-2A > G, human gene group DNA's target sequence, internal reference target sequence.
For SLC26A4:IVS7-2A > primer that detects of G is:
SEQ?NO.1：5'-TGGGATGGATTTAACAATGCC-3’
SEQ?NO.2：5’-GTTAGAAAGTTCAGCATTATTTGGTTG-3’：
For SLC26A4:2168A > primer that detects of G is:
SEQ?NO.3：5’-AATGGAACCTTGACCCTCTTGA-3’
SEQ?NO.4：5’-TGTGATAGAAAAGCTGGAGCAATG-3’：
For SLC26A4:IVS7-2A > probe that detects of G sudden change is:
SEQ?NO.5：5’-AAATGGCAGTAGCAATTATCGTCCG
A-3’
For SLC26A4:2168A > probe that detects of G sudden change is:
SEQ?NO.6：5’-CTTGGTTCTGTAGATAGAGTATAGCATCACGG
C-3’：
For the general probe that the human gene group DNA is detected, be:
SEQ?NO.7：5’-GAATGTGTCCTTTCTAATGTTGTCGTC-3’：
Wherein the LNA nucleosides means with boldface type.
3. test kit according to claim 1 and 2, it is characterized in that: the sequence that described internal reference is one section synthetic is loaded on the plasmid vector of pMD18-T and obtains, and the sequence of this section synthetic (SEQ NO.4) does not find high relevant homologous region through NCBI website Blast.Extension increasing sequence and the primer probe that internal reference is detected are:
SEQ?NO.8：CACCAGCATCTCCCTTCATGTTGACTACCGTAGGCTGCCACCATTTCAGAAGAACGATGACCCCTTGCTAGCAGTGGAAGAGTTGCATGAAGGTAATATACTCGATCCGTAATTCCACTATTGAAATGGGTACATGACTGATACAGACCATC
SEQ?NO.9：5’-CACCAGCATCTCCCTTCATGT-3’
SEQ?NO.10：5’-GATGGTCTGTATCAGTCATGTACCCA-3’
SEQ?NO.11：5’-GAACGATGACCCCTTGCTAGCAGTGGAAGAG-3’
The composite amplification in described each site adopts polymerase chain reaction to realize, adopts quantitative fluorescent PCR to detect in real time, by the synchronous amplification with standard substance and analysis, draws institute's mark somatotype information or mutant proportion information originally.
The human gene group DNA that wherein detected is: use Chelex method, magnetic bead extraction method or phenol/chloroform extraction method to process to the source sample DNA obtained; Described source sample is: derive from the mankind: filter paper blood cake/buccal swab sample, FTA card blood cake/buccal swab sample, buccal swab sample, blood/trace, tissue, amniotic fluid.
While using described test kit to carry out pcr amplification, the amplification elementary reaction carries out on the PCR of any model instrument, amplification program: 94-98 ℃ 1-5min; The 94-98 of 45 circulations ℃ 5-10s, 55-65 ℃ of 30-50s.
Use with fluorescent mark and mix the primer of modification through the LNA nucleoside monomers, improve the Tm value of probe, shortened probe length, strengthened the insight of probe to point mutation, thereby increased sensitivity and the specificity of probe, prevented false positive and false-negative appearance.
The accompanying drawing explanation
Fig. 1 is that test kit of the present invention is to SLC26A4:2168A > the different detection collection of illustrative plates that dilute in the gradient situation of G somatotype standard substance (235 heterozygous mutant type DNA under 10ng DNA background);
Fig. 2 is that test kit of the present invention is to SLC26A4:IVS7-2A > the different detection collection of illustrative plates that dilute in the gradient situation of G somatotype standard substance (235 heterozygous mutant type DNA under 10ng DNA background);
Fig. 3 is the canonical plotting of making according to Fig. 1, Fig. 2 data;
Fig. 4 is that test kit of the present invention carrys out the detection collection of illustrative plates of source DNA (10ng/20uL system) to the normal individual blood cake;
Fig. 5 is that test kit of the present invention is to SLC26A4:2168A > the individual blood cake of G sudden change carrys out the detection collection of illustrative plates of source DNA (5ng/20uL system);
Fig. 6 is that test kit of the present invention is to SLC26A4:IVS7-2A > G mutated individual blood cake carrys out the detection collection of illustrative plates of source DNA (5ng/20uL system).
Embodiment
Below in conjunction with the drawings and specific embodiments, the invention will be further described, but not as a limitation of the invention.
Embodiment 1 test kit of the present invention detects the DNA sample of sudden change and normal individual
For SLC26A4:2168A > the probe 5 ' end that detects of G sudden change adopts the FAM fluorochrome label, for SLC26A4:IVS7-2A > the probe 5 ' end that detects of G sudden change adopts the HEX fluorochrome label, probe 5 ' the end detected for human mitochondrial DNA adopts the Cy5 fluorochrome label, and the probe 5 ' end detected for internal reference adopts the ROX fluorochrome label.
1, sample to be tested is 1000 parts, all uses the technological method of " DNA extraction-pcr amplification-order-checking " to carry out the order-checking detection to each site.Wherein, SLC26A4:2168A > 1 part, G sudden change sample, SLC26A4:IVS7-2A > 4 parts, G sudden change sample.
2, the extracting genome DNA of sample
Chelex extraction method: cut 1～3mm blood cake (sample comes from the XX hospital laboratory) and be placed in the 1.5mL centrifuge tube, add sdH
2o1mL, vibrate centrifugal, abandons supernatant liquor, and repeating step twice, abandon supernatant liquor, and draw 200 μ L with the rifle head of cutting fast after the 5%Chelex-100 concussion is suspended and add in centrifuge tube, the vibration several seconds.After 56 ℃ of water bath heat preservation 30min, the vibration several seconds.95 ℃ of boiling water bath 10min, slightly vibrate the several seconds.The centrifugal 5min of 2000rpm, the DNA for extracting in supernatant.
3, the detection analysis of amplification and amplified production
(1) pcr amplification system:
(2) amplification program on ABI StepOne Plus type quantitative real time PCR Instrument: 95C3min; 95C5s, 60C35s (collection fluorescent signal), be 45cycles.
(3) detect and analyze
By 2168A > G somatotype standard substance (235 heterozygous mutant type DNA under 10ng DNA background) and IVS7-2A > after G somatotype standard substance (299 heterozygous mutant type DNA under the 10ngDNA background) 1:1 mixes (10ng/uL), and dilution is 5ng/uL, 1ng/uL, 0.5ng/uL, getting respectively 1uL joins in amplification system as template, carry out fluorescent quantitation and collect data obtaining Fig. 1, Fig. 2 (unrisen signal all omits), be figure according to each concentration and corresponding Ct value, obtain the typical curve of Fig. 3.
Fig. 4 is that test kit of the present invention carrys out the detection collection of illustrative plates of source DNA (0.5ng/20uL system) to the normal individual blood cake: obtain internal reference probe (ROX) passage and signal and sigmoid curve detected, the Ct value is 23.11, shows that this amplified reaction is effective; Obtain two passages of human gene group DNA's probe (Cy5) and signal and sigmoid curve detected, the Ct value is 22.95, the concentration that shows this DNA sample is about 10ng/uL2168A > G probe (FAM) and IVS7-2A two sense channels of G probe (HEX) do not have sigmoid curve, show this sample be 2168 and the IVS7-2 site do not have the normal individual source of sudden change.
Fig. 5 is that test kit of the present invention carrys out the detection collection of illustrative plates of source DNA (5ng/20uL system) to the individual blood cake of 2168 sudden changes: obtain internal reference probe (ROX) passage and signal and sigmoid curve detected, the Ct value is 23.08, shows that this amplified reaction is effective; Obtain two passages of human gene group DNA's probe (Cy5) and signal and sigmoid curve detected, the Ct value is 23.92, the concentration that shows this DNA sample is about 5ng/uLIVS7-2A > G probe (HEX) sense channel do not have sigmoid curve, shows that there is not sudden change in this sample IVS7-2 site; 2168A > G probe (FAM) passage detects signal and sigmoid curve, and the Ct value is 23.89, contrast Fig. 3 determines that this sample should be 5ng/uL2168A > G heterozygous mutant type.
Fig. 6 is that test kit of the present invention carrys out the detection collection of illustrative plates of source DNA (5ng/20uL system) to IVS7-2 mutated individual blood cake: obtain internal reference probe (ROX) passage and signal and sigmoid curve detected, the Ct value is 23.05, shows that this amplified reaction is effective; Obtain two passages of human gene group DNA's probe (Cy5) and signal and sigmoid curve detected, the Ct value is 23.82, shows that the concentration of this DNA sample is about 5ng/uL; 2168A > G probe (FAM) sense channel do not have sigmoid curve, shows that there is not sudden change in these sample 2168 sites; IVS7-2A > G probe (HEX) passage detects signal and sigmoid curve, the Ct value is 20.02, contrast Fig. 3 finds 5ng human gene group DNA IVS7-2A > the Ct value of G heterozygous mutant type should be 21.09, shows that this sample should be IVS7-2A > G homozygous mutation type.
With sequence measurement, compare: the homologous genes seat somatotype result to the sample in same source is consistent.
10 * PCR damping fluid of different pH used in above embodiment, with the Tris-HCl damping fluid preparation of different pH values, the Tris-HCl concentration in 1 * PCR damping fluid is 10mM, KCl concentration is 50mM; In the present invention, Taq polysaccharase used and other reagent and material are commercially available prod.
Claims (9)
1. deaf sick tumor susceptibility gene SLC26A42168A>G, IVS7-2A>the G mutation detection kit, it is characterized in that comprising amplifing reagent and series of standards product; Described amplifing reagent comprises: PCR damping fluid, MgCl
2reaction mixture with dNTPs, the Taq enzyme, ultrapure water, high specific amplification SLC26A4:2168A>G, IVS7-2A>the G primer mixture, above-mentioned site is carried out to the probe mixture of specific detection, the general probe mixture that the human gene group DNA is detected, internal reference and the primer probe mixture that internal reference is detected; Described series of standards product comprise: 2168A>G somatotype standard substance, IVS7-2A>G somatotype standard substance.
2. test kit according to claim 1 is characterized in that:
For SLC26A4:IVS7-2A > primer that detects of G is:
SEQ?NO.1：5’-TGGGATGGATTTAACAATGCC-3’
SEQ?NO.2：5’-GTTAGAAAGTTCAGCATTATTTGGTTG-3’；
For SLC26A4:2168A > primer that detects of G is:
SEQ?NO.3：5’-AATGGAACCTTGACCCTCTTGA-3’
SEQ?NO.4：5’-TGTGATAGAAAAGCTGGAGCAATG-3’；
For SLC26A4:IVS7-2A > probe that detects of G sudden change is:
SEQ?NO.5：5’-AAATGGCAGTAGCAATTATCGTCCG
A-3’
For SLC26A4:2168A > probe that detects of G sudden change is:
SEQ?NO.6：5’-CTTGGTTCTGTAGATAGAGTATAGCATCACGG
C-3’；
For the general probe that the human gene group DNA is detected, be:
SEQ?NO.7：5’-GAATGTGTCCTTTCTAATGTTGTCGTC-3’；
Wherein the LNA nucleosides means with boldface type.
3. test kit according to claim 1 and 2, it is characterized in that: the sequence that described internal reference is one section synthetic is loaded on the plasmid vector of pMD18-T and obtains, and the sequence of this section synthetic (SEQ NO.4) does not find high relevant homologous region through NCBI website Blast.Extension increasing sequence and the primer probe that internal reference is detected are:
SEQ?NO.8：CACCAGCATCTCCCTTCATGTTGACTACCGTAGGCTGCCACCATTTCAGAAGAACGATGACCCCTTGCTAGCAGTGGAAGAGTTGCATGAAGGTAATATACTCGATCCGTAATTCCACTATTGAAATGGGTACATGACTGATACAGACCATC
SEQ?NO.9：5’-CACCAGCATCTCCCTTCATGT-3’
SEQ?NO.10：5’-GATGGTCTGTATCAGTCATGTACCCA-3’
SEQ?NO.11：5’-GAACGATGACCCCTTGCTAGCAGTGGAAGAG-3’
4. test kit according to claim 1 and 2, it is characterized in that: described for SLC26A4:2168A G, IVS7-2A the probe that detects of G sudden change, the general probe that the human gene group DNA is detected, the internal reference probe, 5 ' end and the 3 ' end of every probe all carry out fluorochrome label, and 5 ' end is held as quenching group for luminophore and 3 '.
5. test kit according to claim 1 and 2, it is characterized in that: described for to SLC26A4:2168A G, IVS7-2A the G sudden change carries out the probe of specific detection, the general probe that the human gene group DNA is detected is divided into four groups, adopt respectively four kinds of different luminophores to carry out mark to 5 ' end of each group probe, the quenching group of 3 ' end can be identical or different fluorescence dye.
6. require described test kit according to right 4, it is characterized in that: four groups of being divided into of probe are: for to SLC26A4:IVS7-2A > the G sudden change probe that carries out specific detection adopts same group of luminous-quenching group; For to 2168A > the G sudden change probe that carries out specific detection adopts same group of luminous-quenching group; The general probe that the human gene group DNA is detected adopts same group of luminous-quenching group; Adopt same group of luminous-quenching group for the probe that internal reference is carried out to specific detection.
7. require described test kit according to right 4, it is characterized in that: the 5 ' fluorescence dye of holding different luminophores to use can be: ALEXAFluor350, FAM, TET, HEX/JOE/VIC, Cy3, TAMRA, ROX ,/Texas Red, Cy5; 3 ' the fluorescence dye of holding identical or different quenching group to use can be: BHQ1, BHQ2, TAMRA, DABCYL.
8. according to right 1, require described test kit, it is characterized in that: comprise series of standards product: 2168A G somatotype standard substance (2168A of 10ng/uL > G heterozygous mutation DNA sample 1 pipe), IVS7-2A G somatotype standard substance (IVS7-2A of 10ng/uL > G heterozygous mutation DNA sample 1 pipe).
9. the described test kit of claim 1 is applied to the detection of deaf sick tumor susceptibility gene, it is characterized in that by the deaf sick tumor susceptibility gene SLC26A4:2168A of quantitative fluorescent PCR specific detection > G, IVS7-2A > G; For IVS7-2A > the primer probe that detects of G is: SEQ NO.1, SEQ NO.2, SEQ NO.5; For SLC26A4:2168A > the primer probe that detects of G sudden change is: SEQ NO.3, SEQ NO.4, SEQ NO.6; For the primer probe that the human gene group DNA is detected, be: SEQNO.3, SEQNO.4, SEQNO.7; Primer probe for internal control test is: SEQ NO.9, SEQ NO.10, SEQ NO.11.The composite amplification in described each site adopts polymerase chain reaction to realize, adopts quantitative fluorescent PCR to detect in real time, by the synchronous amplification with standard substance and analysis, draws institute's mark somatotype information or mutant proportion information originally.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310410838.3A CN103451301B (en) | 2013-09-11 | 2013-09-11 | Deaf sick tumor susceptibility gene SLC26A4 2168A > G, IVS7-2A > G mutation detection kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310410838.3A CN103451301B (en) | 2013-09-11 | 2013-09-11 | Deaf sick tumor susceptibility gene SLC26A4 2168A > G, IVS7-2A > G mutation detection kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103451301A true CN103451301A (en) | 2013-12-18 |
| CN103451301B CN103451301B (en) | 2016-04-06 |
Family
ID=49734134
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310410838.3A Active CN103451301B (en) | 2013-09-11 | 2013-09-11 | Deaf sick tumor susceptibility gene SLC26A4 2168A > G, IVS7-2A > G mutation detection kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103451301B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110878343A (en) * | 2019-12-03 | 2020-03-13 | 国家卫生健康委科学技术研究所 | Cpf1 kit for quickly detecting genetic deafness pathogenic gene SLC26A4 mutation and detection method thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012055069A1 (en) * | 2010-10-27 | 2012-05-03 | Capitalbio Corporation | Luminophore-labeled molecules coupled with particles for microarray-based assays |
| CN102465174A (en) * | 2010-11-09 | 2012-05-23 | 王宝恒 | Method for detecting GJB2 gene mutation by fluorescence quantitative PCR technology, and kit thereof |
| CN102534030A (en) * | 2012-02-14 | 2012-07-04 | 北京科聆金仪生物技术有限公司 | Kit for jointly detecting four deafness predisposing genes and application thereof |
| CN102618624A (en) * | 2011-01-26 | 2012-08-01 | 苏州市立医院 | Kit for screening deaf gene of Chinese populations, and use method thereof |
| CN102864232A (en) * | 2012-09-26 | 2013-01-09 | 潮州凯普生物化学有限公司 | Deafness susceptive gene joint detection kit |
-
2013
- 2013-09-11 CN CN201310410838.3A patent/CN103451301B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012055069A1 (en) * | 2010-10-27 | 2012-05-03 | Capitalbio Corporation | Luminophore-labeled molecules coupled with particles for microarray-based assays |
| CN102465174A (en) * | 2010-11-09 | 2012-05-23 | 王宝恒 | Method for detecting GJB2 gene mutation by fluorescence quantitative PCR technology, and kit thereof |
| CN102618624A (en) * | 2011-01-26 | 2012-08-01 | 苏州市立医院 | Kit for screening deaf gene of Chinese populations, and use method thereof |
| CN102534030A (en) * | 2012-02-14 | 2012-07-04 | 北京科聆金仪生物技术有限公司 | Kit for jointly detecting four deafness predisposing genes and application thereof |
| CN102864232A (en) * | 2012-09-26 | 2013-01-09 | 潮州凯普生物化学有限公司 | Deafness susceptive gene joint detection kit |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110878343A (en) * | 2019-12-03 | 2020-03-13 | 国家卫生健康委科学技术研究所 | Cpf1 kit for quickly detecting genetic deafness pathogenic gene SLC26A4 mutation and detection method thereof |
| CN110878343B (en) * | 2019-12-03 | 2023-04-07 | 国家卫生健康委科学技术研究所 | Cpf1 kit for rapidly detecting genetic deafness pathogenic gene SLC26A4 mutation and detection method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103451301B (en) | 2016-04-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102534031B (en) | High-specificity kit for detecting deafness predisposing genes and uses | |
| CN107385064B (en) | Fluorescence labeling composite amplification kit for simultaneously amplifying human autosomal SNP and STR loci and application thereof | |
| CN110055312B (en) | Primer, probe and kit for detecting cis-trans mutation of EGFR gene C797S and T790M | |
| CN105177115B (en) | A kind of UGT1A1 Polymorphisms site fluorescence detection reagent kit for being used to instruct Irinotecan based chemotherapy drug individualized treatment | |
| CN104830852B (en) | One kind detection HLA B*15:The multiple real time fluorescence PCR method of 02 allele | |
| CN103451302A (en) | Deafness susceptible gene mitochondrion 12SrDNA 1555A>G and 1494C>T mutant ratio detection kit | |
| CN106148484B (en) | A kind of kit that diagnosis Y chromosome is micro-deleted | |
| CN102586433B (en) | Deafness predisposing gene 12S rRNA (ribosomal ribonucleic acid) 1494C>T fluorescence detection kit and application thereof | |
| CN107513577A (en) | A kind of method of efficient detection EGFRT790M mutant and probe and kit for detection | |
| CN109321651A (en) | A kind of composition, kit, sample treatment and application detecting people CYP2D6 gene pleiomorphism | |
| CN104531881A (en) | Fluorescence PCR detection kit for human K-RAS gene mutation | |
| CN109182493A (en) | The primer and kit and its detection method of people's 16p11.2 microdeletion syndrome detection | |
| CN102534030B (en) | Kit for jointly detecting four deafness predisposing genes and application thereof | |
| CN112111609A (en) | Universal nucleic acid detection kit for enteroviruses | |
| CN103451301B (en) | Deaf sick tumor susceptibility gene SLC26A4 2168A > G, IVS7-2A > G mutation detection kit | |
| WO2020134950A1 (en) | Gene mutation/fusion combination and kit for identification of benign and malignant pulmonary nodules | |
| CN103451300B (en) | Deaf sick tumor susceptibility gene GJB2 235delC, 299delAT mutation detection kit | |
| CN106755530B (en) | MGB probe real-time fluorescence PCR method for detecting HLA-A31: 01 allele and primer probe combination thereof | |
| CN106636365B (en) | Nucleic acid, kit and method for detecting A1166C polymorphic site of AGTR1 gene | |
| CN110438226B (en) | Kit for detecting cis-trans mutation, sample processing method and judgment method | |
| CN102660636A (en) | A fluorescence detection kit for detecting deafness susceptibility gene 12S rRNA 1555A>G and application thereof | |
| CN103436625B (en) | 6 deaf sick susceptibility loci somatotype/mutant proportion detection kit | |
| CN102605052B (en) | Fluorescence detection kit for detecting deafness susceptibility gene GJB2 235delC and application of fluorescence detection kit | |
| CN104232774A (en) | Primers for detecting breast cancer susceptibility gene SNP (single nucleotide polymorphism), fluorescent probes and applications | |
| CN111172248B (en) | General kit for verifying copy number variation based on fragment analysis technology |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |