CN109666691A - EV71 vaccine preparation method and the vaccine prepared by this method - Google Patents

Abstract

The present invention relates to using Pichia pastoris as expression system, P1 and the 3C albumen of the EV71 after codon optimization is co-expressed using same promoter, and obtains the preparation method of the virus sample particle vaccines with immunogenicity.Further relate to the vaccine prepared by this method.

Description

EV71 vaccine preparation method and the vaccine prepared by this method

Technical field

The present invention relates to using Pichia pastoris as expression system, the EV71 after codon optimization is co-expressed using different promoters P1 and 3C albumen, and obtain the preparation method of the virus sample particle vaccines with immunogenicity.It further relates to through party's legal system Standby vaccine.

Background technique

Enterovirns type 71 (EV71) belongs to Picornaviridae enterovirus genus, main to cause hand-foot-and-mouth disease and aseptic brain The central nervous system diseases such as film inflammation, brainstem encephalitis and polio sample paralysis, disable and case fatality rate are higher, be the extent of injury It is only second to the Neural invasion enterovirus of poliovirus.For EV71 with the mankind for unique host, major transmission path is excrement- Oral instructions are broadcast.Crowd is generally susceptible to EV71, but its main infection object is 5 years old Infants Below.Reported for the first time from 1974 with Come, EV71 causes more than ten scale outbursts in the whole world, only in China, just once in 1998 and 2007~2008 fraction of the year Tens of thousands of people's subinfection is not caused on the ground such as Taiwan and Shandong, and in certain research reports, hair of the EV71 in selected areas of China Sick rate is up to 10%.

EV71 virion is no coating icosahedral symmetry sphere, is made of 60 identical subunits.Its viral base Because group be single-stranded positive RNA, be about 7400bp, only one reading frame and be located at 5 ' and 3 ' noncoding region, coding more than one Polyprotein encodes tetra- capsid proteins of VP1~VP4 comprising 3 precursor proteins P1~P3, P1, and P2 and P3 encode 7 non-structural proteins It is white, including 2A, 2B, 2C, 3A, 3B, 3C, 3D.P1 be cut under the action of 3C or 3CD enzyme 3 protein subunits VP1, VP3 and VP0, VP0 can further be cut into VP2 and VP4.Wherein 3C is specific proteolytic enzyme, identifies the site Gln-Gly, is decomposed P1 precursor protein makes it release VP1~VP4 of composition viral capsid subunit, is finally completed the assembling of virion；3D is RNA polymerase.

According to gene homology difference, EV71 can be divided for tri- kinds of genotype of A, B, C, wherein Type B and c-type again can be into One step is subdivided into B1~B5, C1~C4 hypotype.The fashion trend of different genotype is presented certain areal variation, and areal The EV71 genotype of different time prevalence is again different.But since 1997, EV71 is more steady in the fashion trend of China It is fixed, mainly based on C4 type.

Since the pathogenesis of EV71 needs further to be disclosed with immunologic mechanism, so up to the present, still without effective The vaccine of antiviral drugs and pre- preventing virus infection.In recent years, also have many research shows that being achieved on EV71 vaccine research Some progress, including inactivated vaccine, recombinant vaccine, DNA vaccination, polypeptide vaccine and attenuated live vaccine.It is wherein most efficiently and safe Vaccine research direction be recombination virus-like particle (VLPs) vaccine.

Virus-like particle is the grain structure of the capsid protein composition with complete stereochemical structure of virus-free genome, both Without infectivity, and the epitope on capsid protein is remained, and stable structure, therefore compared to tradition attenuation or inactivation epidemic disease Seedling has more reliable safety, and compared to other recombinant vaccines, and the advantage of immunogenicity is also clearly.Since 1985 Year discovery hepatitis B (HBV) surface antigen (Surface Antigen, HBsAg) particle be found to can be used as hepatitis B vaccine with Come, VLPs technology rapidly develops in the research of new virus vaccine.Than more typical successfully using virus-like particle as epidemic disease The example of seedling is human papilloma virus (HPV) virus-like particle, and many results of study are shown, including Escherichia coli, yeast and bar Many expression systems including shape virus can all express recombination HPV late protein L1 and L2, obtain having virus particle structure L1/L2-VLPs or L1-VLPs after host is immunized together with aluminium adjuvant in these virus-like particles, can induce body to generate high The neutralizing antibody of titre reaches good protective effect.

The beginning of the nineties, David C.Ansardi et al. are successfully expressed in Hela cell and are obtained and EV71 virus structure The VLPs of the very similar poliovirus for belonging to Picornaviridae, main policies are cotransfections with coding ridge As a result the recombinant vector of marrow poliovirus P1 precursor protein and P3 precursor protein gene proves the 3CD egg in P3 precursor protein White combined enzyme agent plays specific proteolytic enzyme function, and the P1 precursor protein of coexpression is decomposed into VP1, VP0 and VP3 egg It is white, and the uniform virus-like particle of form is finally obtained in Electronic Speculum observation.In 2003, Yuchen Hu et al. was thin in insect In born of the same parents after recombinant baculovirus of the cotransfection with EV71 P1 and 3CD gene, it is similarly obtained EV71 virus-like particle.

Play the role of new studies have shown that 3C albumen equally can achieve 1 precursor protein of decomposed P, and 3C is specific protein White hydrolase, energy proteolysis cut EV71 precursor protein, this is most important to the synthesis of dynamic disease toxalbumin.

Summary of the invention

P1 precursor protein encoding gene and HRV 3CP encoding gene are only cloned into yeast expression vector by the present invention In, form stable homogeneous is successfully obtained after coexpression and the virus-like particle with immunogenicity, this conclusion also demonstrate EV71 The assembling of virion needs and only needs P1 precursor protein and HRV 3CP.

In order to meet the industrialized production of EV71 vaccine research and development, the present invention selects pichia yeast expression system.Pichia pastoris Expression system has that easy to operate, expression quantity is high, the advantages such as low in cost, is suitable for large-scale production recombinant protein.And P1 with It is more suitable for expressing in Pichia pastoris after the DNA sequences encoding codon optimization of 3C albumen, has effectively ensured virus The high expression quantity of corpuscular protein.

The case where being translated in host for simulated virus infection later period P1 and 3C albumen with expressing, through codon optimization P1 and 3C gene are cloned into identical carrier, can guarantee two gene copy numbers one for being integrated into Pichia pastoris genome in this way Cause, convenient for simultaneously regulate and control two kinds of recombinant protein expression quantity, avoid twice convert caused by copy number difference influence indirectly P1 or The expression of 3C.In addition, 3C is manipulated by weak promoter pPEX8, expression quantity is relatively low, and P1 then uses strong promoter pAOX1, table It is relatively high up to measuring, reach the mesh of more effective expression virion protein again while ensure that two gene copy numbers are consistent 's.

The first aspect of the present invention discloses a kind of method for preparing EV71 recombinant virus sample particle, and this method is by P1 precursor Protein coding gene and HRV 3CP encoding gene are cloned into yeast expression vector, obtain form stable homogeneous and have The virus-like particle of immunogenicity.

In a preferred embodiment, the sequence of the P1 precursor protein encoding gene and HRV 3CP encoding gene is With the sequence of Pichia pastoris codon optimization.In a further preferred embodiment, the P1 precursor protein encoding gene Sequence is SEQ ID NO:5, and the sequence of HRV 3CP encoding gene is SEQ ID NO:6.

In a further preferred embodiment, the P1 precursor protein encoding gene and HRV 3CP encoding gene pass through same One carrier cloning is into yeast expression vector.

In yet another preferred embodiment, the same expression vector includes the promoter of varying strength.More at one In preferred embodiment, the expression vector of the P1 precursor protein encoding gene is the BstBI/KpnI in pPICZ α B carrier The recombinant vector that site insertion SEQ ID NO:5 is constituted, the expression vector of the HRV 3CP encoding gene are in pPICZ α B The site the BstBI/KpnI insertion SEQ ID NO:6 of carrier and promoter (this that pAOX1 promoter is replaced with to pPEX8 gene Text is named as pPEXZ promoter, SEQ ID NO:13) recombinant vector that is constituted.

The second aspect of the present invention discloses EV71 recombinant virus sample particle prepared by the method for the present invention.

The third aspect of the present invention discloses the vaccine comprising EV71 recombinant virus sample particle of the invention.Preferably at one In embodiment, the vaccine also includes aluminum hydroxide adjuvant.

The fourth aspect of the present invention discloses the purposes of EV71 recombinant virus sample particle of the invention as vaccine.

The fifth aspect of the present invention discloses a kind of DNA molecular, and nucleotides sequence is classified as with Pichia pastoris codon optimization Coding EV71 virus P1 precursor protein or 3C albumen nucleotide sequence.In a preferred embodiment, the DNA molecular Nucleotides sequence be classified as SEQ ID NO:5 or SEQ ID NO:6.

The sixth aspect of the present invention discloses a kind of recombinant vector, wherein including the nucleotides sequence of fifth aspect present invention Column.

In one embodiment, the recombinant vector is pPICZ α B.

In a preferred embodiment, the pAOX1 promoter of pPICZ α B is replaced with weak promoter.It is more excellent at one In the embodiment of choosing, the weak promoter is pPEX8 promoter.

The seventh aspect of the present invention discloses the host cell of the recombinant vector comprising fifth aspect present invention.It is excellent at one It selects in embodiment, the host cell is Pichia pastoris.

Detailed description of the invention

Fig. 1 shows the agarose electrophoresis detection of double digestion (HindIII+KpnI) identification of recombination P1-pPICZ α B.M1: 250bp DNA Ladder；P:P1-pPICZ plasmid (non-digestion)；1:P1-pPICZ double digestion (HindIII+KpnI).

Fig. 2 shows the agarose electrophoresis detections of double digestion (HindIII+KpnI) identification of recombination 3C-pPICZ α B.M1: 250bp DNA Ladder；P:3C-pPICZ plasmid (non-digestion)；1:3C-pPICZ double digestion (HindIII+KpnI).

Fig. 3 shows the agarose electrophoresis detection of the PCR identification of recombination 3C-pPEXZ.1-5: using 3C-pPEXZ as template PCR product；6:ddH₂O is the control PCR product of template；M:DL2000 DNA Ladder；Lane 7:PEX-T is template PCR product；8:ddH₂O is the control PCR product of template.

Fig. 4 shows the agarose electrophoresis detection of the digestion identification of recombination P13C-pPEXZ.1:250bp ladder DNA marker；2. recombinating P13C-pPEXZ (BamHI+NcoI)；3. recombinating P13C-pPEXZ plasmid (non-digestion).

Fig. 5 shows Western-blot identification P13C-pPEXZ-SMD1168H inducing expression.

(a.100nm Fig. 6 shows the Electronic Speculum observation of P13C-pPEXZ expression gained recombination EV71 virus-like particle； b.50nm)。

Specific embodiment

The present invention provides a kind of Pichia pastoris strain that two kinds of albumen is co-expressed under different promoters control, this bacterial strains Genome conformity expresses the recombinant vector of P1 and the 3C gene of EV71 simultaneously, is up to the present to utilize Pichia pastoris table for the first time Up to system successful expression P1 albumen and 3C albumen to obtain the research of the EV71 virus-like particle of form stable homogeneous.The present invention Have the advantage that (1) compared to mammalian cell used in other similar research achievement or baculovirus expression system System, the pichia yeast expression system that the present invention uses is easy to operate, low in cost, and yield is high, and product property stable homogeneous is conducive to Large-scale industrial production；(2) 3C rather than 3CD are only expressed, and successfully guarantee coexpression P1 albumen be by 3C protein breakdown can group Dress up VP1~VP4 albumen of viral capsid；(3) P1 and 3C gene insertion identical carrier make it be integrated into Pichia pastoris genome Two gene copy numbers are consistent afterwards, are convenient for while regulating and controlling two kinds of recombinant protein expression quantity.(4) 3C is manipulated by weak promoter pPEX8, table Relatively low up to measuring, P1 then uses strong promoter pAOX1, and expression quantity is relatively high, and the simulated virus infection later period mainly expresses capsid The case where albumen；(5) pichia yeast expression system is adapted to after P1 and the optimization of 3C gene codon, reaches the mesh of high efficient expression 's.

Following embodiment by way of example illustrates the present invention, but the range being not intended to be limiting of the invention.

Embodiment

1. gene selects and codon optimization design

It is synthesized referring to C4 type strain in China BJ08-Z020-1 (GenBank:FJ606449.1) by technology well known in the art Encode the DNA sequence dna of EV71 P1 and 3C.BJ08-Z020-1 wild type P1 and 3C DNA sequence dna are SEQ ID NO:1 and SEQ ID NO:2, the amino acid sequence of the two coding are SEQ ID NO:3 and SEQ ID NO:4.To the DNA sequence dna of wild type P1 and 3C into Row transformation, codon is all made of the higher codon of frequency of use in Pichia pastoris, obtain optimization SEQ ID NO:5 and SEQ ID NO:6.It should be noted that not considering the frequency of use of codon merely when carrying out codon optimization, also needing Consider how to avoid translating under the early period for not changing amino acid sequence the mRNA come GC ratio is excessively high and mRNA two Some common restriction enzyme sites are avoided in influence of the level structure to translation efficiency, are comprehensively considered and are optimized EV71 P1 and 3C DNA sequence dna.

2.P13C-pPEXZ recombinant expression carrier constructs

P1 and 3C gene are obtained by way of gene chemical synthesis according to above-mentioned synthetic method first, then construct P1- PPICZaB and 3C-pPICZaB recombinant vector.The AOX1 promoter of 3C-pPICZaB is replaced with into PEX8 promoter again, is obtained 3C-pPEXZ.It is inserted by way of finally being connect with the P1 expression cassette of AOX1 transcription termination region digestion with AOX1 promoter 3C-pPEXZ obtains P1 expression cassette direction P13C-pPEXZ identical with 3C expression cassette direction.

Specific implementation step is as follows:

2.1 P1-pPICZ α B building

The P1 sequence of synthesis gained SEQ ID NO:5 is cloned into pPICZ α B carrier by following method.

Using the P1 sequence of SEQ ID NO:5 as template, forward primer: 5 ' CCAAGCTCTTCGAAACGATGGGTTCTCAA GTCT 3'(SEQ ID NO:7)；Reverse primer: 5 ' AGCGGTACCCTATTATAAAGTAGTA 3'(SEQ ID NO:8).It is logical Cross the P1 DNA fragmentation that PCR mode expands to be respectively provided with BstBI and KpnI to both ends.All primers mentioned by the present invention are equal For designed, designed, Ying Jun Bioisystech Co., Ltd in Shanghai is entrusted to be synthesized.PCR program: 94 DEG C 5 minutes, 94 DEG C of 30 seconds, 57 Recycle within 15 seconds within DEG C 30 seconds, 72 DEG C 2 points 30 times, 72 DEG C 10 minutes, 10 DEG C 10 minutes, end of run.PCR product is with Ago-Gel Electroresis appraisal simultaneously recycles band (Qiagen plastic recovery kit) at about 2600bp.Recycle segment and pPICZ α B with BstBI and KpnI (restriction enzyme involved in the present invention is purchased from NEB company) joint digestion, agarose gel electrophoresis are identified simultaneously About 2600bp and about 3300bp segment is separately recovered.P1 segment and pPICZ α B are connected with molar ratio for the ratio T4 of 5:1 after recycling The connection overnight of 16 DEG C of enzyme (Takara) is connect, second day connection product is transformed into E.coli DH5 α (purchased from Beijing ancient cooking vessel state biotechnology Co., Ltd), less salt LB (1% tryptone, 0.5% yeast powder, 0.5%NaCl) plate is coated on (containing 25 μ g/ml Zeocin), it is incubated overnight for 37 DEG C.Picking Partial Conversion rear clone extracts plasmid, double digestion (HindIII+KpnI) identification, agar Sugared electrophoresis detection (Fig. 1).Identification gained Positive recombinant clones save after DNA sequencing verifying is correct, this recombinant vector is named as P1-pPICZαB。

2.2 3C-pPICZ α B building

The 3C sequence of synthesis gained SEQ ID NO:6 is cloned into pPICZ α B carrier by following method.

Using the 3C sequence of SEQ ID NO:6 as template, with forward primer: 5 ' TTTAGTTCTTCGAAGCTAGCATGGGTC CATCTCTGG 3 ' (SEQ ID NO:9) and reverse primer: 5 ' GGCGGTACCCTATTATTGTTCTGAA 3’(SEQ ID NO: 10) expand to be respectively provided with the 3C DNA fragmentation of BstBI and KpnI restriction enzyme site to both ends by PCR mode.PCR program: 94 DEG C 5 minutes, 94 DEG C recycled 30 times for 30 seconds, 55 DEG C for 30 seconds, 72 DEG C for 50 seconds, 72 DEG C 10 minutes, 10 DEG C 10 minutes, end of run.PCR Product is identified with agarose gel electrophoresis and recycles band at about 600bp (Qiagen gel extraction kit).Recycle piece Section combines digestion with pPICZ α B with BstBI and KpnI, and agarose gel electrophoresis is identified and about 600bp peace treaty is separately recovered 3300bp segment.3C segment and pPICZ α B are stayed overnight for the ratio of 5:1 with 16 DEG C of T4 ligase (Takara) after recycling with molar ratio Connection, second day connection product are transformed into E.coli DH5 α, are coated on less salt LB plate (containing 25 μ g/ml Zeocin), 37 DEG C It is incubated overnight.Picking Partial Conversion rear clone extracts plasmid, double digestion (HindIII+KpnI) identification, agarose electrophoresis detection (Fig. 2).Identification gained Positive recombinant clones save after DNA sequencing verifying is correct, this recombinant vector is named as 3C-pPICZ α B.

2.3 3C-pPEXZ building

Using GS115 Pichia pastoris genomic DNA as template, with forward primer: 5 ' GCCGAGATCTTATATCTCTATGTAGT 3'(BglII)(SEQ ID NO:11)；Reverse primer: 5 ' CCATGCTAGCTAACAGGCACCTGAAG 3 ' (NheI) (SEQ ID NO:12) expands to obtain both ends difference by PCR mode PPEX8 promoter (GenBank number: 2056276 to 2057130 of CP014715.1, from) with BglII and NheI DNA fragmentation (SEQ ID NO:13), be named as pPEX8 promoter.PCR program: 94 DEG C 5 minutes, 94 DEG C 30 seconds, 55 DEG C 30 Second, 72 DEG C 50 seconds recycle 30 times, 72 DEG C 10 minutes, 10 DEG C 10 minutes, end of run.PCR product is reflected with agarose gel electrophoresis Determine and recycles band at about 800bp (Qiagen gel extraction kit).PPEX8 and 3C-pPICZ the α B of recycling with The about 800bp and 3C-pPICZ α B's of pPEX8 identified and are separately recovered to BglII and NheI joint digestion, agarose gel electrophoresis About 3900bp segment.PPEX8 segment and 3CD-pPICZ α B are the ratio T4 ligase of 5:1 with molar ratio after recycling (Takara) it connects overnight for 16 DEG C, second day connection product is transformed into E.coli DH5 α, is coated on less salt LB plate (containing 25 μ g/ Ml Zeocin), 37 DEG C are incubated overnight.Picking Partial Conversion rear clone extracts plasmid, and PCR identifies the pPEX8 piece in recombinant plasmid Section, agarose electrophoresis detect (Fig. 3).Wherein 1~No. 5 clone is positive colony.Identification gained Positive recombinant clones are surveyed through DNA It is saved after sequence verifying is correct, this recombinant vector is named as 3C-pPEXZ.

2.4 P13C-pPEXZ building

Combine digestions P1-pPICZ α B with BglII+BamHI, cuts with AOX1 promoter and AOX1 tanscription termination The P1 expression cassette in area；3C-pPEXZ is digested with BamHI, agarose gel electrophoresis is identified and the pact of P1 expression cassette is separately recovered The about 3800bp segment of 4000bp and 3C-pPEXZ recycles 3C-pPEXZ alkaline phosphatase (NEB) dephosphorylation.P1 after recycling Expression cassette segment and 3C-pPEXZ are connected with the ratio that molar ratio is 1:3 with 16 DEG C of T4 ligase (Takara) overnight, and second day Connection product is transformed into E.coli DH5 α, is coated on less salt LB plate (containing 25 μ g/ml Zeocin), 37 DEG C are incubated overnight.It chooses Partial Conversion rear clone is taken to extract plasmid, double digestion identifies (BamHI+NcoI), and agarose electrophoresis detects (Fig. 4).Identification gained The P1 expression cassette of positive restructuring is identical as 3C expression cassette direction, this clone saves after DNA sequencing verifying is correct, this recombinant vector It is named as P13C-pPEXZ.

3.P13C-pPEXZ recombinant strains construction and expression

Host strain used in the present invention is Pichi strain (SMD1168H).P13C-pPEXZ Pichiapastoris expression strain tool Body construction step is as follows:

P13C-pPEXZ is linearized with SacI, phenol after endonuclease reaction: chloroform removes removing protein, adds 2.5 times of volumes Dehydrated alcohol, 1/10 volume 3M NaAc (pH5.2) precipitate DNA, and gained precipitating is after 75% ethanol washing, drying with a small amount of nothing Bacterium ddH2O dissolution precipitating, electricity turn Pichia pastoris SMD1168H, are coated on YPDS (1% yeast powder, 2% peptone, 2% grape Sugar, 1M sorbic alcohol, 2% agar powder) plate (containing 200 μ g/ml Zeocin), 30 DEG C are cultivated 3 days, and total hectogram is grand.Therefrom picking Tens of clones are inoculated in YPD (1% yeast powder, 2% peptone, 2% glucose, 2% agar powder) plate (containing 1500 μ g/ml Zeocin), screening plasmid height copies bacterial strain, and 30 DEG C are cultivated 2 days.Part clonal growth is very fast, the best number of picking growing state A clone is inoculated in 4ml YPD fluid nutrient medium, after 24 hours replace BMMY culture medium (1% yeast powder, 2% peptone, 100mM phosphate buffer pH6.0,1.34%YNB, 0.5% methanol, 0.00004% biotin), 0.5% methanol induction 72 is small When after collect thallus.For thallus after bead is broken, centrifugation gained supernatant identifies (Fig. 5) with Western-blot, used one Resist and resist for the self-control rabbit of anti-VP1 albumen more, secondary antibody is goat anti-rabbit igg-HRP.The results show that weight of the EV71 destination protein in building Pichia yeast is intracellular expression for group.

4.EV71 the fermentation tank culture of recombinant protein

1 strain glycerol cryopreservation tube is taken from work seed bank, 100 μ L access 5ml YPD culture medium is drawn after thawing, 280rpm, 30 DEG C are cultivated 20 hours.OD₆₀₀1~2.The activating solution 1ml of microscopy qualification is accessed into 500ml YPD culture medium, 280rpm, 30 DEG C are cultivated 20 hours.OD₆₀₀2~6.Microscopy is without living contaminants.It is fermented using BIOENGINEERING NLF22 Tank, fermentation basal salt media BSM₁(K₂SO₄273g, MgSO₄109g, CaSO₄.2H₂O 17.6g, H₃PO₄400.5ml KOH 62g, glycerol 600g, PTM1 60ml, GPE 1ml, deionized water add to 15L).It is inoculated with by 1:15.Fermentation temperature is 30.0 DEG C, initial pH5.00, revolving speed 300rpm culture, ventilatory capacity 0.5vvm, DO100% add PTM₁(CuSO₄.5H₂O 6.0g, NaI 0.008g, MnSO₄3.0g, NaMoO₄0.2g, H₃BO₃0.02g, ZnSO₄20.0g CoCl₂0.5g, FeSO₄.7H₂O 65.0g, biotin 0.2g, H₂SO₄5.0ml, deionized water add to 1L) trace salt.The left side of initial about 20 hours multiplicative stages The right side maintains oxygen dissolving value to be higher than 30%, and when carbon source is exhausted, thallus weight in wet base reaches about 100g/L.Add 50% glycerol it is molten Liquid (every liter of addition 12ml PTM1).Dissolved oxygen level is maintained by adjusting speed of agitator, air mass flow, tank pressure (< 0.8bar) 20% or more.It adds about 8 hours, when thallus weight in wet base about 350g/L.PH value control is adjusted to 6.00 simultaneously, is added (every liter of methanol Add 12mlPTM1) induction.Oxygen dissolving value is maintained to be higher than 20%, 30 DEG C of temperature, pH value control is 6.00.Fermentation in 40 hours is induced to tie Fermentation liquid is released when beam.Fermentation liquid is through 4800rpm, and 20 minutes, 4 DEG C were collected after centrifugation bacterium mud, freezes in -20 DEG C.

5.EV71 virus-like particle harvest

Cleaning buffer solution (100mM PB is added by 1:3 in P13C-pPEXZ-SMD1168H thallus after fermentation inducement PH7.0,0.15M NaCl) mixing, it mixes well, in 8000rpm, is centrifuged 5 minutes, collects cell, repeat above operation two times. Broken bacterium buffer is added by 1:5 in cell after cleaning to mix, after mixing well, high pressure is crushed the above cell suspension, and repeats Operation, makes 90% clasmatosis.The broken bacterium solution that high pressure is crushed, in 9000rpm, 30 minutes, 10 DEG C of centrifuge separations, collect from Supernatant after the heart.Supernatant 40000rpm after taking 1ml to break bacterium, 3 hours, 4 DEG C of ultracentrifugations discarded supernatant solution, precipitated with 100 μ l PBS (10mM, pH7.4) is resuspended.Transmission electron microscope observing is the results show that be presented shape in bacteria break supernatant liquid after ultracentrifugation The virus-like particle (Fig. 6) of state stable homogeneous, particle diameter is between 20-30nm.

Every liter of fermentation liquid can harvest 300 grams of thallus, after purification step, pure VLP be obtained, according to the production of final VLP The VLP expression quantity that the yield of amount and purification step calculates the method for the present invention is about that 150mg/ rises fermentation liquid.Those skilled in the art Member can be illustrated, and the recombinant virus sample granule protein expression quantity of this order of magnitude can meet the requirement of industrialized production, with existing skill Art is compared and achieves unexpected technological progress.

The preparation of 6.EV71 virus sample particle vaccines

With reference to " recombinant hepatitis B vaccine (the wine brewing ferment of Pharmacopoeia of the People's Republic of China third portion (version in 2010) It is female) " chapter, the method for page 126, the EV71 virus-like particle protein that purifying is obtained adsorbs aluminum hydroxide adjuvant, is prepared into pre- The candidate vaccine of anti-EV71 virus.

The measurement of 7.EV71 virus-like particle immunogenicity and immune protective

The SPF grade BALB/c mouse (Shanghai western Poole-Bi Kai experimental animal Co., Ltd) for choosing 6~8 week old, is divided into 2 Group, every group of 8 mouse.The buffer that 1st group of mouse uses 0.5ml to contain aluminium adjuvant is immunized (as adjuvant control group), and the 2nd The group VLP (as vaccine group) for the absorption aluminium adjuvant that 0.5ml concentration is 10 μ g/ml, exempted from respectively at intraperitoneal injection in the 0th, 14 day Epidemic disease is immunized twice altogether, takes a blood sample within second immune latter two weeks.By the blood collected after 37 DEG C of placement 1h, 4000g centrifugation 10min draws supernatant to get mouse polyvalent antibody is arrived, stores in -20 DEG C, and detect the binding antibody titre and neutralization of mouse serum EV71 antiviral antibody titre, the specific method is as follows:

Binding antibody titer determination method is as follows: with the EV71 virus vlps of coating buffer dilution purifying to 1 μ g/ml, to enzyme mark Respectively add 0.1ml in each shrinkage pool of plate, 4 DEG C overnight.Coating buffer is removed, with 0.3ml PBST (10mM PBS+0.05%Tween- 20) shrinkage pool is washed.2 hours are kept the temperature in 37 DEG C with 0.3ml confining liquid (5% skimmed milk power+PBST).Every shrinkage pool is added slow with dilution Fliud flushing (2% skimmed milk power+PBST) is each with the tested serum (dilution gradient is from 1:100 to 1:3278800) of different gradient dilutions 0.1ml keeps the temperature 1 hour in 37 DEG C and moves back serum deprivation liquid, washs shrinkage pool with 0.3ml cleaning solution.Then it is added to every shrinkage pool with dilute Buffer is released with goat anti-mouse igg each 0.1ml of 1:5000 diluted HRP label, 37 DEG C are removed enzyme mark after heat preservation 0.5 hour Liquid washs shrinkage pool with 0.3ml cleaning solution；Then 0.1ml DAB developing solution is added into shrinkage pool, room temperature is protected from light effect after twenty minutes Add 2M H₂SO₄0.05ml terminate liquid terminates reaction, and measures OD with enzyme mark colour comparatour₄₅₀Value, according to OD₄₅₀Reading value calculates blood Clear antibody titer value.

Neutralizing antibody titers measuring method is as follows: in 96 porocyte culture plates, serum to be checked is subjected to gradient dilution, it is dilute Multiple is released from 1:8 to 1:4096, each dilution takes EV71 virus liquid (the titre 100CCID of 0.05ml and 0.05ml₅₀/ It 0.05ml) mixes, after mixed liquor is put into 37 DEG C of incubations 2 hours, it is 2 × 10 that concentration, which is added,⁵The RD cell suspension of a/ml, then It is put into 37 DEG C of CO2 incubators and is incubated for culture.It observes CPE (cytopathic effect) daily using inverted microscope, and records disease Malicious titration results to inhibit the inverse of the serum highest dilution of 50% cytopathy were in final serum and anti-after 6-7 days Body titre value.

The results are shown in Table 1 for serum binding antibody titre and neutralization antiviral antibody titre, from the results shown in Table 1 There is the immune protective of very strong immunogenicity and external virus using the EV71 vaccine immune mouse of virus-like particle.

Serum antibody titer value obtained by mouse and neutralizing antibody titers value is immunized in 1 EV71 virus-like particle of table

" technology well known in the art " described herein refers to that those of ordinary skill in the art can be according to experiment purpose from ability The technology that can be found or obtain in the documents such as dictionary disclosed in domain or related fields, textbook, patent, paper, such as in " molecule Clone " described in technology.

SEQUENCE LISTING

<110>Shanghai Runze Biotechnology Co., Ltd

<120>EV71 vaccine preparation method and the vaccine prepared by this method

<130> ZR1810001

<160> 13

<170> PatentIn version 3.3

<210> 1

<211> 2586

<212> DNA

<213> Enterovirus 71

<400> 1

atgggttcgc aagtgtctac acagcgctcc ggttctcacg aaaactcaaa ctcagccact 60

gagggttcta ccataaacta caccaccatc aattactaca aagactccta tgctgccaca 120

gcaggcaaac agagtctcaa acaggatcca gacaagtttg caaatcctgt taaagacatc 180

ttcactgaaa tggcagcgcc actgaagtcc ccatccgctg aggcatgtgg atacagtgat 240

cgagtggcgc aattaactat tggcaactcc accatcacca cgcaagaagc ggctaacatt 300

atagtcggtt atggtgagtg gccttcctac tgctcagatt ctgacgctac agcagtggat 360

aaaccaacgc gcccggatgt ttcagtgaac aggttttaca cattggacac taaattgtgg 420

gagaaatcgt ccaagggatg gtactggaag ttcccggatg tgttaactga aactggggtc 480

tttgggcaaa atgcacaatt ccactacctc taccgatcag ggttctgcat ccacgtgcag 540

tgcaatgcca gtaaattcca ccaaggagca ctcctagtcg ctgtcctacc agagtatgtc 600

attgggacag tggcaggcgg tacagggacg gaagatactc acccccctta caaacagact 660

caacccggcg ccgatggctt cgagttgcaa catccgtacg tgcttgatgc tggcatccca 720

atatcacagt taacagtgtg cccacaccag tggattaatt tgaggaccaa caattgtgct 780

acaataatag tgccatacat taacgcactg ccttttgatt ctgccttgaa ccattgcaac 840

tttggcctgt tagttgtgcc tattagccca ctagactacg accaaggagc gacgccagta 900

attcctataa ctatcacatt ggccccaatg tgttctgaat tcgcaggtct taggcaggca 960

gtcacgcaag ggttccccac cgagctaaaa cctggcacaa atcaattttt aaccaccgat 1020

gatggcgttt cagcacctat tctaccaaac ttccacccca ccccgtgtat ccacatacct 1080

ggtgaagtta ggaacttgct agagttatgc caggtggaga ccattctgga ggttaacaat 1140

gtgcccacga atgccactag cttaatggag agactgcgct tcccggtctc agcacaagca 1200

gggaaaggtg agctgtgtgc ggtgtttaga gccgatcctg ggcgaaatgg accatggcaa 1260

tccaccttac tgggtcagtt gtgcgggtac tacacccagt ggtcaggatc attggaagtc 1320

accttcatgt ttactggatc cttcatggct accggcaaga tgctcatagc ctatacaccg 1380

ccaggaggtc ctctgcccaa ggaccgggcg accgccatgt tgggcacgca cgtcatctgg 1440

gattttgggc tacaatcgtc tgttaccctt gtaataccat ggatcagcaa cactcattat 1500

agagcacatg cccgagatgg agtgtttgac tactacacca cagggttagt cagtatatgg 1560

tatcagacaa attacgtggt tccaatcggt gcgcccaata cagcctatat aatagcacta 1620

gcggcagccc aaaagaactt cactatgaaa ttgtgcaagg atgctagtga tatcctgcag 1680

acgggcacca tccagggaga tagggtggca gatgtaattg aaagttccat aggagatagc 1740

gtgagcagag ccctcactca cgctctacca gcacccacag gccagaacac acaggtgagc 1800

agtcatcgac tggatacagg caaggttcca gcactccaag ctgctgaaat tggagcatca 1860

tcaaatgcta gtgacgagag catgattgag acacgctgtg ttcttaactc gcacagtaca 1920

gctgagacca ctcttgatag tttcttcagc agggcgggat tagttggaga gatagatctc 1980

cctcttgagg gcacaactaa cccaaatggt tatgccaact gggacataga tataacaggt 2040

tacgcgcaaa tgcgtagaaa ggtagagcta ttcacctaca tgcgctttga tgcagagttc 2100

acttttgttg cgtgcacacc caccggggaa gttgtcccac aattgctcca atatatgttt 2160

gtgccacctg gagcccctaa gccagattct agggaatccc ttgcatggca aaccgccact 2220

aacccctcag tttttgtcaa gctgtcagac cctccagcgc aggtttcagt gccattcatg 2280

tcacctgcga gtgcttatca atggttttat gacggatatc ccacattcgg agaacacaaa 2340

caggagaaag atcttgaata cggggcatgt cctaataaca tgatgggcac gttctcagtg 2400

cggactgtgg ggacctccaa gtccaagtac cctttagtgg ttaggattta catgagaatg 2460

aagcacgtca gggcgtggat acctcgcccg atgcgtaacc agaactacct attcaaagcc 2520

aacccaaatt atgctggcaa ctccattaag ccaactggtg ccagtcgcac agcgatcacc 2580

actctt 2586

<210> 2

<211> 549

<212> DNA

<213> Enterovirus 71

<400> 2

ggcccgagcc ttgactttgc tctctcccta ctgagaagga acatcaggca agtccaaaca 60

gaccaggggc atttcaccat gttgggtgtt agggatcgct tagcagtcct cccacgccac 120

tcacaacctg gcaaaactat ttggattgag cacaaactcg tgaacgtcct tgatgcagtt 180

gaactggtgg atgagcaagg agtcaacctg gaattaaccc tcatcactct tgacaccaac 240

gaaaagttta gggatatcac caaattcatc ccagaaaata ttagcactgc tagtgatgcc 300

accctagtga tcaacacgga gcacatgcca tcaatgtttg tcccggtggg tgacgttgtg 360

cagtatggct tcttgaatct cagtggtaag cctacccatc gcaccatgat gtacaacttt 420

cctactaaag caggacagtg tggaggagtg gtgacatctg ttgggaaggt tgtcggtatt 480

cacattggtg gcaatggcag acaaggtttt tgcgcaggcc tcaaaaggag ttactttgtt 540

agtgaacaa 549

<210> 3

<211> 862

<212> PRT

<213> Enterovirus 71

<400> 3

Met Gly Ser Gln Val Ser Thr Gln Arg Ser Gly Ser His Glu Asn Ser

1 5 10 15

Asn Ser Ala Thr Glu Gly Ser Thr Ile Asn Tyr Thr Thr Ile Asn Tyr

20 25 30

Tyr Lys Asp Ser Tyr Ala Ala Thr Ala Gly Lys Gln Ser Leu Lys Gln

35 40 45

Asp Pro Asp Lys Phe Ala Asn Pro Val Lys Asp Ile Phe Thr Glu Met

50 55 60

Ala Ala Pro Leu Lys Ser Pro Ser Ala Glu Ala Cys Gly Tyr Ser Asp

65 70 75 80

Arg Val Ala Gln Leu Thr Ile Gly Asn Ser Thr Ile Thr Thr Gln Glu

85 90 95

Ala Ala Asn Ile Ile Val Gly Tyr Gly Glu Trp Pro Ser Tyr Cys Ser

100 105 110

Asp Ser Asp Ala Thr Ala Val Asp Lys Pro Thr Arg Pro Asp Val Ser

115 120 125

Val Asn Arg Phe Tyr Thr Leu Asp Thr Lys Leu Trp Glu Lys Ser Ser

130 135 140

Lys Gly Trp Tyr Trp Lys Phe Pro Asp Val Leu Thr Glu Thr Gly Val

145 150 155 160

Phe Gly Gln Asn Ala Gln Phe His Tyr Leu Tyr Arg Ser Gly Phe Cys

165 170 175

Ile His Val Gln Cys Asn Ala Ser Lys Phe His Gln Gly Ala Leu Leu

180 185 190

Val Ala Val Leu Pro Glu Tyr Val Ile Gly Thr Val Ala Gly Gly Thr

195 200 205

Gly Thr Glu Asp Thr His Pro Pro Tyr Lys Gln Thr Gln Pro Gly Ala

210 215 220

Asp Gly Phe Glu Leu Gln His Pro Tyr Val Leu Asp Ala Gly Ile Pro

225 230 235 240

Ile Ser Gln Leu Thr Val Cys Pro His Gln Trp Ile Asn Leu Arg Thr

245 250 255

Asn Asn Cys Ala Thr Ile Ile Val Pro Tyr Ile Asn Ala Leu Pro Phe

260 265 270

Asp Ser Ala Leu Asn His Cys Asn Phe Gly Leu Leu Val Val Pro Ile

275 280 285

Ser Pro Leu Asp Tyr Asp Gln Gly Ala Thr Pro Val Ile Pro Ile Thr

290 295 300

Ile Thr Leu Ala Pro Met Cys Ser Glu Phe Ala Gly Leu Arg Gln Ala

305 310 315 320

Val Thr Gln Gly Phe Pro Thr Glu Leu Lys Pro Gly Thr Asn Gln Phe

325 330 335

Leu Thr Thr Asp Asp Gly Val Ser Ala Pro Ile Leu Pro Asn Phe His

340 345 350

Pro Thr Pro Cys Ile His Ile Pro Gly Glu Val Arg Asn Leu Leu Glu

355 360 365

Leu Cys Gln Val Glu Thr Ile Leu Glu Val Asn Asn Val Pro Thr Asn

370 375 380

Ala Thr Ser Leu Met Glu Arg Leu Arg Phe Pro Val Ser Ala Gln Ala

385 390 395 400

Gly Lys Gly Glu Leu Cys Ala Val Phe Arg Ala Asp Pro Gly Arg Asn

405 410 415

Gly Pro Trp Gln Ser Thr Leu Leu Gly Gln Leu Cys Gly Tyr Tyr Thr

420 425 430

Gln Trp Ser Gly Ser Leu Glu Val Thr Phe Met Phe Thr Gly Ser Phe

435 440 445

Met Ala Thr Gly Lys Met Leu Ile Ala Tyr Thr Pro Pro Gly Gly Pro

450 455 460

Leu Pro Lys Asp Arg Ala Thr Ala Met Leu Gly Thr His Val Ile Trp

465 470 475 480

Asp Phe Gly Leu Gln Ser Ser Val Thr Leu Val Ile Pro Trp Ile Ser

485 490 495

Asn Thr His Tyr Arg Ala His Ala Arg Asp Gly Val Phe Asp Tyr Tyr

500 505 510

Thr Thr Gly Leu Val Ser Ile Trp Tyr Gln Thr Asn Tyr Val Val Pro

515 520 525

Ile Gly Ala Pro Asn Thr Ala Tyr Ile Ile Ala Leu Ala Ala Ala Gln

530 535 540

Lys Asn Phe Thr Met Lys Leu Cys Lys Asp Ala Ser Asp Ile Leu Gln

545 550 555 560

Thr Gly Thr Ile Gln Gly Asp Arg Val Ala Asp Val Ile Glu Ser Ser

565 570 575

Ile Gly Asp Ser Val Ser Arg Ala Leu Thr His Ala Leu Pro Ala Pro

580 585 590

Thr Gly Gln Asn Thr Gln Val Ser Ser His Arg Leu Asp Thr Gly Lys

595 600 605

Val Pro Ala Leu Gln Ala Ala Glu Ile Gly Ala Ser Ser Asn Ala Ser

610 615 620

Asp Glu Ser Met Ile Glu Thr Arg Cys Val Leu Asn Ser His Ser Thr

625 630 635 640

Ala Glu Thr Thr Leu Asp Ser Phe Phe Ser Arg Ala Gly Leu Val Gly

645 650 655

Glu Ile Asp Leu Pro Leu Glu Gly Thr Thr Asn Pro Asn Gly Tyr Ala

660 665 670

Asn Trp Asp Ile Asp Ile Thr Gly Tyr Ala Gln Met Arg Arg Lys Val

675 680 685

Glu Leu Phe Thr Tyr Met Arg Phe Asp Ala Glu Phe Thr Phe Val Ala

690 695 700

Cys Thr Pro Thr Gly Glu Val Val Pro Gln Leu Leu Gln Tyr Met Phe

705 710 715 720

Val Pro Pro Gly Ala Pro Lys Pro Asp Ser Arg Glu Ser Leu Ala Trp

725 730 735

Gln Thr Ala Thr Asn Pro Ser Val Phe Val Lys Leu Ser Asp Pro Pro

740 745 750

Ala Gln Val Ser Val Pro Phe Met Ser Pro Ala Ser Ala Tyr Gln Trp

755 760 765

Phe Tyr Asp Gly Tyr Pro Thr Phe Gly Glu His Lys Gln Glu Lys Asp

770 775 780

Leu Glu Tyr Gly Ala Cys Pro Asn Asn Met Met Gly Thr Phe Ser Val

785 790 795 800

Arg Thr Val Gly Thr Ser Lys Ser Lys Tyr Pro Leu Val Val Arg Ile

805 810 815

Tyr Met Arg Met Lys His Val Arg Ala Trp Ile Pro Arg Pro Met Arg

820 825 830

Asn Gln Asn Tyr Leu Phe Lys Ala Asn Pro Asn Tyr Ala Gly Asn Ser

835 840 845

Ile Lys Pro Thr Gly Ala Ser Arg Thr Ala Ile Thr Thr Leu

850 855 860

<210> 4

<211> 183

<212> PRT

<213> Enterovirus 71

<400> 4

Gly Pro Ser Leu Asp Phe Ala Leu Ser Leu Leu Arg Arg Asn Ile Arg

1 5 10 15

Gln Val Gln Thr Asp Gln Gly His Phe Thr Met Leu Gly Val Arg Asp

20 25 30

Arg Leu Ala Val Leu Pro Arg His Ser Gln Pro Gly Lys Thr Ile Trp

35 40 45

Ile Glu His Lys Leu Val Asn Val Leu Asp Ala Val Glu Leu Val Asp

50 55 60

Glu Gln Gly Val Asn Leu Glu Leu Thr Leu Ile Thr Leu Asp Thr Asn

65 70 75 80

Glu Lys Phe Arg Asp Ile Thr Lys Phe Ile Pro Glu Asn Ile Ser Thr

85 90 95

Ala Ser Asp Ala Thr Leu Val Ile Asn Thr Glu His Met Pro Ser Met

100 105 110

Phe Val Pro Val Gly Asp Val Val Gln Tyr Gly Phe Leu Asn Leu Ser

115 120 125

Gly Lys Pro Thr His Arg Thr Met Met Tyr Asn Phe Pro Thr Lys Ala

130 135 140

Gly Gln Cys Gly Gly Val Val Thr Ser Val Gly Lys Val Val Gly Ile

145 150 155 160

His Ile Gly Gly Asn Gly Arg Gln Gly Phe Cys Ala Gly Leu Lys Arg

165 170 175

Ser Tyr Phe Val Ser Glu Gln

180

<210> 5

<211> 2592

<212> DNA

<213> Artificial

<400> 5

atgggttctc aagtctcaac acaaaggtca ggatctcatg agaactccaa ttctgctaca 60

gagggatcaa ccattaatta tacaaccatt aactactaca aggactcata tgccgctaca 120

gccggaaagc agtccttgaa acaagaccca gataagttcg ccaaccctgt gaaggatatc 180

tttacagaga tggctgcacc attgaagtcc ccatccgctg aggcctgtgg atattctgat 240

agagtcgctc aattgactat tggtaactcc actataacca cccaagaagc agccaatatt 300

atcgttggtt acggtgagtg gccatcatat tgctcagact ccgatgctac agccgtcgat 360

aaaccaacaa gacctgatgt ttcagttaac cgtttctaca cccttgacac taaactgtgg 420

gaaaagtctt ccaagggttg gtactggaaa tttccagacg ttttgacaga aactggtgtt 480

ttcggtcaaa acgctcaatt ccattatttg tatcgttccg gtttctgtat tcatgtgcag 540

tgtaacgctt caaaatttca tcaaggtgct ttgcttgttg ccgttcttcc tgaatatgtt 600

ataggtactg tggccggagg tactggaacc gaagatactc atcctccata taagcaaact 660

caacctggag ctgatggatt tgaactgcaa catccatacg ttttagatgc aggtatacct 720

atttcccaac ttaccgtgtg tccacaccag tggattaatc tgaggactaa caactgcgca 780

accattatcg ttccttatat taacgcactt ccatttgatt ctgctttgaa ccactgcaat 840

tttggactgt tagtcgtccc aatttctcca ttagactacg accagggtgc cactccagtg 900

attcctatca ccataactct ggctccaatg tgctctgagt tcgctggttt gagacaggcc 960

gtcactcagg gttttcctac cgagttaaag ccaggaacca atcagttctt gactaccgac 1020

gatggtgttt ctgctccaat tctgcctaac tttcatccaa ctccatgtat ccatatacct 1080

ggagaagtcc gtaatttgct tgagctttgt caagttgaaa ccattttaga agtgaacaat 1140

gttccaacca acgcaacttc tttgatggag agactgagat tccctgtttc tgctcaggct 1200

ggaaagggag aactttgtgc tgttttcaga gcagacccag gtcgtaacgg accatggcag 1260

tctactttgc tgggacaatt gtgcggttat tatacccaat ggtccggttc attggaagtc 1320

acttttatgt ttactggatc attcatggct actggtaaga tgttgattgc atacacacct 1380

cctggaggac cacttcctaa ggacagagca actgctatgt taggtactca cgttatctgg 1440

gactttggat tgcaatcatc tgttactctt gttattcctt ggatttctaa cacccattat 1500

agagcacatg ctagggacgg agttttcgat tattacacca caggacttgt gtctatttgg 1560

tatcagacaa actatgttgt gcctatcggt gcacctaaca ctgcttacat catcgctctt 1620

gctgcagctc agaagaattt taccatgaaa ttgtgtaaag atgcttctga catcctgcaa 1680

accggtacta tccaaggtga cagagttgcc gatgttatcg aatcctcaat cggagactca 1740

gtttccagag cattgactca cgccttgcca gctccaaccg gtcagaacac ccaagtttca 1800

tctcacaggt tggatactgg taaggtccca gcattacaag ctgctgaaat cggtgcttct 1860

tcaaacgcct ctgacgaatc tatgatagag accagatgtg tcttgaactc ccactcaact 1920

gcagagacaa cattggactc attcttctca agggctggtt tggttggtga gatcgatttg 1980

cctttagaag gtactactaa cccaaatggt tacgctaatt gggatataga tattacagga 2040

tatgctcaaa tgaggagaaa ggttgagctg tttacataca tgcgttttga tgctgagttc 2100

acttttgtgg cttgtacacc aactggtgag gttgttccac aactgttgca gtacatgttt 2160

gtgcctccag gtgctcctaa acctgattct agagaatctt tagcctggca gacagctaca 2220

aatccatccg tgttcgtgaa gttgtctgat ccacctgcac aagtgtctgt cccattcatg 2280

tccccagcat ctgcctacca atggttctac gatggatacc caactttcgg tgagcacaaa 2340

caggaaaagg atttagaata cggagcatgc cctaataata tgatgggtac attctctgtc 2400

agaacagtcg gtacttccaa atctaagtac cctctggtcg tcagaattta catgagaatg 2460

aaacacgtca gagcctggat tcctcgtcct atgagaaatc agaattactt attcaaagcc 2520

aatcctaatt acgccggaaa ttccattaaa cctactggag cctccagaac agccattact 2580

actttataat ag 2592

<210> 6

<211> 558

<212> DNA

<213> Artificial

<400> 6

atgggtccat ctctggactt cgctttgtct cttttaagaa gaaacattag acaagtccag 60

actgatcaag gacatttcac aatgctggga gttagagaca gattagctgt tttgccaaga 120

cattcccagc ctggaaagac tatatggata gagcataagt tggttaacgt tctggatgct 180

gtggaactgg tcgatgagca aggagttaat ttagagttga ctcttattac tttggacact 240

aacgaaaagt ttagggacat cacaaagttt atcccagaaa acatttcaac tgcatctgat 300

gcaaccttgg tcattaatac cgagcacatg ccttctatgt tcgtccctgt gggtgatgtt 360

gtccagtatg gtttcttgaa tctttccgga aaaccaacac acaggacaat gatgtacaac 420

ttccctacca aagccggtca atgcggagga gttgttacct cagttggtaa agtggtgggt 480

atccacattg gtggtaatgg tcgtcaaggt ttctgtgccg gtcttaaacg ttcctacttt 540

gtttcagaac aataatag 558

<210> 7

<211> 33

<212> DNA

<213> Artificial

<400> 7

ccaagctctt cgaaacgatg ggttctcaag tct 33

<210> 8

<211> 25

<212> DNA

<213> Artificial

<400> 8

agcggtaccc tattataaag tagta 25

<210> 9

<211> 36

<212> DNA

<213> Artificial

<400> 9

tttagttctt cgaagctagc atgggtccat ctctgg 36

<210> 10

<211> 25

<212> DNA

<213> Artificial

<400> 10

ggcggtaccc tattattgtt ctgaa 25

<210> 11

<211> 26

<212> DNA

<213> Artificial

<400> 11

gccgagatct tatatctcta tgtagt 26

<210> 12

<211> 26

<212> DNA

<213> Artificial

<400> 12

ccatgctagc taacaggcac ctgaag 26

<210> 13

<211> 855

<212> DNA

<213> Artificial

<400> 13

tatatctcta tgtagtagta ttccaatcaa ataccctgta gcacagggaa taatgttgaa 60

tattgccaat tgtaggatga gaaccttgat gaagaactgg tctgttagga cgatcttcga 120

attaggccta gattcgttaa ctttcagatt aagctggaat ttgtatgccg agggtgtaga 180

ttgaaaataa aaataaatca acgatgtgat gattccaaat ggaccggcag acacataaat 240

gtccaatccc agcaaatgat aagctacctc catcaatatt gtggtagcaa ccatgttgta 300

gaagtaggat gcaactacaa ccccgagaaa cttattggag ccataaattc tttccagatg 360

cttgatggca aaatgaatca atgcaacacc aatcatgacc tctgattcgt tctgaaagct 420

caattggtag atcaatatcc tccagtattg tctccactga ctgataaagg ggtcgtagct 480

aaggataaac acatacttga ggtcaaaaag tgatgcaaaa attgggagca atatcagcaa 540

cactgtgaac gccttacatc gtggaacctg gtggaatcct ttgggtatca gggaagacat 600

taaccagtgt tttcttatct atttgtcttt ttacactaaa gtgaagtacg aatccatgcg 660

attgattcct cctcagatat cagctgaatt cttgcttatg taatacttgc gcgaactaca 720

tgtgaactta ggattcgata aggctggggg gtcaaccaac cccacttcaa agagccgacc 780

cgtataaata gcctctgcgt cctcagatca acaagacgaa gcaatttttt tttacctatc 840

ttcaggtgcc tgtta 855

Claims (12)

1. a kind of method for preparing EV71 recombinant virus sample particle, this method includes by EV71 virus P1 precursor protein encoding gene It is cloned into yeast expression vector, form stable homogeneous is obtained after double expression and has immune with HRV 3CP encoding gene The virus-like particle of originality, wherein the sequence of the P1 precursor protein encoding gene is SEQ ID NO:5, HRV 3CP encodes base The sequence of cause is SEQ ID NO:6.

2. the method for claim 1 wherein the P1 precursor protein encoding genes and HRV 3CP encoding gene to pass through same table Up to carrier cloning into yeast expression vector.

3. method for claim 2, wherein the same expression vector includes the promoter of varying strength.

4. method for claim 3, wherein the expression vector of the P1 precursor protein encoding gene is in pPICZ α B carrier The recombinant vector that the site BstBI/KpnI insertion SEQ ID NO:5 is constituted, the expression vector of the HRV 3CP encoding gene To be inserted into SEQ ID NO:6 in the site BstBI/KpnI of pPICZ α B carrier and pAOX1 promoter being replaced with pPEX8 starting The recombinant vector that son is constituted.

5. the EV71 recombinant virus sample particle of the method preparation by any one of preceding claims.

6. a kind of vaccine, it includes the EV71 recombinant virus sample particles of claim 5.

7. the vaccine of claim 6 also includes aluminum hydroxide adjuvant.

8. purposes of the EV71 recombinant virus sample particle of claim 5 as vaccine.

9. a kind of DNA molecular, nucleotides sequence is classified as SEQ ID NO:5 or SEQ ID NO:6.

10. a kind of recombinant vector, for the pPICZ α B carrier of the nucleotide sequence comprising claim 9.

11. the recombinant vector of claim 10, wherein pAOX1 promoter is replaced by pPEX8 promoter.

12. the Pichia pastoris of the recombinant vector comprising claim 10 or 11.