CN103361377B

CN103361377B - The method that HPV6 L1 albumen is produced with expressed by Hansenula yeast system

Info

Publication number: CN103361377B
Application number: CN201210088620.6A
Authority: CN
Inventors: 李鼎锋; 霍烛; 陈星梅; 程海; 王贻杰; 陈丹; 刘娟; 刘勇
Original assignee: Abzymo Biosciences Co ltd
Current assignee: Abzymo Biosciences Co ltd
Priority date: 2012-03-28
Filing date: 2012-03-28
Publication date: 2017-12-05
Anticipated expiration: 2032-03-28
Also published as: CN107916234A; CN103361377A

Abstract

The present invention relates to the method that HPV6L1 albumen is produced with expressed by Hansenula yeast system.Specifically, Hansenula yeast cell is recombinated the invention discloses the method for the restructuring Hansenula yeast cell for producing expression HPV6L1 albumen and as caused by methods described.The invention also discloses produce the purposes of the method and caused HPV6L1 albumen of HPV6L1 albumen in preventative vaccine is prepared using the restructuring Hansenula yeast cell.

Description

The method that HPV6L1 albumen is produced with expressed by Hansenula yeast system

Invention field

The invention belongs to medical bioengineering technical field, is related to the method for producing HPV6L1 albumen, more particularly to use the Chinese The method that inferior yeast expression system produces HPV6L1 albumen.

Background technology

HPV (human papillomavirus, HPV) is a kind of nonencapsulated closed loop double-stranded DNA virus, Belong to papovaviridae polyomavirus subfamily, the main epithelium mucous membrane tissue for invading human body, and then induce various benign and pernicious Preneoplastic lesions.

The different subtype HPV come has been identified at present more than 200 kinds, and HPV infection has obvious tissue specificity, different The HPV of type is different with the thermophilic tropism of mucous membrane for skin, can induce different papillary lesions, kind of HPV types about more than 30 It is not relevant with RTI, wherein there is kind more than 20 related to tumour.The good pernicious difference of lesion is induced according to HPV, HPV can be big Cause is divided into two classes：1) high-risk-type (such as HPV16, HPV18, HPV45, HPV31, HPV33, HPV52, HPV58, HPV35, HPV59, HPV56, HPV39, HPV51 etc.)：It is closely related with mankind's Various Tissues malignant tumour, mainly cause severe atypical hyperplasia and Infiltrating carcinoma, especially the closest with the generation of cervical carcinoma with the infection of HPV16 and HPV18 types, the infection of the two types accounts for cervical carcinoma More than the 70% of infection, wherein HPV16 accounts for more than 50%；2) low risk (such as HPV6, HPV11, HPV40, HPV42, HPV43, HPV44, HPV54, HPV72, HPV 81 etc.)：Epidermal cell benign proliferative venereal disease can be caused, such as condyloma acuminatum and condyloma Deng wherein accounting for more than 90% by the HPV6 and HPV11 condyloma acuminatums induced.

HPV is mainly made up of virus coat and genomic DNA.Genome is about 7900bp, there is 8 encoding hiv protease bases Cause.The albumen of wherein 6 ORF codings is in the early expression of virus replication, referred to as early protein；The albumen of 2 ORF codings is in disease The late period expression that poison replicates, referred to as late protein.Late protein includes major cat protein L1 and secondary coat protein L2, and joins With the formation of virus coat.

HPV viruse coat protein can carry out self assembly, the L1 albumen of single expression or by L1 in a variety of expression systems Albumen can be self-assembled into virus-like particle (virus-likeparticle, VLP) when being co-expressed with L2 albumen, wherein with ferment VLP caused by mother system, Baculovirus insect expression system and mammalian cell expression system etc. is closer to natural viral Structure.Generation neutralizing antibody can be induced in vivo after being immunized using the VLP of heterogenous expression system production, obtain good be immunized Protecting effect.

Multiple-shaped nuohan inferior yeast (Hansenula Polymorpha), also referred to as Pichia augusta, is currently generally acknowledged One of ideal heterologous gene expression system.Multiple-shaped nuohan inferior yeast had both possessed protokaryon life as single celled eukaryotic microorganism Thing fast growing, it is easy to the features such as genetic manipulation, there is the function such as eukaryotic post translational processing and modification again.In addition, the inferior ferment of the Chinese Mother is also equipped with that security is good, be easy to culture, cost is cheap, expression quantity is high and the advantage such as inheritance stability, and can overcome such as Bacterial strain is unstable for saccharomyces cerevisiae (Saccharomyces cerevisiae), yield poorly and glycosylates that side chain is long and complete red ferment The problem of mother's (Pichia Pastoris) exogenous origin gene integrator copy number is relatively low.At present, using expressed by Hansenula yeast system production Medicine (such as insulin, trade name Wosulin) and HBV vaccines (trade name Hepavax-Gene) list marketing.

Summary of the invention

In the first aspect, the invention provides a kind of side for the restructuring Hansenula yeast cell for producing expression HPV6L1 albumen Method, it is comprised the steps of：

A) by the way that the exogenous polynucleotide insertion vector of the nucleotide sequence comprising coding HPV6L1 albumen is built into table Expression constructs；

B) with the expression construct conversion Hansenula yeast cell obtained in step a)；With

C) the Hansenula yeast cell obtained in step b) is screened, obtains the restructuring containing the exogenous polynucleotide Hansenula yeast cell.

In second aspect, present invention also offers Hansenula yeast cell is recombinated according to caused by the above method.

At the 3rd aspect, present invention also offers a kind of method of generation HPV6L1 albumen, comprise the following steps：

I) the restructuring Hansenula yeast cell of the present invention is cultivated under conditions of suitable for HPV6L1 protein expressions；With

Ii) reclaimed from culture and purify HPV6L1 albumen.

The step of methods described can also include carrying out purified HPV6L1 albumen depolymerization and meeting again.

In terms of last, present invention also offers HPV6L1 albumen caused by the method according to the invention to prepare use Purposes in the vaccine of prevention HPV6 infection.

Brief description of the drawings

Southern trace testing results of the Fig. 1 using MOX promoter fragments as probe.Using ATCC26012 genomic DNAs Control.1：(applied sample amount is for control：1000ng)；2：(applied sample amount is for control：500ng)；3：(applied sample amount is for control：250ng)；4： (applied sample amount is for control：125ng)；5：(applied sample amount is HP/pRMHP2.1-6wt genomic DNAs：15.625ng its brightness between Between 500ng and 1000ng controls)；6：(applied sample amount is HP/pRMHP2.1-6sc genomic DNAs：15.625ng its brightness is situated between Between 500ng and 1000ng controls)；7：(applied sample amount is HP/pRMHP2.1-6hp genomic DNAs：15.625ng its brightness Between 500ng and 1000ng controls).

The SDS-PAGE results of Fig. 2A HPV6L1 albumen induced expression in Escherichia coli.1：Protein marker；2：Do not lure The control sample led；3,4,5：IPTG induced expression samples.

The purification result of the HPV6L1 albumen of Fig. 2 B prokaryotic expressions.1：Protein marker；2：Supernatant after ultrasonication Liquid；3：Sediment fraction after ultrasonication；4,5：Flow through liquid；6：20% eluent；7：100% eluent.

Fig. 2 C rabbit polyclonal antibody purification results.1：Protein marker；2：Antiserum；3：Flow through liquid；4：Antibody elution.

The western blot detection of restructuring Hansenula yeast cellular expression levels different Fig. 3.1：HP/pRMHP2.1-6wt； 2：HP/pRMHP2.1-6sc；3,4：HP/pRMHP2.1-6hp；5：Standard items (30 μ g/L)；6：Pre-dyed protein marker.

The detection of expression of HPV6L1 albumen in Fig. 4 fermentation process.1：Pre-dyed protein marker；2：Standard items (30 μ g/L)； 3：Induction 0 hour；4：Induction 3 hours；5：Induction 6 hours；6：Induction 9 hours；7：Induction 10 hours.

The POROS 50HS purifying electrophoretograms of Fig. 5 A HPV6L1 albumen.1：Upper prop sample；2：Flow through liquid；3~9：NaCl ladders Degree elution.

The CHT purifying electrophoretograms of Fig. 5 B HPV6L1 albumen.1：Upper prop sample；2: 3~6: phosphate gradient elution.

The transmission electron microscope observing result of the HPV6L1 albumen of Fig. 6 purifying.

Detailed description of the invention

The present inventor has been successfully set up the method that HPV6L1 albumen is produced using Hansenula yeast, caused HPV6L1 eggs Virus-like particle can be self-assembled into vain, available for the vaccine for preparing prevention HPV infection.

Present invention firstly provides a kind of method for the restructuring Hansenula yeast cell for producing expression HPV6L1 albumen, it is included Following steps：

Present invention additionally comprises Hansenula yeast cell is recombinated according to caused by methods described.

Amino acid sequence from the HPV6L1 albumen of different HPV6 Strain can have differences.It is right that the present inventor passes through All HPV6L1 protein sequences are compared in database, and the frequency of occurrences is chosen on each amino acid position of HPV6L1 albumen Highest amino acid residue, obtain and be shown in SEQID NO：1 amino acid sequence, the sequence are that HPV6L1 albumen most represents The consensus sequence of property.Therefore, the HPV6L1 albumen in the present invention preferably has SEQ ID NO：Amino acid sequence shown in 1.

In order to efficiently express HPV6L1 albumen using Hansenula yeast, inventor is according to SEQ ID NO：Amino shown in 1 Acid sequence, the codon optimization of nucleotide sequence is carried out for Hansenula yeast.Optimization principles include：A) according to Hansenula yeast heredity Password frequency of use table (http://www.kazusa.or.jp/codon/cgi-bin/showcodon.cgiSpecies= 4905) frequency of use highest or higher codon are selected；B) avoid thering is potential impact to bear genetic transcription or protein translation Controlling element, such as PolyAT areas, PolyGC areas, silencer (Sliencer) area and internal splice site；C) to including 5 ' ends UTR, HPV6L1 code area and 3 ' end UTR including mRNA secondary structures carry out comprehensive analysis, avoid complicated RNA secondary structures Formed, make the free energy of mRNA secondary structures reduce；D) used and Hansenula yeast promoter downstream as far as possible in upstream of coding region 5 ' completely the same UTR areas of native sequences；E) conventional restriction enzyme enzyme recognition site is eliminated.By the nucleotides sequence of optimization It is shown in SEQ ID NO：4.The nucleotide sequence of coding HPV6L1 albumen used in the present invention is preferably SEQ ID NO：4 Shown sequence.

The Chinese patent Shen that the adaptable polymorpha expression vector of the present invention is Application No. 201210021524.X Please described in polymorpha expression vector pRMHP2.1 (comprising being shown in SEQ ID NO：15 sequence).By the way that coding will be included The exogenous polynucleotide of the nucleotide sequence of HPV6L1 albumen is cloned into pRMHP2.1 carriers, can obtain the expression structure of the present invention Build body.It will be understood by those skilled in the art that the expression construct of the present invention can also use other vector constructions, such as authorize Chinese patent CN100400665C described in carrier.

In order to be expressed in Hansenula yeast, exogenous polynucleotide in the expression construct operably with promoter Connected with terminator.

As used herein, the function connects for referring at least two polynucleotides " are operably connected ".For example, operably connect Connect including the connection between promoter and another polynucleotides, wherein the promoter sequence originates and mediates this another is more The transcription of nucleotides.Operably connection includes the connection between terminator and another polynucleotides, wherein the terminator Terminate the transcription of another polynucleotides.

Include but is not limited to MOX, FMD, AOX1 and DHAS promoter suitable for the promoter of the present invention.In some embodiment party In case, the promoter used in the present invention is the MOX promoters from Hansenula yeast.In other embodiments, it is of the invention The middle promoter used is the FMD promoters from Hansenula yeast.Include but is not limited to come from suitable for the terminator of the present invention The MOX terminators of Hansenula yeast.

Expression construct is converted to Hansenula yeast cell and can be carried out with a variety of methods known in the art, including but not It is limited to the conversion of electroporation and PEG mediations.

In addition, developed in this area it is a variety of be used for express foreign protein Hansenula yeast bacterial strain, include but is not limited to CGMCC2.2498 Hansenula yeasts, ATCC34438 Hansenula yeasts and ATCC26012 Hansenula yeast cells.These Hansenula yeast bacterial strains The present invention can also be applied to.In some embodiments, for the Hansenula yeast cell for the expression construct for converting the present invention It is ATCC26012 Hansenula yeast cells.

In post-conversion, can select to recombinate Hansenula yeast cell according to the resistant gene carried on carrier.It is suitable anti- Property gene includes but is not limited to Kan resistant genes and Zeocin resistant genes.The carrier according to used in, it is also possible to use nutrition Defect culture medium recombinates Hansenula yeast cell to screen.

Expression of the exogenous polynucleotide in Hansenula yeast and its copy number positive correlation in Hansenula yeast.Cause This, can also contain the more nucleosides of multicopy external source by carrying out further screening the methods of Southern traces or quantitative PCR The restructuring Hansenula yeast cell of acid.It is preferred that exogenous polynucleotide copy number is more than 5 restructuring Hansenula yeast cell, more preferably external source Polynucleotide copies number is more than 30 restructuring Hansenula yeast cell.

On the other hand, present invention also offers a kind of method of generation HPV6L1 albumen, comprise the following steps：

Ii) reclaimed from culture and purify HPV6L1 albumen.

The various culture mediums known in the art that can be used for culture Hansenula yeast and basic condition of culture, those skilled in the art It can be selected or be changed as needed.Culture protein content needed for of the restructuring expressed by Hansenula yeast bacterial strain of the present invention can To carry out in flask or be carried out in the bioreactor (such as 30L fermentation tank) of different scales., can according to selected promoter The expression of the HPV6L1 albumen is induced to add suitable inducer in culture.In the feelings using MOX or FMD promoters Under condition, methanol is added as inducer.

The purifying of caused HPV6L1 albumen can use various protein purification modes known in the art, such as saltout, The combination of ultrafiltration, precipitation, chromatography etc. or these modes.In one embodiment, first with chromatography media POROS 50HS (Applied Biosystems) carries out preliminary purification, followed by chromatography media Macro-Prep ceramic hydroxyapatites (Type II, 40 μm) is further purified.

Using the present invention method prepare purifying HPV6L1 albumen can be self-assembled into virus-like particle (embodiment 9, Fig. 6), and in mouse good immunogenicity (embodiment 10) is shown, therefore present invention provides the HPV6L1 eggs Purposes in the vaccine infected for preventing HPV6 is prepared in vain.

Embodiment

The present invention will be further illustrated by way of embodiment below, but is not therefore limited the present invention to described Scope of embodiments in.

Embodiment 1：The analysis of HPV6L1 consensus amino acid sequences

The HPV6L1 albumen of total length is made up of 500 amino acid, is retrieved by GenBank, obtains contain 500 amino altogether The total length HPV6L1 protein sequences 117 of acid.Amino acid alignment point is carried out using Vector NTI software AlignX functions Analysis, obtaining most representational HPV6L1 consensus amino acid sequences, (consensus amino acid sequence, that is, exist The each amino acid positions of HPV6L1 use the sequence of probability of occurrence highest amino acid residue), its sequence such as SEQ ID NO：1 It is shown.

Embodiment 2：HPV6L1 encoding genes it is artificial synthesized

The present invention has synthesized 3 kinds of different HPV6L1 nucleotide sequences altogether, is referred to as 6wt, 6sc and 6hp：

1) the natural HPV6L1 gene orders identical nucleotides sequence shown in 6wt- and GenBank accession number AF335604.1 Row, are shown in SEQ ID NO：2；

2) 6sc- the present inventor is according to SEQ ID NO：Amino acid sequence shown in 1, it is inclined for saccharomyces cerevisiae genetic code The nucleotide sequence of love property brand-new design, sequence are shown in SEQ ID NO：3；

3) 6hp- the present inventor is according to SEQ ID NO：Amino acid sequence shown in 1, it is inclined for Hansenula yeast genetic code The nucleotide sequence of love property brand-new design, sequence are shown in SEQ ID NO：4.

According to above nucleotide sequence, commission Sinogenomax Co., Ltd. carries out 6wt, 6sc respectively And 6hp complete sequence is artificial synthesized, it is cloned in carrier T and (is respectively designated as T-6wt, T-6sc and T-6hp), and it is carried out Sequence verification.

Embodiment 3：Produce the expression construct for carrying different HPV6L1 nucleotide sequences

The polymorpha expression vector that the present invention is applied is Application No. 201210021524.X Chinese patent application Described in polymorpha expression vector pRMHP2.1 (it includes SEQ ID NO：Sequence shown in 15).

(1) PCR of MOX promoters and MOX terminators is expanded

Using Hansenula yeast strains A TCC26012 and ATCC34438 the mixed genomic DNA as template, with following primer pair The MOX promoters that size is 1518bp are obtained, while NotI restriction enzyme sites are introduced in upstream；

MOX promoter primers：5’-AAGGAAAAAAGCGGCCGCAACGATCTCCTCGAGCTGCTCGC-3’(SEQID NO：16)

MOX promoter primers：5’-TTTGTTTTTGTACTTTAGATTGATGTC-3’(SEQ ID NO：17)

Using Hansenula yeast strains A TCC26012 and ATCC34438 the mixed genomic DNA as template, with following primer pair The MOX terminators that size is 311bp are obtained, while BglII restriction enzyme sites are introduced in downstream；

MOX terminator primers：5’-GGAGACGTGGAAGGACATACCGC-3’(SEQ ID NO：18)

MOX terminator primers：5’-GAagatctCAATCTCCGGAATGGTGATCTG-3’(SEQ ID NO：19)

(2) expression construct for carrying different HPV6L1 nucleotide sequences is produced

Using the recombinant plasmid T-6wt for carrying 6wt as template, size is obtained as 1551bp's using primer 1 and primer 2 amplification HPV6L1 wt genes, while the overlap at the end of MOX promoter regions 3 ' is introduced in upstream, introducing MOX terminators 5 ' in downstream holds Overlay region；

Primer 1：5’-CATCAATCTAAAGTACAAAAACAAAATGTGGCGGCCTAGCGACAGCACAG-3’(SEQ ID NO：5)

Primer 2：5’-GCGGTATGTCCTTCCACGTCTCCTTACCTTTTAGTTTTGGCGCGCTT-3’(SEQ ID NO：6)

Using the recombinant plasmid T-6sc for carrying 6sc as template, size is obtained as 1551bp's using primer 3 and the amplification of primer 4 HPV6 L1 sc genes, while the overlap at the end of MOX promoter regions 3 ' is introduced in upstream, introduce MOX terminators 5 ' in downstream The overlay region at end；

Primer 3：5’-CATCAATCTAAAGTACAAAAACAAA_{ATGTGGAGACCATCTGATTCTACTG}-3’(SEQ ID NO：7)

Primer 4：5’-GCGGTATGTCCTTCCACGTCTCCTTATCTTTTCGTCTTGGCTCTTTTC-3’(SEQ ID NO：8)

Using the recombinant plasmid T-6hp for carrying 6hp as template, size is obtained as 1551bp's using primer 5 and the amplification of primer 6 HPV6L1hp genes, while the overlap at the end of MOX promoter regions 3 ' is introduced in upstream, introducing MOX terminators 5 ' in downstream holds Overlay region；

Primer 5：5’-CATCAATCTAAAGTACAAAAACAAA_{ATGTGGAGACCATCGGACTCTACTG}-3’(SEQ ID NO：9)

Primer 6：5’-GCGGTATGTCCTTCCACGTCTCCTTAGCGCTTCGTCTTCGCTCTTTTC-3’(SEQ ID NO：10)

Respectively using three MOX promoters, 6wt genes/6sc genes/6hp genes, MOX terminators fragments as template, to draw Thing 7 obtains 6wt expression cassettes/6sc expression cassettes/6hp expression cassettes that size is 3.4Kb with the amplification of primer 8, while is carried in upstream NotI restriction enzyme sites, BglII restriction enzyme sites are carried in downstream.

Primer 7：5’-AAGGAAAAAAGCGGCCGCAACGATCTCCTCGAGCTGCTCGC-3’(SEQ ID NO：11)

Primer 8：5’-GAagatctCAATCTCCGGAATGGTGATCTG-3’(SEQ ID NO：12)

6wt expression cassettes, 6sc expression cassettes and 6hp expression cassettes are cloned into respectively by NotI+BglII double digestions In pRMHP2.1 carriers, expression construct pRMHP2.1-6wt, pRMHP2.1-6sc and pRMHP2.1-6hp are obtained.

Embodiment 4：Recombinate the generation of Hansenula yeast cell

(1) extraction and digestion of recombinant expression construct constitution grain

Picking is transformed into the E. coli clones of the recombinant expression construct constitution grain obtained in embodiment 3, after expanding culture Plasmid is extracted using E.Z.N.A Plasmid Mini Kit kits (Omega Bio-Tek companies), and list is carried out with BglII Digestion, reclaimed using E.Z.N.A Gel Extraction Kit kits (OmegaBio-Tek companies), it is pre- with 60 μ L The sterilized water of heat to 55 DEG C is eluted, and is quantified by determining OD260 progress DNA, and the fragment of linearisation is diluted to 100nng/ μ l, it is stored in -2 0 DEG C of refrigerators, it is standby.

(2) processing of Hansenula yeast cell

Picking Hansenula yeast strains A TCC26012 single bacterium colonies, are accessed in the small test tube of the YPD fluid nutrient mediums containing 5ml, 37 DEG C culture 12 hours；Bacterium solution 5ml is taken to be forwarded in 200ml YPD culture mediums, 37 DEG C of culture 4-6 hours, are about 1.0- to OD600 1.5, centrifuge 10min in 6000rpm；It is resuspended with 200ml0.1mol/L phosphate buffers (DTT containing 25mmol/L, pH7.5) Thalline, fully mix, 30min is incubated in 37 DEG C, 6000rpm centrifugation 10min, supernatant is abandoned, stays thalline.With the STM solution of precooling 200ml washes thalline, and thalline pressure-vaccum is uniform, centrifuges 3min in 4 DEG C of 6000rpm, abandons supernatant, stay precipitation.With ice-cold STM solution Thalline is resuspended in 100ml, centrifuges 3min in 4 DEG C of 6000rpm, abandons supernatant, stay precipitation.It is ice-cold with 100-200 μ l according to biomass Thalline is resuspended in STM solution, and bacterium solution is transferred in the centrifuge tube after high pressure, ice bath, prepares conversion.

(3) the electricity conversion of Hansenula yeast cell

By plasmid: thalline=1: 2 amount adds restructuring expressed by Hansenula yeast plasmid 15 μ l, the μ l of bacterium solution 30, abundant pressure-vaccum is equal It is even, it is placed in be transformed in ice bath；Will be in advance with alcohol-pickled, and after ultraviolet irradiation, take out, add in the electric revolving cup of -20 DEG C of refrigeration Enter plasmid thalline mixed liquor；By voltage 2500V, resistance 150

Ω, the μ F of electric capacity 50 condition are shocked by electricity；It is rapidly added 1ml after electric shock to have balanced to the YPD solution of room temperature, gently It is transferred to after mixing in EP pipes；Thalline after electricity is turned places 1h in 37 DEG C of water-baths, is gently overturned 3 times at interval of 15min；Will 1h bacterium solution has been incubated, 10min has been centrifuged in 6000rpm, abandons supernatant；Thalline is resuspended with 200 μ l YPD solution, is applied with 100 μ l/ plates It is distributed in the YPD flat boards containing 0.25mg/mlZeocin, culture 3-7 days is inverted in 37 DEG C.

(4) passing on, stably for expressed by Hansenula yeast bacterial strain is recombinated

The recombinant bacterial strain single bacterium colony grown in picking Zeocin resistant panels, is inoculated in 5ml Zeocin containing 0.25mg/ml YPD fluid nutrient mediums in, in 37 DEG C, 200rpm shaking table culture 24-36 hours, to OD values up to after 50, with 1: 1000 ratio Transfer in 5ml Zeocin containing 0.25mg/ml YPD fluid nutrient mediums, cultivate to OD values up to after 50, then with 1: 1000 ratio Example is transferred in 5ml Zeocin containing 0.25mg/ml YPD fluid nutrient mediums, by that analogy, continuous to pass 10 times and carry out strain Preservation.Preservation system is bacterium solution: 60% glycerine=1: 1, measure preserve strain as needed, usually the μ l of 500 μ l bacterium solutions+500 60% glycerine；

The restructuring expressed by Hansenula yeast bacterial strain access 5ml for reaching 10 times is free of to the YPD fluid nutrient mediums of Zeocin resistances In, in 37 DEG C, 200rpm shaking table cultures to OD values up to after 50, transferred with 1: 1000 ratio in 5ml YPD fluid nutrient mediums, By that analogy, it is continuous in the YPD fluid nutrient mediums without Zeocin resistances to pass 5 times.

By the YPD flat boards of bacterium solution coating G418 containing 10mg/ml after stabilization, culture 2-4 days is inverted in 32 DEG C, is put down from each The eugonic single bacterium colony of picking carries out copy number detection in plate.

Embodiment 5：Recombinate the exogenous polynucleotide copy number detection of Hansenula yeast cell

(1) extraction of pastoris genomic dna and quantitative

The eugonic yeast strain single bacterium that inoculation embodiment 4 obtains, which is fallen in 5ml YPD fluid nutrient mediums, cultivates Base, 37 DEG C of 16~24h of culture；2ml Yeast Cultivation liquid is taken, room temperature 4500g centrifugations 3min collects thalline；It is molten using 500 μ l SCED Bacterium is resuspended in liquid (1mol/L sorbierites, 10mmol/L sodium citrates, 10mmol/L EDTA, 10mmol/L DTT dithiothreitol (DTT)s) Body, and 50mg bead fully shaking 5min are added, add 50 μ l 10mg/ml lywallzymes, 37 DEG C of warm bath 1h；Add 60 μ l's 10%SDS, 30 μ l Proteinase K, 10 μ l RNaseA enzymes, room temperature cultivate 2h after placing 10 minutes in 55 DEG C of water-bath；Add Enter 350 μ l saturated phenols and 350 μ l chloroforms, be sufficiently mixed after 13000rpm, centrifuge 10 minutes, collect the upper liquid after layering； Isometric (about 700 μ l) chloroform is added, in 13000rpm, centrifuges 10 minutes, collects the upper liquid after layering；Add into upper liquid Entering 140 μ l 3mol/L sodium acetate solutions, 700 μ l isopropanols are added after gently mixing, room temperature places 5min after mixing, in 13000rpm, centrifuge 10 minutes.Supernatant is abandoned, the ethanol of 1ml 70% is added and is cleaned, in 13000rpm, centrifuges 10 minutes, falls After going supernatant, DNA precipitations to be placed in room temperature placement 30min, 100 μ l TE dissolvings are added.Genomic DNA is carried out by determining OD260 Quantify, and the fragment of linearisation is diluted to 100ng/ μ l, is stored in -20 DEG C of refrigerators, it is standby.

(2) Southern immunoblot methods carry out quantifying for exogenous polynucleotide copy number

a：It is prepared by probe

MOX described in the Chinese patent application for the MOX probe Application No. 201210021524.X that the present invention is applied Probe, using DIG DNA Labeling and Detection kit kits (the Cat No of Roche companies： 11093657910) probe preparation is carried out.Concretely comprise the following steps：The PCR primer of 10 μ l MOX promoter regions is added into EP tubules (200ng/ μ l), and sealed up with sealed membrane, boiling water boils 10 minutes.It is immediately placed in the absolute ethyl alcohol capsule of precooling (- 20 DEG C) (cooling down suddenly).Pipe outer wall ethanol is dried, centrifuges (about 10s), sequentially adds 5 μ l tiny electrolytic cells water, 2 μ l 10xHexanucleotide Mix、2μl10x dTP Labeling Mixture、1μl 7Klenow Enzyme(labeling Grade), mix, sealed membrane sealing.37 DEG C of water-baths are stayed overnight, -20 DEG C of preservations.

b：Southern traces

Using digoxin hybridization check kit I (the Cat No of Beijing Mei Laibo medical science and technologies Co., Ltd：DIGD- ) and the efficient hybridization solutions of HyB (Cat No l10：Hyb-500 Southern trace detections) are carried out according to product description.

(3) copy number of different restructuring Hansenula yeast bacterial strains compares

Southern traces testing result (see Fig. 1) is shown：Screen the HP/pRMHP2.1-6wt bacterial strains obtained, HP/ The copy number of pRMHP2.1-6sc bacterial strains and HP/pRMHP2.1-6hp bacterial strains approaches, and copy number is all higher than 31 but less than 63.

Embodiment 6：The preparation of the prokaryotic expression and rabbit polyclonal antibody of HPV6L1 albumen

(1) the PCR amplifications of HPV6L1 genes and expression plasmid clone's structure

Using pRMHP2.1-6hp as template, HPV6L1hp base of the size as 1519bp is obtained using primer 9 and the amplification of primer 10 NdeI restriction enzyme sites are introduced because of fragment (without terminator codon), while in upstream, SalI restriction enzyme sites are introduced in downstream；

Primer 9：5’-ggaattccat_{ATGTGGAGACCATCGGACTCTACTG}-3’(SEQ ID NO：13)

Primer 10：5’-CCGGTCGACGCGCTTCGTCTTCGCTCTTTTCC-3’(SEQ ID NO：14)

6hp gene fragment clones are entered to the pET43.1a carriers of NdeI+XhoI double digestions by NdeI+SalI double digestions In (Novagen companies), the correct recombinant plasmid of sequence verification is named as pET43.1a-6hp.

(2) induced expression of the HPV6L1 albumen in Escherichia coli

Recombinant plasmid pET43.1a-6hp converts E. coli expression strains BL21-CodonPlus (DE3)-RIPL, obtains Engineering bacteria BL21-CodonPlus (DE3)-RIPL/pET43.1a-6hp must be expressed.Picking single bacterium colony accesses the liquid of LB containing 5ml In the test tube of culture medium (the μ g/ml containing Amp 50), 37 DEG C of cultures to OD600 add IPTG to final concentration when being 0.6-0.9 0.5mmol/L, induction time 5h, while the control tube not induced is set.Bacterium solution is collected, SDS-PAGE detection recombinant proteins Expression (Fig. 2A).

(3) purifying of HPV6L1 albumen

Preparation of samples：Picking expression engineering bacteria BL21-CodonPlus (DE3)-RIPL/pET43.1a-6hp single bacterium colonies connect In the test tube for entering the fluid nutrient mediums of LB containing 5ml (the μ g/ml containing Amp 50), 37 DEG C of overnight incubations, next day is connect by 1% inoculum concentration In the 1L triangular flasks for entering the fluid nutrient mediums of LB containing 400ml (the μ g/ml containing Amp 50), to OD₆₀₀When about 0.8, IPTG is added extremely Final concentration 0.5mmol/L, collect bacterium solution after inducing 5h and centrifuge, bacterial sediment is resuspended in PBS in 1: 10 (g/ml) ratio Precipitation is collected by centrifugation in solution, carrying out ultrasonic bacteria breaking (5s, 5s, 400W, the 60cycles) under ice bath, 10000r/min centrifugation 10min.

Purge process (Fig. 2 B)：Ultrasound precipitation is added into solution (100mM phosphate, 500mM in 1: 10 (g/ml) ratio NaCl, 20mM imidazoles, 8M ureas, pH8.0) in be sufficiently stirred dissolving, 10000r/min centrifugation 10min, collect 0.45 μm of film of supernatant Filtering.It is splined on Chelating Sepharose FF chromatography medias, equilibrium liquid A is 100mM phosphate, 500mM NaCl, 20mM imidazoles, 8M ureas, pH8.0, eluent B are 100mM phosphate, 150mM NaCl, 500mM imidazoles, 8M ureas, pH8.0, are eluted Step：Foreign protein first is washed with 20%B streams, then destination protein is eluted with 100%B.Collect destination protein eluting peak.Dialysis removes miaow Azoles.

(4) prepared by rabbit polyclonal antibody

Rabbit is immunized and serum collection：With 2 new zealand rabbits of HPV6L1 protein immunizations of the prokaryotic expression of purifying, it is immunized Method uses back multi-point injection method, immune programme for children be the 0th, 3,6,8 week it is each be immunized once, immunizing dose is 250 μ g/ times, Antigen need to be injected again after Freund's complete adjuvant (FCA) or incomplete Freund's adjuvant (FIA) are fully emulsified, and first immunisation should With FCA, follow-up immunization application FIA, taken a blood sample in the 9th week by arteria carotis and separate serum, every rabbit can separate serum 40- 60ml。

Antibody purification (Fig. 2 C)：Antiserum is after 0.45 μm of filtering, and upper prop is in chromatography media rProtein A Sepharose FF, carry out affinitive layer purification.Under pH neutrallty conditions, antibody binding is on chromatography media, with citric acid-lemon Lemon acid sodium buffer solution (pH4.0) elutes, and collects antibody elution peak, neutralizes neutral to pH with 1M Tris.Cl, pH9.0 immediately.

Embodiment 7：The expression study of difference restructuring Hansenula yeast bacterial strain

(1) induced expression of Hansenula yeast bacterial strain is recombinated

Picking recombinates Hansenula yeast single bacterium colony from flat board, accesses in the small test tube of the YPG fluid nutrient mediums containing 5ml, 37 DEG C culture 24 hours；Bacterium solution is transferred in the 100ml triangular flasks of the inducing cultures of YPM containing 30ml, initial density OD₆₀₀= 1, induced 72 hours in 37 DEG C of shaking tables, final concentration of 0.5% methanol solution was added in bacterium solution every 12 hours (i.e. 0.15ml/ bottles).

Take the bacterium solution after 25ml inductions to be transferred in 50ml centrifuge tube, centrifuge 10min in 10000rpm, abandon supernatant；With Bacterial sediment is resuspended in 50ml cell cracking, after fully mixing, is pressed in Ultrasound Instrument and " power 60%, time 20min, opens 5s, closes 5s " ultrasonication program carries out bacterial cell disruption, needs to keep ice bath in shattering process；By the bacterium solution of ultrasonication, in 10000rpm centrifuges 10min, and collection supernatant freezes standby in -20 DEG C.

(2) detection of expression of Hansenula yeast bacterial strain HPV6L1 albumen is recombinated

The detection of HPV6L1 protein expression levels is carried out using western blot semi-quantitative method

Glue and electrophoresis：12% polyacrylamide gel is prepared, adds measuring samples and standard items, upper strata glue is with 8V/ Cm voltage, separation gel carry out electrophoresis with 15V/cm voltage, when reaching separation gel bottom to bromophenol blue, stop electrophoresis, cut Separation gel；

Semidry method transferring film：Pvdf membrane first uses methyl alcohol process 15 seconds, and positive pole liquid is soaked into again extremely after being rinsed 3 times with deionized water Few 5min；Running gel is soaked in negative electrode solution, installs electrotransfer device in order, and 150mA electric current carries out electricity and turns 35-45min； After the completion of transferring film, check whether pre-dyed protein marker band is completely transferred.

Closing：Being added film with tweezers has in the valve bag of the milk of 20ml 5%, extrudes bubble, uses plastic film sealing Machine seals.Shaking table shakes closing 1 hour or (should be put into refrigerator cold-storage preservation overnight) overnight slowly.

Primary antibody is incubated：The rabbit-anti HPV6L1 albumen prepared anti-added with 1/200 ratio more is filled into 5% milk In valve bag, film is put into after mixing, bubble is extruded, is sealed with plastic film sealing machine.Shaking table shakes incubation 1.5 hours slowly.

Wash film：Take the film out and washed 5 times with TBST, about 100ml, time are 5 minutes every time.Last time is 10 minutes.

Secondary antibody is incubated：The goat-anti rabbit secondary antibody of HRP marks is added to the valve bag for filling 5% milk with 1/1000 ratio In, film is put into after mixing, bubble is extruded, is sealed with plastic film sealing machine.Shaking table shakes incubation 2 hours slowly.

Colour developing：Film is put into nitrite ion, shaking table shakes to band slowly to be occurred, and is rinsed color development stopping with flowing water, is dried laggard Row is taken pictures.

(3) result

By influence of the more different HPV6L1 nucleotide sequences for protein expression, as a result (Fig. 3) is shown：HPV is natural Gene 6wt and according to the optimization of saccharomyces cerevisiae codon-bias expression of the 6sc genes in Hansenula yeast far below pressing It is therefore, comprehensive for Hansenula yeast host genetic codon bias according to the gene 6hp of Hansenula yeast codon-bias optimization design Close optimization and realize that high level expression is vital in Hansenula yeast bacterial strain for HPV6L1 albumen.

Embodiment 8：The zymotechnique of HPV6L1 restructuring expressed by Hansenula yeast bacterial strains and purifying process research

Fermentation seed liquid：1 is taken to freeze glycerol stock (HP/pRMHP2.1-6hp).80 are drawn after thawing

In μ l access 5ml YPD culture mediums, in 37 DEG C, 200rpm shaking table cultures 18-24hr, A_600nmAbout 3-5, assay approval Respectively draw 1ml afterwards to access in 2 bottles of 500ml YPD culture mediums, in 37 DEG C, 200rpm shaking table cultures 18-24hr to A_600nmAbout 15- 20, it is stand-by as fermentation seed liquid after assay approval.

Ferment control：Fermentation initial medium contains dusty yeast 300g, peptone 150g, glycerine 100g, basic salt (K₂SO₄273g, MgSO₄100g, 85%H₃PO₄400ml, KOH 62g), 10L purified waters fully dissolve, and add in 30L fermentation tanks, Purified water is settled to 14L, 121 DEG C, 30min sterilizings, 60ml PTM1 liquid microelements (CuSO is added after being cooled to 30 DEG C₄· 5H₂O 6.0g, K10.088g, MnSO₄·H₂O 3.0g, Na₂MoO₄·2H₂O 0.2g, H₃BO₃0.02g, CoCl₂· 6H₂O0.5g, ZnCl₂20.0g FeSO₄·7H₂O 65.0g, Biotin 0.2g, dense H₂SO₄5.0ml, purified water are settled to 1L, 0.22 μm of membrane filtration is degerming), ammoniacal liquor regulation pH5.6,2 bottles of 500ml fermentation seed liquids are inoculated with, now fermentation volume is 15L.Rise Beginning speed of agitator is 200rpm, air mass flow 0.5Nm3/hr, tank press 0.5bar, and it is 20-80% that oxygen dissolving value is controlled in fermentation.Rise After growth period beginning maintains about 22hr, bacterium solution A_600nmReach 20 or so, dissolved oxygen starts rapid increase, starts with 100ml/hr flow velocity streams Add supplemented medium (50% glycerine (W/V), 12ml PTM1), now entering to become a mandarin adds growth period.After cultivating about 6-8hr, bacterium solution A_600nmReach 90 or so, stop stream and add, ammoniacal liquor adjusts pH value to 6.0.Start stream after dissolved oxygen bottom out plus methanol (contains 12ml/L PTM1 the induced expression phase) is entered, methanol initial flow rate of acceleration is 50ml/hr, is sampled per hour, methanol determination of electrode methanol is dense Degree, by adjusting methanol feeding speed control methanol concentration ＜ 5g/L, and it is used for Western prints after collecting wet thallus ultrasonication Mark detection (5 times of dilutions of sample), western blot testing result is as shown in Figure 4.

Lower tank centrifugation：Lower tank is carried out after induction 10hr, centrifuging 30min under the conditions of 4 DEG C with 5000rpm collects wet thallus.Receive - 20 DEG C of the wet thallus obtained freezes.

Bacterial cell disruption：The HPV6 expression wet thallus of -20 DEG C of preservations is taken, 0.9% is added according to the ratio of 10ml/g wet thallus Physiological saline cleans.After thalline washing, by 20ml buffer solutions/g wet thallus add disruption buffer (NaCl containing 0.5mol/L, 0.02%Tween-80,0.05mol/L MOPS) fully dissolving, crushed, cracking pressure 1500bar, circulated using high-pressure homogenization It is broken 6-8 times, microscopy percentage of damage ＞ 90%.Bacterial cell disruption liquid centrifuges 30min under the conditions of 4 DEG C with 9000rpm, collects supernatant Liquid, 45% ammonium sulfate is added, after precipitating 30min, 9000rpm centrifuges 30min under the conditions of 4 DEG C, collects supernatant.

Chromatographic purifying：Bacterial cell disruption supernatant through 1 μm of filtering, is splined on chromatography media POROS50HS (Applied Biosystems), destination protein is adsorbed onto on chromatography media, with 0.5M~1.5M NaCl gradient elutions, destination protein and impurity Initial gross separation is obtained, collects the HPV6L1 albumen (Fig. 5 A) of elution.Just pure HPV6L1 albumen is splined on chromatography media Macro-Prep ceramic hydroxyapatites (Type II, 40 μm), destination protein is incorporated on chromatography media, with 20~200mM phosphorus Hydrochlorate concentration gradient elutes, and destination protein separates with impurity, collects the HPV6L1 albumen (Fig. 5 B) of elution.

HPV6 L1 VLP depolymerization and reunion：HPV6L1 albumen after purification adds 25mM DTT, 0.05% Polysorbate80, under the conditions of pH8.2, in room temperature depolymerization 2 hours.Dialysis removes DTT, system of dialysing：1.0M NaCl, 20mM phosphate, 0.05%Polysorbate80, pH 7.2.Dialyse, change 3 times, each 30min in 1: 100 ratio.Dialyse again Into reunion buffer solution, system of dialysing：1M NaCl, 5mM Ca²⁺, 60mM sodium citrates, pH6.2,0.05% Polysorbate80.In 4 DEG C, dialysis obtains the HPV6L1VLP of reunion after 24 hours.

The stability of HPV6L1 albumen compares before and after reunion：1) THERMAL STABILITY：Under the conditions of controlled rate, by temperature 70 DEG C are increase gradually to by 25 DEG C, because light scattering changes in solution caused by albumen aggregation, the light at 350nm can be passed through Absorption value is detected.Table 1 is shown：Obvious aggregation takes place at 50 DEG C for the HPV6L1 albumen do not met again, and after meeting again HPV6L1 albumen does not occur significantly to assemble at 50 DEG C, is heated up to 60 DEG C and just starts to assemble.2) acceleration for stabilization Journal of Sex Research： Under the conditions of 37 DEG C, compare after placing certain time, the HPV6L1 albumen do not met again and the aggregation extent for the HPV6L1 albumen met again, From table 2, the accelerated stability of HPV6L1 albumen is significantly better than the HPV6L1 albumen do not met again after reunion.Comprehensive heat endurance And accelerated stability result of study, reunion improve intrinsic stability of the HPV6L1 albumen for temperature-induced aggregation.

Table 1：The thermal stability analysis of HPV6L1 albumen before and after reunion

Table 2：The accelerated stability analysis of HPV6L1 albumen before and after reunion

Embodiment 9：The HPV6L1 recombinant proteins of transmission electron microscope observing purifying

With the HPV6L1 protein samples of 2 times of dilutions of sterilized water after purification, one droplet of drop is on cured disk.Copper mesh is taken to make have support The surface of film contacts with sample liquid surface, stands 1min and takes out, take out copper mesh, unnecessary drop is absorbed with filter paper bar, is slightly dried. 2% acetic acid uranium solution is taken, one droplet of drop is on cured disk.The copper mesh for being adsorbed with sample is positioned over dye liquor surface (sample connects with dye liquor Touch), stand 2min.Copper mesh is taken out, unnecessary drop is absorbed with filter paper bar, is dried under incandescent lamp.It is saturating using JEOL-1400 models Radio sem observation VLP particle shapes simultaneously take pictures (shown in result figure 6).

Embodiment 10：The immunogenicity research for the HPV6L1VLP being prepared by recombinant with Hansenula yeast

Using measure humoral immunity effect ED₅₀The method evaluation HPV6 L1 VLP of (median effective dose) immunogenicity

(1) mouse is immune：70 6 week old Balb/c female mices (are purchased from Chinese Academy of Medical Sciences's Animal Experimental Study Institute), cleaning grade raising.6 groups, including 5 experimental groups and 1 control group are divided into, by required immunizing dose by HPV6L1 eggs White sample is diluted (table 3).Immune programme for children is：0th, 3,6 week it is each it is immune once, killed within 14 days after last time is immune mouse and point From serum.

Table 3：The packet of mouse

(2) serological conversion rate after mouse is immunized in ELISA method measure HPV6 L1 VLP, concretely comprises the following steps：Buffered with coating Escherichia coli restructuring HPV6L1 albumen is diluted to 0.5 μ g/ml by liquid, 0.1ml is added per hole, 4 DEG C overnight.Next day lavation buffer solution is washed Wash 3 times, get rid of most residual liquid.Closed 30 minutes with antibody diluent, lavation buffer solution washs 3 times, is detected after drying, or dry in the air 4 DEG C of damp proof preservations after dry.Each mice serum sample is diluted with 1: 10000 with sample diluting liquid, take 0.1ml in it is above-mentioned In the reacting hole of coating, put 37 DEG C and be incubated 1 hour, wash 5 times.(while doing blank, negative hole control).Added in reacting hole The sheep anti-mouse igg secondary antibody 0.1ml of the HRP marks of the diluted fresh of antibody diluent 1: 5000,37 DEG C are incubated 30 minutes, washing 5 times, last time is washed with distilled water.The tmb substrate solution 0.1ml of Extemporaneous, 37 DEG C of colour developings are added in each reacting hole 10 minutes.50 μ l 2M sulfuric acid 0.05ml are added in each reacting hole with terminating reaction.On ELIASA, (the 630nm at 450nm For reference wavelength), each hole OD values are surveyed after being returned to zero with blank control wells.Cutoff values calculate and positive findings judges：Cutoff values =negative control value × 2.1；Sample OD value ＞ Cutoff values are then judged to the positive.

(3) humoral immunity effect ED₅₀Calculating

According to the result of calculation of table 4, HPV6L1VLP humoral immunity effect ED₅₀It is worth for 0.315 μ g, it is shown that HPV6 L1 VLP possesses good immunogenicity.

Table 4：The humoral immunity effect detection case of mouse

Wherein：It is 2 to turn dilution factor higher than 50% sun, turns dilution factor less than 50% sun as 4.Obtained by calculating：Distance than The logarithm for being 0.301, ED50 for dilution factors of 0.667, the log10 higher than 50% positive turn is 0.5017, and 50% sun turns dilution factor and is 3.17.So ED₅₀It is worth for 0.315 μ g.

Claims

1. a kind of method of generation HPV6 L1 albumen, comprises the following steps：

A) the restructuring Hansenula yeast cell of expression HPV 6 type L1 (HPV6 L1) albumen is produced；

B) the restructuring Hansenula yeast cell obtained in being cultivated under conditions of suitable for the HPV6 L1 protein expressions a)；

C) reclaimed from culture and purify the HPV6 L1 albumen；With

D) depolymerization and reunion are carried out to purified HPV6 L1 albumen,

Wherein a) in pass through the weight that the method that comprises the steps of produces expression HPV 6 type L1 (HPV6 L1) albumen Group Hansenula yeast cell：

A1) by the way that the SEQ ID NO being operably connected with MOX promoters and MOX terminators will be included:HPV6 L1 shown in 4 The exogenous polynucleotide insetion sequence of albumen coded sequence is shown in SEQ ID NO:15 carrier carrys out construction expression construct；

A2) use step a1) in obtain expression construct pass through Electroporation Transformation ATCC26012 Hansenula yeast cells；With

A3) with Zeocin and G418 to step a2) in obtain Hansenula yeast cell screen, obtain and be more than containing copy number The restructuring Hansenula yeast cell of 30 exogenous polynucleotide；

Wherein b) in culture comprise the following steps b1) and b2)：

B1 fermentation seed liquid) is prepared：Take the μ l access 5ml YPD culture mediums of restructuring Hansenula yeast cell cryopreservation glycerol stock 80 In, in 37 DEG C, 200rpm shaking table cultures 18-24hr to A_600nm3-5, draw 1ml access 500ml YPD culture mediums in, in 37 DEG C, 200rpm shaking table cultures 18-24hr to A_600nm15-20, it is stand-by as fermentation seed liquid；

B2) ferment：2x500ml fermentation seed liquids are added to the fermentation initial medium in 30L fermentation tanks, fermentation volume 15L； Starting speed of agitator is 200rpm, air mass flow 0.5Nm3/hr, tank press 0.5bar, and it is 20-80% that oxygen dissolving value is controlled in fermentation； After the initial growth phase maintains 22hr, bacterium solution A600nm reaches 20, and dissolved oxygen starts rapid increase, starts to add with 100ml/hr flow velocity streams Supplemented medium；After cultivating 6-8hr, bacterium solution A600nm reaches 90, stops stream and adds, and ammoniacal liquor adjusts pH value to 6.0；Dissolved oxygen starts back Start stream after rising plus methanol enters the induced expression phase, methanol initial flow rate of acceleration is 50ml/hr, is sampled per hour, methanol electrode Methanol concentration is determined, by adjusting methanol feeding speed control methanol concentration ＜ 5g/L；Lower tank after 10hr is induced, under the conditions of 4 DEG C Wet thallus is collected with 5000rpm centrifugations 30min simultaneously to freeze for -20 DEG C；

Wherein c) in recovery and purifying comprise the following steps c1) and c2)：

C1 the wet thallus of -20 DEG C of preservations) is taken, the cleaning of 0.9% physiological saline is added according to the ratio of 10ml/g wet thallus；Thalline is washed After washing, add disruption buffer by 20ml buffer solutions/g wet thallus and fully dissolve, crushed using high-pressure homogenization, cracking pressure 1500bar, circulation is broken 6-8 times, microscopy percentage of damage ＞ 90%；Bacterial cell disruption liquid is centrifuged under the conditions of 4 DEG C with 9000rpm 30min, supernatant is collected, add 45% ammonium sulfate, after precipitating 30min, 9000rpm centrifuges 30min under the conditions of 4 DEG C, collects Supernatant；

C2 the bacterial cell disruption supernatant) through 1 μm of filtering, is splined on chromatography media POROS 50HS, with 0.5M-1.5M NaCl ladders Degree elution, collect the HPV6 L1 albumen of elution；Just pure HPV6 L1 albumen is splined on chromatography media Macro-Prep ceramics Hydroxyapatite, with 20-200mM phosphate concn gradient elutions, collect the HPV6 L1 albumen of elution；

Wherein d) in depolymerization and reunion comprise the following steps：

HPV6 L1 albumen after purification adds 25mM DTT, 0.05% Polysorbate80, under the conditions of pH8.2, in room Warm depolymerization 2 hours；For 1.0M NaCl, 20mM phosphate, 0.05%Polysorbate80, pH 7.2 dialysis system presses 1: 100 ratios are dialysed 3 times, each 30min, remove DTT；1M NaCl, 5mM Ca are directed to again²⁺, 60mM sodium citrates, pH6.2, 0.05%Polysorbate80 dialysis system is carried out dialysis in reunion buffer solution；In 4 DEG C, dialysis obtains what is met again after 24 hours HPV6 L1 albumen.