CN104513826B

CN104513826B - Human papilloma virus gene, vector, strain and expression method

Info

Publication number: CN104513826B
Application number: CN201310454513.5A
Authority: CN
Inventors: 丛薇; 刘瑞峰; 许丹
Original assignee: Shanghai Zerun Biotech Co Ltd
Current assignee: Shanghai Zerun Biotech Co Ltd
Priority date: 2013-09-29
Filing date: 2013-09-29
Publication date: 2020-10-20
Anticipated expiration: 2033-09-29
Also published as: CN112280793A; CN104513826A; CN112280792A; CN112280792B; CN112280793B

Abstract

The invention relates to genes of Pichia pastoris expression codon optimized 52, 31 and 45 human papilloma virus major capsid protein L1, vectors and strains containing the genes, a preparation method thereof and an expression method.

Description

Human papilloma virus gene, vector, strain and expression method

Technical Field

The invention relates to the field of molecular biology, in particular to genes of HPV52, HPV31 and HPV45 type human papilloma virus major capsid protein L1 which are optimized by codons and are suitable for being expressed in pichia pastoris, and a vector, a strain and a method for expressing the genes.

Background

Cervical cancer is the second major gynecological malignancy to breast cancer, and more than 50 million women are diagnosed with cervical cancer worldwide each year, and 27 million women die of the disease, with an age-normalized infection rate of 10.5%. As early as the 80 s, Haraldzur Hausen found that Human Papilloma Virus (HPV) infection was associated with cervical cancer onset, and a large number of subsequent studies have also demonstrated that HPV is closely related to cervical cancer and its precancerous lesions. To date, hundreds of HPV genotypes have been found, of which about 40 can infect the genital tract mucosa. The high-risk HPV types are HPV16, 18, 31, 33, 45, 52 and 58, and more than 90 percent of cervical cancers are related to the high-risk HPV types.

According to the report of the WHO in 2010, HPV52 is a high-risk type with detection rate accounting for 7 th position of cervical cancer worldwide, is mainly related to cervical cancer in asian areas, and has a detection rate in high-grade lesions of cervix to be excluded at 3 rd position. Unlike HPV16 and HPV18, there is a geographic bias in the distribution of HPV 52. Among Asian HPV infection types, the detection rate of HPV52 type is high, and multiple studies conducted in China show that HPV52 type also belongs to a relatively common type.

According to the report of the WHO in 2010, HPV31 is a high-risk type with detection rate accounting for 6 th in cervical cancer worldwide, and the detection rate is ranked 2 nd in high-grade cervical lesion. HPV31 is considered one of the most prevalent 4 high-risk types of cervical squamous cell carcinoma, and is widely present in asymptomatic patients. Particularly, the HPV31 type is mainly related to cervical intraepithelial dysplasia and cervical cancer formation.

The incidence of HPV45 subtype of HPV infection in chinese women was 2.3%, belonging to HPV subtypes with higher incidence in China (China Human papillomavir and Related Cancers, Fact Sheet2010, WHO/icoformation Centre HPV on and central Cancer, Sep15, 2010).

HPV is a non-enveloped icosahedral symmetric virus, the virus genome DNA of which is in a closed loop shape and has the length of about 7200-8000bp and consists of an early coding region (early region), a late coding region (late region) and a long regulatory region (long control region) positioned between the early coding region and the late coding region. The late coding region contains two Open Reading Frames (ORFs) encoding viral capsid proteins L1 and L2. The L1 protein has a molecular weight of about 55kDa, is a main capsid protein, supports the whole virus capsid structure in the form of 72 pentamers, has highly conserved amino acid sequences in different types, and can stimulate the organism to produce protective antibodies. The L2 protein has smaller molecular weight and is positioned in the L1 protein.

Various expression systems such as insect expression systems, yeast expression systems, prokaryotic expression systems, and mammalian cells can obtain virus-like particles (VLPs) by expressing the major capsid protein L1 alone or by expressing L1+ L2 in combination. VLPs expressed alone in L1 are structurally similar to the natural viral capsid and can be used to induce high titer virus neutralizing antibody responses associated with protection from viral challenge.

Therefore, the L1 protein has high feasibility as a target protein for HPV vaccine development, because the L1 protein is highly conserved in different genotypes and can be expressed to form VLPs independently. However, the commercial development and production of VLPs obtained by expressing recombinant viral proteins as HPV vaccines requires solving a number of technical problems, among which the first to be solved is how to increase the expression level of recombinant viral proteins. In expression systems such as escherichia coli, pichia pastoris and baculovirus, the L1 protein is limited by the codon usage frequency of amino acids in organisms, so that the expression level is low or even no expression is caused. As described in Merck, U.S. Pat. No.7,498,036, wild-type VLP protein was expressed in Saccharomyces cerevisiae at about 35. mu.g/mg (VLP in disrupted supernatant/total protein in disrupted supernatant).

Therefore, there is a need in the art for a method for expressing HPV52L1, HPV31L1, and HPV45L1 genes at high levels, which should enable high-level, easy-to-handle, and low-cost expression of HPV52L1, HPV31L1, and HPV45L1 genes.

Disclosure of Invention

In order to solve the above technical problems, according to a first aspect of the present invention, there is provided an HPV52, HPV31, HPV45 gene capable of being expressed in pichia pastoris, the gene having an amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, and SEQ ID NO: 6.

The pichia pastoris is used as an expression system for expressing recombinant protein, has the characteristics of high expression quantity, simple and convenient operation, low cost and the like, and is more beneficial to large-scale industrial production compared with higher insect cells and mammalian cells. Because the codon usage frequency of amino acid is different among different species, when pichia pastoris is used for expressing recombinant protein, a DNA sequence which is more beneficial to translation is obtained after codon optimization and adjustment according to the amino acid sequence of target protein. Therefore, the HPV52, HPV31 and HPV45 genes subjected to codon optimization can obtain higher expression level in pichia pastoris, and are more favorable for research, development and production of preventive vaccines aiming at HPV52, HPV31 and HPV 45. As shown in the examples of the application, the expression amounts of the codon-optimized HPV52, HPV31 and HPV45 genes in the pichia pastoris can reach up to about 140 mu g/mg, 110 mu g/mg and 150 mu g/mg (VLP in the bacteria breaking supernatant/total protein in the bacteria breaking supernatant) respectively.

According to a second aspect of the present invention, there is provided a method for expressing HPV L1 gene in pichia pastoris, comprising the following steps:

(1) respectively cloning the HPV52, HPV31 and HPV45L1 genes into expression vectors;

(2) transforming the expression vector obtained in the step (1) into a pichia pastoris strain;

(3) screening the transformed strains obtained in the step (2) by using antibiotics to obtain one or more strains with the best growth condition;

(4) further screening the strains obtained in the step (3) by testing the expression levels of HPV52, HPV31 and HPV45L1 genes to obtain one or more strains with the highest expression level;

(5) performing expression by using the strain obtained in the step (4) to obtain HPV52, HPV31 and HPV45L1 proteins.

According to a specific embodiment of the present invention, the expression vector in step (1) is a pPICZ α B vector, and the antibiotic used in step (3) is Zeocin. .

According to a specific embodiment of the present invention, the pichia pastoris strain used in the step (2) is a pichia pastoris X-33 strain.

According to a specific embodiment of the present invention, the operation of testing the expression level of HPV52, HPV31, and HPV45L1 genes in the step (4) is performed by a Western blot method.

According to a particular embodiment of the invention, the expression step in step (5) is a fermentation step carried out in a fermenter.

According to a third aspect of the present invention there is provided an expression vector comprising the HPV52, HPV31, HPV45L1 genes of the invention.

According to a specific embodiment of the invention, the expression vector containing the genes HPV52, HPV31 and HPV45L1 of the invention is derived from pPICZ α B vector.

According to the fourth aspect of the invention, pichia pastoris strains containing the HPV52, HPV31 and HPV45L1 genes or expression vectors can express and produce HPV52, HPV31 and HPV45L1 proteins at high levels, and are more beneficial to the development and production of preventive vaccines aiming at HPV52, HPV31 and HPV 45.

Drawings

FIG. 1 shows agarose electrophoresis of HPV52L1 gene after double digestion. HPV 520.7% agarose gel electrophoresis identification of double digestion results 1: expression plasmid (HindIII + KpnI); 2: and (5) DNA Marker.

FIG. 2 shows Western-blot identification of HPV52L1 supernatant after disruption. Western-blot identification of 52L 1' induced expression conditions, 1-8: recombinant expression strains; 9: PageRuler Prestated Protein Ladder; 10: an empty host bacterium.

FIG. 3 shows SDS-PAGE of HPV52L1 protein samples. Carrying out SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) electrophoresis detection on the purified HPV52L1 virus-like particles, and marking 1; 2HPV52L1 final purified virus-like particles.

FIG. 4 shows an electron micrograph showing virus-like particles in HPV52L1 protein sample. An electron micrograph of the virus-like particles after HPV52L1 purification.

FIG. 5 shows the result of double-restriction enzyme identification of HPV31L1-pPIC Z α B. 1: DNA Marker; 2,3,6,8: 31L1-pPIC Z α B monoclonal plasmid; 4,5,7,9: 31L1-pPIC Z.alpha.B monoclonal plasmid double digestion (KpnI/BstBI).

FIG. 6 shows Western-blot identification of HPV31L1 induced expression. 1-8: recombinant expression strains; 9: a positive protein stock solution; 10: PageRuler Prestained Protein Ladder.

FIG. 7 shows SDS-PAGE electrophoretic assay of virus-like particles after HPV31L1 purification. 1 Marker; 2HPV 3IL1 after purification

FIG. 8 shows an electron micrograph of virus-like particles after HPV31L1 purification

FIG. 9 shows the results of identifying double cleavage by HPV45L10.8% agarose gel electrophoresis. 1: expression plasmid (HindIII + KpnI double digestion); 2: DNA Marker

FIG. 10 shows HPV45L1Western-blot identifying 45L 1' induced expression. 1: an empty host bacterium; 2-8, 10: recombinant expression strains; 9: PageRuler Prestated Protein Ladder

FIG. 11 shows SDS-PAGE electrophoretic assay of HPV45L1 after purification. 1HPV45L1 protein; 2Marker

FIG. 12 shows an electron micrograph of virus-like particles after HPV45L1 purification

DESCRIPTION OF THE SEQUENCES

SEQ ID NO: 1 is wild type HPV52L1 amino acid sequence.

SEQ ID NO: 2 is the nucleotide sequence of HPV52L1 gene.

SEQ ID NO: 3 is wild type HPV31L1 amino acid sequence.

SEQ ID NO: 4 is the nucleotide sequence of HPV31L1 gene.

SEQ ID NO: 5 is wild type HPV45L1 amino acid sequence.

SEQ ID NO: 6 is the nucleotide sequence of HPV45L1 gene of the invention.

SEQ ID NO: 7HPV52L1 gene nucleotide sequence forward primer.

SEQ ID NO: nucleotide sequence reverse primer of 8HPV52L1 gene.

SEQ ID NO: 9HPV45L1 gene nucleotide sequence forward primer.

SEQ ID NO: 10HPV45L1 gene.

Detailed Description

The present invention is described in detail by the following examples so that those skilled in the art can better understand the present invention. The following examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperature, etc.) but some errors and deviations should be accounted for. Unless otherwise indicated, temperature is in degrees Celsius or is ambient and pressure is near or equal to atmospheric. Restriction enzymes used in the examples described below were purchased from New England Biolab, Inc., unless otherwise indicated. It is to be understood that the instrumentation used in the examples described below is conventional in the art, unless otherwise indicated. The medium used is, unless otherwise stated, a commercially available conventional medium, the constituents and amounts of which are well known to those skilled in the art. For the sake of brevity, various common abbreviations may be used herein, the meaning of which is fully understood by those skilled in the art.

Examples

Example 1: HPV52L1 codon optimization design

The 52L1 sequence was synthesized based on the wild-type HPV52L1 amino acid sequence (GenBank: CAA52590.1, SEQ ID NO: 1) and Pichia preferred codons. The wild HPV52L1DNA sequence is modified, all codons adopt codons with higher or highest use frequency in pichia pastoris, and the formation of a secondary structure and the selection of enzyme cutting sites are considered, so that the nucleotide sequence SEQ ID NO of the HPV52L1 gene is finally obtained: 2.

example 2: construction of HPV52L1 recombinant expression vector

The resulting 52L1 sequence was synthesized and cloned into pPICZalphaB vector (Invitrogen) by the following method. Amplifying by a PCR mode to obtain a 52L1DNA fragment with BstBI and KpnI at two ends respectively, wherein a PCR primer: a forward primer: 5 'CAGGTGATCTTCGAAACGATGAGTGTTTGGAGAC 3' (BstBI) (SEQ ID NO: 7); reverse primer: 5 'ATTGGTACCCTATTATCTTTTAACT 3' (KpnI) (SEQ ID NO: 8). PCR procedure: the operation was completed by cycling 30 times at 94 ℃ for 5 minutes, at 94 ℃ for 30 seconds, at 55 ℃ for 30 seconds, at 72 ℃ for 1 minute and 50 seconds, at 72 ℃ for 10 minutes, and at 10 ℃ for 10 minutes. The PCR product was identified by agarose gel electrophoresis and the band at 1500bp was recovered (Qiagen gel extraction kit). The recovered fragment was digested with BstBI and KpnI (New England Biolab) in combination with pPICZalphaB, identified by agarose gel electrophoresis and fragments of about 1500bp and 3600bp were recovered, respectively. The recovered 52L1 was ligated to pPICZalphaB in a 5: 1 molar ratio with T4 ligase (Takara) overnight at 16 ℃ and the ligation products were transformed the next day into E.coli DH 5. alpha. and plated on low-salt LB plates (containing 25ug/mL Zeocin) and cultured overnight at 37 ℃. After partial transformation, the plasmid was cloned and extracted, identified by double digestion (HindIII + KpnI), and detected by agarose electrophoresis (FIG. 1). The positive recombinant clone obtained by identification is stored after being verified to be correct by DNA sequencing, and the recombinant vector is named as pPICZ52L 1.

Example 3: construction and expression of HPV52L1 recombinant expression strain

Linearization of pPICZ52L1 with SacI, phenol: removing protein with chloroform, adding 2.5 times volume of anhydrous ethanol, 1/10 volume of 3M NaAc (pH5.2) to precipitate DNA, washing the obtained precipitate with 75% ethanol, oven drying, and adding small amount of sterile ddH₂The precipitate was dissolved in O, transferred to a Pichia host strain (Invitrogen), spread on YPDS plates (containing 180. mu.g/mLzeocin), and cultured at 30 ℃ for 3 days to obtain hundreds of clones. Several tens of clones were selected and inoculated on YPD plates (containing 1500. mu.g/mLzeocin), and high-copy plasmid strains were selected and cultured at 30 ℃ for 2 days. Partial clones grow faster, several clones with the best growth condition are selected and inoculated in 5mL YPD liquid culture medium, BMMY culture medium is replaced after 24 hours, and thalli are collected after 0.5% methanol induction for 48 hours. After the thalli are crushed by glass beads, supernatant obtained by centrifugation is identified by Western-blot (figure 2), and the primary antibody is the home-made rabbit polyclonal antibody. The strain with the highest expression level is frozen and stored at-80 ℃ to be used as a fermentation tank culture working seed.

Example 4: fermenter culture of HPV52L1 recombinant protein

1 strain of glycerol is taken from a working seed bank and frozen in a tube, namely the genetic engineering bacteria expressing HPV52L1 obtained in example 3, after being melted, 100 mu L of the genetic engineering bacteria are absorbed and inoculated into 5mL of YPD medium, and the YPD medium is cultured at 280 revolutions per minute (rpm) for 20 hours at 30 ℃. The density of the thallus reaches OD₆₀₀About 1 to about 2. The microscopic examination is free from the contamination of foreign bacteria. 1mL of the activation solution which was passed through the examination was inoculated into 500mL of YPD medium and cultured at 280rpm at 30 ℃ for 20 hours. The density of the thallus reaches OD₆₀₀About 2 to about 6. The microscopic examination is free from the contamination of foreign bacteria. Basic salt culture medium BSM1 (K) for fermentation₂SO₄273g，MgSO₄109g，CaSO₄·2H₂O17.6g，H₃PO₄400.5mL, KOH62g, Glycerol 600g, PTM160mL, 1mL of natural killer, deionized water added to 15L), no antibioticAfter preparation, the extract was sterilized in a 30L fermenter (Bioengineering Co.). Sterilizing at 121 deg.C for 30min, and cooling to 30 deg.C. Inoculating the activated seed liquid into a tank at a ratio of 1: 15. Fermenting at 30.0 + -0.5 deg.C, initial pH of 5.00 + -0.05, culturing at initial rotation speed of 300rpm, ventilating amount of 0.5vvm, D0 (dissolved oxygen value) of 100%, and adding PTM1(CuSO 1)₄·5H₂O6.0g，NaI0.008g，MnSO₄3.0g，NaMoO₄0.2g，H₃BO₃0.02g，ZnSO₄20.0g，CoCl₂0.5g，FeSO₄·7H₂O65.0g，biotin0.2g，H₂SO₄5.0mL, deionized water to 1L) of trace salts. The initial proliferation stage is about 24 hours, the dissolved oxygen value is maintained to be not less than 20%, when the carbon source is completely consumed, the dissolved oxygen value rapidly rises, and the wet weight of the thalli reaches about 100 g/L. The initial two hours were supplemented with 50% volume glycerol solution at a rate of 200mL/h per hour (12 mL PTM1 added per liter). After two hours of feeding, 300mL/h was used instead. By adjusting the stirring speed, the air flow rate and the tank pressure (b)<0.8bar) to maintain the dissolved oxygen level above 30%. After the addition of the enzyme for about 4 hours and the wet weight of the cells of about 200g/L, the feeding of the enzyme is stopped and the dissolved oxygen value is increased. While controlling the pH to 6.00. + -. 0.05, the induction was started by adding methanol (12 mL of PTM1 per liter). The initial methanol addition was controlled at 30 mL/h. The amount of methanol added was slowly increased and the feed rate was set to 90mL/h after 4 hours of methanol induction. The dissolved oxygen value is maintained to be higher than 20 percent by volume, the temperature is maintained at 30 ℃, and the pH value is controlled to be 6.00 +/-0.05. And discharging fermentation liquor after the fermentation is finished after 40 hours of induction. The thalli is collected by centrifugation at 4 ℃, and the wet weight of the thalli reaches 390 g/L.

Example 5: HPV52L1 protein purification

After the collected thalli are broken (broken bacterium buffer solution: 200mM MOPS, pH7.0, 0.7NaCl, 0.05% Tween-80) and centrifuged, the supernatant after breaking the thalli is purified by a chromatography method to obtain the L1 protein which is self-assembled into virus-like particles, and the specific steps are as follows: adding a bacterium breaking buffer solution into the pichia pastoris cells expressing the HPV52L1VLP according to the ratio of 1: 5, mixing the mixture fully, breaking the cell suspension at high pressure after mixing the mixture uniformly, and repeating the operation to break 90 percent of the cells. Centrifuging the high-pressure crushed bacteria-breaking solution at 9000rpm for 30min at 10 deg.C, and collecting the supernatant after centrifugation. The supernatant clarified by centrifugation was subjected to preliminary purification by passing through a POROS50HS (applied biosystems column) in a linear gradient of 100% buffer A (0.5M NaCl, 50mM MOPSpH7.0, 0.05% Tween-80) to 100% buffer B (1.5M NaCl, 50mM MOPS pH7.0, 0.05% Tween-80), and the eluted fractions were collected and subjected to SDS-PAGE and Western-blot detection.

The fractions eluted containing HPV52L1 protein were pooled and further purified using a CHT (BIO-RAD type II) column, eluting by: a linear gradient from 100% buffer A (5mM PB, 0.6M NaCl, 50mM MOPSpH6.5, 0.05% Tween-80) to 100% buffer B (200mM PB, 0.6M NaCl, pH6.5, 0.05% Tween-80). And collecting the eluted components, detecting by SDS-PAGE and Western-blot, and combining the components containing the HPV52L1VLP to obtain the final purified sample. The purity of L1 protein was checked by SDS-PAGE electrophoresis, and the purity of the purified virus-like particles was more than 90% as shown by scanning (FIG. 3). The purified sample was observed by electron microscopy (electron microscopy chamber of chemical series, university of Shanghai Compound denier) to show virus-like particles (FIG. 4), which showed particle diameters between 60 and 100 nm.

Example 6: measurement of expression amount of HPV52L1 recombinant protein of the present invention

In this example, the total protein content of the HPV52L1VLP after the disruption of the bacteria is calculated according to the total protein content of the supernatant of the disrupted bacteria after fermentation measured by the Bradford method and the expression level of the HPV52L1VLP measured by the Elisa sandwich method. The method comprises the following specific steps:

1. determination of Total protein content in fermentation broth lysate supernatant Using Bradford method

The measurement was carried out using K4000Bradford protein qualification reagent kit commercially available from Shanghai Bombycis Biotech Ltd.

Mu.l, 10. mu.l, 20. mu.l, 40. mu.l, 80. mu.l, 100. mu.l of BSA standard (0.5mg/ml) and 40. mu.l (100-fold dilution) of the disrupted supernatant of the fermented cells obtained in example 4 were added to 7 tubes of 1.5ml EP in one portion, and the mixture was made up to a total volume of 100. mu.l with water and mixed. 3 replicates were set for each concentration. 900 μ l Bradford solution was added to each tube, mixed immediately and left at room temperatureAfter standing for 10 minutes, OD was measured respectively₅₉₅Light absorption value. And (3) making a protein concentration-to-absorbance value standard curve according to 6 groups of BSA standard substances, calculating to obtain a linear equation, and calculating the total protein content of the fermented thallus broken bacteria supernatant according to the light absorbance value obtained by breaking the bacteria supernatant and the linear equation of the standard curve.

2. Determination of HPV52L1VLP content in fermented thallus strain-breaking supernatant by Elisa sandwich method

Purified HPV52L1VLP was used as a standard protein concentration curve, and the pre-induced bacteria served as negative controls.

Coating solution (1.6g Na)₂CO₃，2.95g NaHCO₃) The rabbit anti-HPV 52L1VLP polyclonal antibody is diluted 2000 times, and then 0.1ml of the diluted rabbit polyclonal antibody is added into each concave hole of the enzyme label plate respectively, and the mixture is over night at 4 ℃. The coating solution was removed, the wells were washed with 0.3ml of PBST (PBS, pH7.0, 0.05% Tween-20), and incubated with 0.3ml of blocking solution (5% nonfat dry milk + PBST) at 37 ℃ for 2 hours.

The purified HPV52L1VLP obtained in example 5 was serially diluted from a gradient of concentration 2. mu.g/ml to 0.0625. mu.g/ml with a dilution (PBS, pH7.0) in two-fold dilutions, as a standard sample. Meanwhile, the supernatant of the broken bacteria of the fermentation thallus obtained in the example 4 is diluted by 200 times, then 0.1ml of HPV52L1VLP solution with different concentrations after gradient dilution or the supernatant of the broken bacteria after dilution is respectively added into the concave hole, the temperature is preserved for 1 hour at 37 ℃, the antigen solution is removed, and the concave hole is washed by 0.3ml of PBST. MAB885 murine anti-HPV 52L1VLP monoclonal antibody (purchased from CHEMICON) was diluted 1000-fold with antibody dilution buffer (PBS, pH7.0, 2% skim milk powder) and added to wells at 0.1ml per well and incubated at 37 ℃ for 1 hour. The mab solution was removed and the wells were washed with 0.3ml PBST. Then, 0.1ml of HRP-labeled goat anti-mouse IgG0 diluted 5000 times with an antibody dilution buffer was added to each well, and the mixture was incubated at 37 ℃ for 0.5 hour. The antibody solution was removed, the wells were washed with 0.3ml of PBST, and 0.1ml of DAB developing solution (available from Amresco) was added to each well and allowed to react at room temperature for 20 minutes. To each well was added 0.05ml of 2M H₂SO₄Stopping the reaction with a stop solution, and determining OD with an enzyme-labeled colorimeter₄₅₀And (4) light absorption value.

OD of HPV52L1VLP Using gradient dilution₄₅₀And (4) preparing a standard protein concentration curve, and converting the standard protein concentration curve to obtain the fermentation expression quantity of the HPV52L1 protein.

The results of this example are shown in Table 1. As can be seen from Table 1, the expression level of HPV52L1 gene of the invention can reach up to 140 μ g/mg (HPV 52L1VLP in the supernatant of the broken bacteria/total protein in the supernatant of the broken bacteria).

Table 1: expression level of HPV52L1 Gene of the invention

Example 7: preparation of HPV52L1 vaccine

The L1 protein obtained by purification in example 5 was adsorbed with an aluminum phosphate adjuvant by a method described in pharmacopoeia of the people's republic of China (2005 edition), and an HPV52L1 vaccine having immunogenicity was prepared.

Example 8: determination of immunogenicity of HPV52L1 Gene expression product

SPF-grade BALB/c mice (Shanghai Seipaibikai laboratory animals Co., Ltd.) 6-8 weeks old were selected and divided into 4 groups of 8 mice each. Groups 1-3 were injected with 0.5mL VLP adsorbed with aluminum adjuvant (as test group), and groups 4 mice were immunized (as negative control group) with 0.1mL buffer containing aluminum adjuvant (0.32M NaCl, 0.01% Tween-80, 0.01M histidine, pH6.5) once by abdominal subcutaneous five-point injection for 0 day, and blood was collected 28 days after immunization. Standing the collected blood at 37 deg.C for 2h, centrifuging at 8000rpm for 5min, sucking supernatant to obtain mouse immune serum, storing at-20 deg.C, and detecting the positive conversion rate of mouse serum, the specific method comprises: purified Pichia pastoris-expressed HPV52L1 was diluted to 1. mu.g/mL with coating solution and coated on 96-well microtiter plates at 0.1mL per well overnight at 4 ℃. The coating solution was removed and washed 3 times with 0.3mL of BST, followed by 3 washes with 0.3mL of blocking solution (5% nonfat dry milk + PBST) incubated at 37 ℃ for 2 hours. Diluting the test serum with dilution buffer (2% skimmed milk powder + PBST) at a ratio of 1: 1000, 100. mu.l/well, and repeatingThe wells were loaded with an ELISA plate and incubated at 37 ℃ for 1 hour. Washing 6 times, diluting HRP-labeled goat anti-mouse IgG with diluent 1: 5000, adding 100 μ l/well enzyme label plate, incubating at 37 deg.C for 0.5 hr, washing 6 times, adding 100 μ l/well TMB for color development, developing at 37 deg.C for 10 min, adding 2M H₂SO₄The reaction was stopped with 50. mu.l. OD determination with enzyme-labeled colorimeter₄₅₀Reading, OD₄₅₀The values are shown in Table 2. The results of the positive conversion rate of the three test groups are shown in Table 3.

TABLE 2 detection of the positive conversion rate of serum obtained from HPV52L1 immunized mice (OD)₄₅₀Reading number)

Grouping of different doses	1 μ g group	0.1 μ g group	0.01 μ g group
				Rate of yang transformation	100％	100％	12.5％

TABLE 3HPV52L1 positive conversion rate results

Negative average value: 0.007; cutoff value: 0.014

Note: the Cutoff value is the OD of the detected serum antibody of the adjuvant group₄₅₀Average of the values multiplied by 2.1, OD₄₅₀The mouse serum with the value larger than the Cutoff value is judged to be positive, OD₄₅₀Value less than Cutoff valueThe mouse serum was judged negative.

In summary, the major capsid protein L1 gene of human papillomavirus type 52 provided by the invention is an optimized L1 gene, and has the following advantages: the optimized gene is more suitable for expressing the target protein in a yeast host with high efficiency and can meet the requirement of industrial production; meanwhile, the 52 type human papilloma virus vaccine provided by the invention can be self-assembled to form a VLPs structure, and the vaccine can generate stronger immunogenicity in a mouse body by measuring the positive transfer rate of serum after the purified VLPs adsorb an adjuvant, and the method has the following advantages because a pichia pastoris expression system is adopted: low cost, high yield and more uniform and stable product properties.

Example 9: codon optimization design of 1HPV31L1

The 31L1 sequence was synthesized based on the wild-type HPV31L1 amino acid sequence (GenBank: AEI61021.1, SEQ ID NO: 3) and Pichia preferred codons. The wild HPV31L1DNA sequence is modified, all codons adopt codons with higher or highest use frequency in pichia pastoris, and the formation of a secondary structure and the selection of enzyme cutting sites are considered, so that the nucleotide sequence SEQ ID NO of the HPV31L1 gene is finally obtained: 4.

example 10: construction of HPV31L1 recombinant expression vector

31L1 sequences of Kpn I (GGTACC) and Bst BI (TTCGAA) were respectively introduced into both ends of the vector, and the vector was loaded into pGH.

The plasmid 31L-pGH and the vector pPIC Z alpha B are subjected to double enzyme digestion by endonucleases KpnI and BstBI, and fragments of about 1500bp and 3600bp are respectively recovered after agarose gel electrophoresis identification. After recovery, 31L1 was ligated to pPIC Z α B with T4 ligase (Takara) at a molar ratio of 3: 1 for 2 hours at room temperature, and the ligation products were transformed into E.coli DH5 α competent cells, plated on low-salt LB plates (containing 25ug/ml Zeocin), and cultured overnight at 37 ℃.8 transformed monoclonal colonies are picked to carry out colony PCR, agarose gel electrophoresis is carried out to identify PCR products, clones with correct amplification band size are cloned in LB low-salt liquid culture medium, and overnight culture is carried out at 37 ℃. Overnight culture broth was used to extract plasmid (Axygen), identified by double digestion (BstB I + KpnI), and detected by agarose electrophoresis (FIG. 5). The positive recombinant clone obtained by identification is stored after being verified to be correct by DNA sequencing, and the recombinant vector is named as 31L1-pPIC Z alpha B.

Example 11: construction and expression of HPV31L1 recombinant expression strain

Linearizing 31L1-pPIC Z alpha B by SacI, removing protein by phenol and chloroform after enzyme digestion reaction, adding 2.5 times volume of absolute ethyl alcohol and 1/10 volume of 3M NaAc (pH5.2) to precipitate DNA, washing the obtained precipitate by 75% of ethanol, drying, and adding a small amount of sterile ddH₂The pellet was dissolved in O, transferred to Pichia pastoris (Invitrogen), plated on YPDS plates (containing 100. mu.g/ml Zeocin), and cultured at 30 ℃ for 3 days to obtain hundreds of clones. Several tens of clones were selected and inoculated on YPD plates (containing 1500. mu.g/ml Zeocin), and plasmid-high copy strains were selected and cultured at 30 ℃ for 2 days. Partial clones grow faster, several clones with the best growth condition are selected and inoculated in 5ml YPD liquid culture medium, BMMY culture medium is replaced after 24 hours, and thalli are collected after 1% methanol induction for 72 hours. After the thalli are crushed by glass beads, supernatant obtained by centrifugation is identified by Western-blot (figure 6), and the primary antibody is the home-made rabbit polyclonal antibody. The strain with the highest expression level is frozen and stored at-80 ℃ to be used as a fermentation tank culture working seed.

Example 12: fermenter culture of HPV31L1 recombinant protein

1 strain of glycerol is taken from a working seed bank and frozen in a tube, namely the genetic engineering bacteria expressing HPV31L1 obtained in example 11, 100 mu L of the frozen tube is absorbed and inoculated into 5mL of YPD medium, and the YPD medium is cultured at 280 revolutions per minute (rpm) for 20 hours at 30 ℃. The density of the thallus reaches OD₆₀₀About 1 to about 2. The microscopic examination is free from the contamination of foreign bacteria. 1mL of the activation solution which was passed through the examination was inoculated into 500mL of YPD medium and cultured at 280rpm at 30 ℃ for 20 hours. The density of the thallus reaches OD₆₀₀About 2 to about 6. The microscopic examination is free from the contamination of foreign bacteria. Basic salt culture medium BSM1 (K) for fermentation₂SO₄273g，MgSO₄109g，CaSO₄·2H₂O17.6g，H₃PO₄400.5mL, KOH62g, glycerol 600g, PTM160mL, 1mL of bubbled 1, deionized water to 15L), no antibiotics, were formulated and sterilized in a 30L fermentor (Bioengineering Co.). Sterilizing at 121 deg.C for 30min, and cooling to 30 deg.C. The activated seed solution is treated withInoculating in the tank at a ratio of 1: 15. Fermenting at 30.0 + -0.5 deg.C with initial pH of 5.00 + -0.05, culturing at initial rotation speed of 300rpm, ventilating amount of 0.5vvm, DO (dissolved oxygen value) of 100%, and adding PTM1(CuSO 1)₄·5H₂O6.0g，NaI0.008g， MnSO₄3.0g，NaMoO₄0.2g，H₃BO₃0.02g，ZnSO₄20.0g，CoCl₂0.5g，FeSO₄·7H₂O65.0g，biotin 0.2g，H₂SO₄5, OmL, deionized water to 1L) trace salts. The initial growth stage was about 24 hours, the dissolved oxygen value was maintained at not less than 20%, and when the carbon source was consumed, the dissolved oxygen value rapidly increased and the wet weight of the cells reached about 1 OOg/L. The initial two hours were supplemented with 50% volume glycerol solution at a rate of 200mL/h per hour (12 mL PTM1 added per liter). After two hours of feeding, 300mL/h was used instead. By adjusting the stirring speed, the air flow rate and the tank pressure (b)<0.8bar) to maintain the dissolved oxygen level above 30%. After the addition of the enzyme for about 4 hours and the wet weight of the cells of about 200g/L, the feeding of the enzyme is stopped and the dissolved oxygen value is increased. While controlling the pH to 6.00. + -. 0.05, the induction was started by adding methanol (12 mL of PTM1 per liter). The initial methanol addition was controlled at 30 mL/h. The amount of methanol added was slowly increased and the feed rate was set to 90mL/h after 4 hours of methanol induction. The dissolved oxygen value is maintained to be higher than 20 percent of volume percent, the temperature is maintained at 30 ℃, and the pH value is controlled to be 6.00 +/-O.05. And discharging fermentation liquor after the fermentation is finished after 40 hours of induction. The thalli are collected by centrifugation at 4 ℃, and the wet weight of the thalli reaches 420 g/L.

Example 13: HPV31L1 protein purification

After the collected thalli are broken (broken bacterium buffer solution: 200mM MOPS, pH7.0, 0.7NaCl, 0.05% Tween-80) and centrifuged, the supernatant after breaking the thalli is purified by a chromatography method to obtain the L1 protein which is self-assembled into virus-like particles, and the specific steps are as follows:

adding a bacterium breaking buffer solution into the pichia pastoris cells expressing the HPV31L1VLP according to the ratio of 1: 5, mixing the mixture fully, breaking the cell suspension at high pressure after mixing the mixture uniformly, and repeating the operation to break 90 percent of the cells. Centrifuging the high-pressure crushed bacteria breaking solution at 9000rpm for 30min at 1O ℃, and collecting the centrifuged supernatant.

The supernatant of the disrupted bacteria after centrifugation was subjected to primary purification by passing through a POROS50HS (Applied Biosystems) column, in the following manner: elution was performed with a linear gradient of 100% buffer A (0.5M NaCl, 50mM MOPS pH7.0, 0.05% Tween-80) to 100% buffer B (1.5M NaCl, 50mM MOPS pH7.0, 0.05% Tween-80), and the fractions eluted were collected and detected by SDS-PAGE, Western-blot.

The eluted fractions containing HPV31L1 protein were pooled and further purified using a CHT (BIO-RAD type II) column, eluting in the following manner: a linear gradient from 100% buffer A (5mM PB, 0.6M NaCl, 50mM MOPS pH6.5, 0.05% Tween-80) to 100% buffer B (200mM PB, 0.6M NaCl, pH6.5, 0.05% Tween-80). And collecting the eluted components, detecting by SDS-PAGE and Western-blot, and combining the components containing the HPV31L1VLP to obtain the final purified sample. The purity of L1 protein was determined by SDS-PAGE electrophoresis, and the scanning showed that the purity of the purified virus-like particles was more than 90% (FIG. 7. the virus-like particles were present in the purified sample by electron microscopy (electron microscopy chamber of chemical series at the university of Shanghai Compound denier) (FIG. 8), and the particle diameter was between 30-60 nm.

Example 14: measurement of expression amount of HPV31L1 recombinant protein of the present invention

In this example, the total protein content of the HPV31L1VLP after the disruption of the bacteria is calculated according to the total protein content of the supernatant of the disrupted bacteria of the fermented bacteria measured by the Bradford method and the expression level of the HPV31L1VLP measured by the Elisa sandwich method. The method comprises the following specific steps:

Mu.l, 10. mu.l, 20. mu.l, 40. mu.l, 80. mu.l, 100. mu.l of BSA standard (0.5mg/ml) and 40. mu.l (100-fold dilution) of the disrupted supernatant of the fermented cells obtained in example 12 were added to 7 tubes of 1.5ml EP in one portion, and the mixture was made up to a total volume of 100. mu.l with water and mixed. 3 replicates were set for each concentration. 900 μ l Bradford solution was added to each tube, mixed immediately, left at room temperature for 10 minutes, and then OD was measured separately₅₉₅Light absorption value. According to 6 groups of BSA standardsAnd (3) making a standard curve of protein concentration to the absorbance value, calculating to obtain a linear equation, and calculating the total protein content of the fermented thallus broken bacterium supernatant according to the absorbance value obtained by breaking the bacterium supernatant and the linear equation of the standard curve.

2. Determination of HPV31L1VLP content in fermented thallus strain-breaking supernatant by Elisa sandwich method

Purified HPV31L1VLP was used as a standard protein concentration curve, and the pre-induced bacteria served as negative controls.

Coating solution (1.6g Na)₂CO₃，2.95g NaHCO₃) The rabbit anti-HPV 31L1VLP polyclonal antibody is diluted 2000 times, and then 0.1ml of the diluted rabbit polyclonal antibody is added into each concave hole of the enzyme label plate respectively, and the mixture is over night at 4 ℃. The coating solution was removed, the wells were washed with 0.3ml of PBST (PBS, pH7.0, 0.05% Tween-20), and incubated with 0.3ml of blocking solution (5% nonfat dry milk + PBST) at 37 ℃ for 2 hours.

The purified HPV31L1 VLPs obtained in example 13 were serially diluted from a gradient of concentration 2. mu.g/ml to 0.0625. mu.g/ml using a diluent (PBS, pH7.0) as a standard sample in two-fold dilutions. Meanwhile, the bacterial-breaking supernatant of the fermentation thallus obtained in example 12 was diluted 200 times, then 0.1ml of HPV31L1VLP solutions of different concentrations after gradient dilution or diluted bacterial-breaking supernatants were added to the wells, respectively, and after 1 hour of incubation at 37 ℃, the antigen solution was removed and the wells were washed with 0.3ml of PBST. MAB885 murine anti-HPV 52L1VLP monoclonal antibody (purchased from CHEMICON) was diluted 1000-fold with antibody dilution buffer (PBS, pH7.0, 2% skim milk powder) and added to wells at 0.1ml per well and incubated at 37 ℃ for 1 hour. The mab solution was removed and the wells were washed with 0.3ml PBST. Then, 0.1ml of HRP-labeled goat anti-mouse IgG0 diluted 5000 times with an antibody dilution buffer was added to each well, and the mixture was incubated at 37 ℃ for 0.5 hour. The antibody solution was removed, the wells were washed with 0.3ml of PBST, and 0.1ml of DAB developing solution (available from Amresco) was added to each well and allowed to react at room temperature for 20 minutes. To each well was added 0.05ml of 2M H₂SO₄Stopping the reaction with a stop solution, and determining OD with an enzyme-labeled colorimeter₄₅₀And (4) light absorption value.

OD of HPV31L1VLP Using gradient dilution₄₅₀Is detected to be connected withAnd (4) preparing a standard protein concentration curve, and converting the standard protein concentration curve to obtain the fermentation expression quantity of the HPV31L1 protein.

The results of this example are shown in Table 4. As can be seen from Table 4, the expression level of HPV31L1 gene of the invention can reach up to 110 μ g/mg (HPV 31L1VLP in the supernatant of the broken bacteria/total protein in the supernatant of the broken bacteria).

Table 4: expression level of HPV31L1 Gene of the invention

Example 15: preparation of HPV31L1 vaccine

The L1 protein obtained by purification in example 13 was adsorbed with an aluminum phosphate adjuvant by a method described in pharmacopoeia of the people's republic of china (2005 edition), to prepare an HPV31L1 vaccine having immunogenicity.

Example 16: determination of immunogenicity of HPV31L1 Gene expression product

SPF-grade BALB/c mice (Shanghai Seipaibikai laboratory animals Co., Ltd.) 6-8 weeks old were selected and divided into 4 groups of 8 mice each. Groups 1-3 were injected with 0.5mL VLP adsorbed with aluminum adjuvant (as test group), and groups 4 mice were immunized (as negative control group) with 0.1mL buffer containing aluminum adjuvant (0.32M NaCl, 0.01% Tween-80, 0.01M histidine, pH6.5) once by abdominal subcutaneous five-point injection for 0 day, and blood was collected 28 days after immunization. Standing the collected blood at 37 deg.C for 2h, centrifuging at 8000rpm for 5min, sucking supernatant to obtain mouse immune serum, storing at-20 deg.C, and detecting the positive conversion rate of mouse serum, the specific method comprises: purified Pichia pastoris-expressed HPV31L1 was diluted to 1. mu.g/mL with coating solution and coated on 96-well microtiter plates at 0.1mL per well overnight at 4 ℃. The coating solution was removed and washed 3 times with 0.3mL of BST, followed by 3 washes with 0.3mL of blocking solution (5% nonfat dry milk + PBST) incubated at 37 ℃ for 2 hours. Each well was diluted with a dilution buffer (2% nonfat dry milk + PBST) at 1: 1000 (100. mu.l/well), and the wells were plated with an ELISA plate and incubated at 37 ℃ for 1 hour. Washing for 6 times with diluent at ratio of 1: 5000Diluting HRP-labeled goat anti-mouse IgG, adding 100. mu.l/well of ELISA plate, incubating at 37 deg.C for 0.5 hr, washing for 6 times, adding 100. mu.l/well of TMB, developing at 37 deg.C for 10 min, adding 2M H₂SO₄The reaction was stopped with 50. mu.l. OD determination with enzyme-labeled colorimeter₄₅₀Reading, OD₄₅₀The values are shown in Table 5. The results of the positive conversion rate of the three test groups are shown in Table 6.

TABLE 5 measurement of the Positive conversion rate of serum obtained from HPV31L1 immunized mice (OD)₄₅₀Reading number)

Grouping of different doses	1 μ g group	0.1 μ g group	0.01 μ g group
				Rate of yang transformation	100％	100％	100％

TABLE 6HPV31L1 positive conversion rate results

Negative average value: 0.005; cutoff value: 0.01

Note: the Cutoff value is the OD of the detected serum antibody of the adjuvant group₄₅₀Average of the values multiplied by 2.1, OD₄₅₀The mouse serum with the value larger than the Cutoff value is judged to be positive, OD₄₅₀Mouse sera with values less than the Cutoff value were judged negative.

In conclusion, the major capsid protein L1 gene of HPV31 human papilloma virus provided by the invention is an optimized L1 gene, and has the following advantages: the optimized gene is more suitable for expressing the target protein in a yeast host with high efficiency and can meet the requirement of industrial production; meanwhile, the HPV31 type human papilloma virus vaccine provided by the invention can be self-assembled to form a VLPs structure, and the determination of the positive transfer rate of serum after purified VLPs adsorb an adjuvant shows that the vaccine can generate stronger immunogenicity in a mouse body, and the method has the following advantages because a pichia pastoris expression system is adopted: low cost, high yield and more uniform and stable product properties.

Example 17: HPV45L1 codon optimization design

The 45L1 sequence was synthesized based on the wild-type HPV45L1 amino acid sequence (GenBank: ABP99831.1, SEQ ID NO: 5) and Pichia preferred codons. The wild HPV45L1DNA sequence is modified, all codons adopt codons with higher or highest use frequency in pichia pastoris, and the formation of a secondary structure and the selection of enzyme cutting sites are considered, so that the nucleotide sequence SEQ ID NO of the HPV45L1 gene is finally obtained: 6.

example 18: construction of HPV45L1 recombinant expression vector

The resulting 45L1 sequence was synthesized and cloned into the pPICZalphaB vector (Invitrogen) by the following method.

Amplifying by a PCR mode to obtain a 45L1DNA fragment with BstBI and KpnI at two ends respectively, wherein a PCR primer: a forward primer: 5 'CAGGTGATCTTCGAAACGATGGCTTTGTGG 3' (BstBI) (SEQ ID NO: 9); reverse primer: 5 'CGGGGTACCCTATTACTTTTTGG 3' (KpnI) (SEQ ID NO: 10). PCR procedure: the operation was completed by cycling 30 times at 94 ℃ for 5 minutes, at 94 ℃ for 30 seconds, at 55 ℃ for 30 seconds, at 72 ℃ for 1 minute and 50 seconds, at 72 ℃ for 10 minutes, and at 10 ℃ for 10 minutes. The PCR product was identified by agarose gel electrophoresis and the band at 1500bp was recovered (Qiagen gel extraction kit). The recovered fragment was digested with BstBI and KpnI (New England Biolab) in combination with pPICZalphaB, identified by agarose gel electrophoresis and fragments of about 1500bp and 3600bp were recovered, respectively. After recovery 45L1 was ligated to pPICZalphaB in a molar ratio of 5: 1 with T4 ligase (Takara) overnight at 16 ℃ and the ligation products were transformed the next day into E.coli DH 5. alpha. and plated on low salt LB plates (containing 25ug/mL Zeocin) and incubated overnight at 37 ℃. After partial transformation, the plasmid was cloned and extracted, identified by double digestion (HindIII + KpnI), and checked by agarose electrophoresis (FIG. 9). The positive recombinant clone obtained by identification is stored after being verified to be correct by DNA sequencing, and the recombinant vector is named as pPICZ45L 1.

Example 19: construction and expression of HPV45L1 recombinant expression strain

Linearization of pPICZ45L1 with SacI, phenol: removing protein with chloroform, adding 2.5 times volume of anhydrous ethanol, 1/10 volume of 3M NaAc (pH5.2) to precipitate DNA, washing the obtained precipitate with 75% ethanol, oven drying, and adding small amount of sterile ddH₂The precipitate was dissolved in O, transferred to a Pichia host strain (Invitrogen), spread on YPDS plates (containing 180. mu.g/mLzeocin), and cultured at 30 ℃ for 3 days to obtain hundreds of clones. Several tens of clones were selected and inoculated on YPD plates (containing 1500. mu.g/mLzeocin), and high-copy plasmid strains were selected and cultured at 30 ℃ for 2 days. Partial clones grow faster, several clones with the best growth condition are selected and inoculated in 5mL YPD liquid culture medium, BMMY culture medium is replaced after 24 hours, and thalli are collected after 0.5% methanol induction for 48 hours. After the thalli are crushed by glass beads, supernatant obtained by centrifugation is identified by Western-blot (figure 10), and the primary antibody is the home-made rabbit polyclonal antibody. The strain with the highest expression level is frozen and stored at-80 ℃ to be used as a fermentation tank culture working seed.

Example 20: fermenter culture of HPV45L1 recombinant protein

1 strain of glycerol was taken from the working seed bank and frozen in a tube, i.e., the genetically engineered strain expressing HPV45L1 obtained in example 19, and after thawing, 100. mu.L of the thawed strain was inoculated into 5mL of YPD medium and cultured at 30 ℃ for 20 hours at 280 revolutions per minute (rpm). The density of the thallus reaches OD₆₀₀About 1 to about 2. The microscopic examination is free from the contamination of foreign bacteria. 1mL of the activation solution which was passed through the examination was inoculated into 500mL of YPD medium and cultured at 280rpm at 30 ℃ for 20 hours. The density of the thallus reaches OD₆₀₀About 2 to about 6. The microscopic examination is free from the contamination of foreign bacteria. Basic salt culture medium BSM1 (K) for fermentation₂SO₄273g，MgSO₄109g，CaSO₄·2H₂O17.6g，H₃PO₄400.5mL, KOH62g, glycerol 600g, PTM160mL, molinate1mL, deionized water to 15L), no antibiotics, and can be sterilized in a 30L fermentor (Bioengineering Co.) after formulation. Sterilizing at 121 deg.C for 30min, and cooling to 30 deg.C. Inoculating the activated seed liquid into a tank at a ratio of 1: 15. Fermenting at 30.0 + -0.5 deg.C with initial pH of 5.00 + -0.05, culturing at initial rotation speed of 300rpm, ventilating amount of 0.5vvm, DO (dissolved oxygen value) of 100%, and adding PTM1(CuSO 1)₄·5H₂O6.0g，NaI0.008g， MnSO₄3.0g，NaMoO₄0.2g，H₃BO₃0.02g，ZnSO₄20.0g，CoCl₂0.5g，FeSO₄·H₂O65.0g，biotin 0.2g，H₂SO₄5.0mL, deionized water to 1L) of trace salts. The initial proliferation stage is about 24 hours, the dissolved oxygen value is maintained to be not less than 20%, when the carbon source is completely consumed, the dissolved oxygen value rapidly rises, and the wet weight of the thalli reaches about 100 g/L. The initial two hours were supplemented with 50% volume glycerol solution at a rate of 200mL/h per hour (12 mL PTM1 added per liter). After two hours of feeding, 300mL/h was used instead. By adjusting the stirring speed, the air flow rate and the tank pressure (b)<0.8bar) to maintain the dissolved oxygen level above 30%. After the addition of the enzyme for about 4 hours and the wet weight of the cells was about 230g/L, the addition of the feed was stopped and the dissolved oxygen value was increased. While adjusting the pH to 6.00. + -. 0.05, induction was started by addition of methanol (12 ml of TM1 per liter). The initial methanol addition was controlled at 30 mL/h. The amount of methanol added was slowly increased and the feed rate was set to 90mL/h after 4 hours of methanol induction. The dissolved oxygen value is maintained to be higher than 20 percent by volume, the temperature is maintained at 30 ℃, and the pH value is controlled to be 6.00 +/-0.05. And discharging fermentation liquor after the fermentation is finished after 40 hours of induction. The thalli are collected by centrifugation at 4 ℃, and the wet weight of the thalli reaches 440 g/L.

Example 21: HPV45L1 protein purification

adding a bacterium breaking buffer solution into pichia pastoris cells expressing HPV45L1VLP according to the ratio of 1: 5, mixing the pichia pastoris cells, breaking the cell suspension under high pressure after fully mixing the mixture, and repeating the operation to break 90 percent of the cells. Centrifuging the high-pressure crushed bacteria-breaking solution at 9000rpm for 30min at 10 deg.C, and collecting the supernatant after centrifugation.

The fractions eluted containing HPV45L1 protein were pooled and further purified using a CHT (BIO-RAD type II) column, eluting in the following manner: a linear gradient from 100% buffer A (5mM PB, 0.6M NaCl, 50mM MOPS pH6.5, 0.05% Tween-80) to 100% buffer B (200mM PB, 0.6M NaCl, pH6.5, 0.05% Tween-80). And collecting the eluted components, detecting by SDS-PAGE and Western-blot, and combining the components containing the HPV45L1VLP to obtain the final purified sample. The purity of L1 protein was checked by SDS-PAGE electrophoresis, and the purity of the purified virus-like particles was more than 90% as shown by scanning (FIG. 11). The purified sample was observed by electron microscopy (center of electron microscopy at east china university, shanghai) to show virus-like particles (fig. 12), and the results showed that the particle diameter was between 60-100 nm.

Example 22: measurement of expression amount of HPV45L1 recombinant protein of the present invention

In this example, the total protein content of the HPV45L1VLP after the disruption of the bacteria is calculated according to the total protein content of the supernatant of the disrupted bacteria of the fermented bacteria measured by the Bradford method and the expression level of the HPV45L1VLP measured by the Elisa sandwich method. The method comprises the following specific steps:

Mu.l, 10. mu.l, 20. mu.l, 40. mu.l, 80. mu.l, 100. mu.l of BSA standard (0.5mg/ml) and 40. mu.l (100-fold dilution) of the disrupted supernatant of the fermented cells obtained in example 20 were added to 7 tubes of 1.5ml EP in one portion, and the mixture was made up with waterTo a total volume of 100. mu.l, and mixed well. 3 replicates were set for each concentration. 900 μ l Bradford solution was added to each tube, mixed immediately, left at room temperature for 10 minutes, and then OD was measured separately₅₉₅Light absorption value. And (3) making a protein concentration-to-absorbance value standard curve according to 6 groups of BSA standard substances, calculating to obtain a linear equation, and calculating the total protein content of the fermented thallus broken bacteria supernatant according to the light absorbance value obtained by breaking the bacteria supernatant and the linear equation of the standard curve.

2. Determination of HPV45L1VLP content in fermented thallus strain-breaking supernatant by Elisa sandwich method

Purified HPV45L1VLP was used as a standard protein concentration curve, and the pre-induced bacteria served as negative controls.

Coating solution (1.6g Na)₂CO₃，2.95g NaHCO₃) The rabbit anti-HPV 45L1VLP polyclonal antibody is diluted 2000 times, and then 0.1ml of the diluted rabbit polyclonal antibody is added into each concave hole of the enzyme label plate respectively, and the mixture is over night at 4 ℃. The coating solution was removed, the wells were washed with 0.3ml of PBST (PBS, pH7.0, 0.05% Tween-20), and incubated with 0.3ml of blocking solution (5% nonfat dry milk + PBST) at 37 ℃ for 2 hours.

The purified HPV45L1VLP obtained in example 21 was serially diluted from a gradient of concentration 2. mu.g/ml to 0.0625. mu.g/ml using a dilution solution (PBS, pH7.0) as a standard sample in two-fold dilutions. Meanwhile, the bacterial-breaking supernatant of the fermentation thallus obtained in example 20 was diluted 200 times, then 0.1ml of HPV45L1VLP solutions of different concentrations after gradient dilution or diluted bacterial-breaking supernatants were added to the wells, respectively, and after 1 hour of incubation at 37 ℃, the antigen solution was removed and the wells were washed with 0.3ml of PBST. MAB885 murine anti-HPV 45L1VLP monoclonal antibody (purchased from CHEMICON) was diluted 1000-fold with antibody dilution buffer (PBS, pH7.0, 2% skim milk powder) and added to wells at 0.1ml per well and incubated at 37 ℃ for 1 hour. The mab solution was removed and the wells were washed with 0.3ml PBST. Then, 0.1ml of HRP-labeled goat anti-mouse IgG0 diluted 5000 times with an antibody dilution buffer was added to each well, and the mixture was incubated at 37 ℃ for 0.5 hour. The antibody solution was removed, the wells were washed with 0.3ml of PBST, and 0.1ml of DAB developing solution (available from Amresco) was added to each well and allowed to react at room temperature for 20 minutes. To each well was added 0.05ml of 2MH₂SO₄Stopping the reaction with a stop solution, and determining OD with an enzyme-labeled colorimeter₄₅₀And (4) light absorption value.

OD of HPV45L1VLP Using gradient dilution₄₅₀And (4) preparing a standard protein concentration curve, and converting the standard protein concentration curve to obtain the fermentation expression quantity of the HPV45L1 protein.

The results of this example are shown in Table 7. As can be seen from Table 7, the expression level of HPV45L1 gene of the invention can reach 150 μ g/mg (HPV 45L1VLP in the supernatant of the broken bacteria/total protein in the supernatant of the broken bacteria).

Table 7: expression level of HPV45L1 Gene of the invention

Example 23: preparation of HPV45L1 vaccine

The L1 protein obtained by purification in example 21 was adsorbed with an aluminum phosphate adjuvant by a method described in pharmacopoeia of the people's republic of china (2005 edition), to prepare an HPV45L1 vaccine having immunogenicity.

Example 24: determination of immunogenicity of HPV45L1 Gene expression product

SPF-grade BALB/c mice (Shanghai Seipaibikai laboratory animals Co., Ltd.) 6-8 weeks old were selected and divided into 4 groups of 8 mice each. Groups 1-3 were injected with 0.5mL VLP adsorbed with aluminum adjuvant (as test group), and group 4 mice were immunized (as negative control group) with 0.5mL buffer containing aluminum adjuvant (0.32M NaCl, 0.01% Tween-80, 0.01M histidine, pH6.5) by intraperitoneal injection once on day 0, and blood was collected 28 days after immunization. Standing the collected blood at 37 deg.C for 2h, centrifuging at 8000rpm for 5min, sucking supernatant to obtain mouse immune serum, storing at-20 deg.C, and detecting the positive conversion rate of mouse serum, the specific method comprises: purified Pichia pastoris-expressed HPV45L1 was diluted to 1. mu.g/mL with coating solution, coated on 96-well microtiter plates, 0.1mL per well, overnight at 4 ℃. The coating solution was removed, washed 3 times with 0.3mL of BST, incubated with 0.3mL of blocking solution (5% nonfat dry milk + PBST) for 2 hours at 37 deg.C,washing for 3 times. Each well was diluted with a dilution buffer (2% nonfat dry milk + PBST) at 1: 1000 (100. mu.l/well), and the wells were plated with an ELISA plate and incubated at 37 ℃ for 1 hour. Washing 6 times, diluting HRP-labeled goat anti-mouse IgG with diluent 1: 5000, adding 100 μ l/well enzyme label plate, incubating at 37 deg.C for 0.5 hr, washing 6 times, adding 100 μ l/well TMB for color development, developing at 37 deg.C for 10 min, adding 2M H₂SO₄The reaction was stopped with 50. mu.l. OD determination with enzyme-labeled colorimeter₄₅₀Reading, OD₄₅₀The values are shown in Table 8. The results of the positive conversion rate of the three test groups are shown in Table 9.

TABLE 8 detection of the positive conversion rate of sera obtained from mice immunized with HPV45L1 (OD)₄₅₀Reading number)

Grouping of different doses	1 μ g group	0.1 μ g group	0.01 μ g group
				Rate of yang transformation	100％	100％	75％

TABLE 9HPV45L1 positive conversion results

Negative average value: 0.005; cutoff value: 0.01111

Note: the Cutoff value is the OD of the detected serum antibody of the adjuvant group₄₅₀Average of valueMean value multiplied by 2.1, OD₄₅₀The mouse serum with the value larger than the Cutoff value is judged to be positive, OD₄₅₀Mouse sera with values less than the Cutoff value were judged negative.

In summary, the L1 gene of the major capsid protein of human papillomavirus type 45 provided by the present invention is an optimized L1 gene, and has the following advantages: the optimized gene is more suitable for expressing the target protein in a yeast host with high efficiency and can meet the requirement of industrial production; meanwhile, the 45 type human papilloma virus vaccine provided by the invention can be self-assembled to form a VLPs structure, and the vaccine can generate stronger immunogenicity in a mouse body by measuring the positive transfer rate of serum after the purified VLPs adsorb an adjuvant, and the method has the following advantages because a pichia pastoris expression system is adopted: low cost, high yield and more uniform and stable product properties.

Claims

1. A Human Papilloma Virus (HPV) gene is optimized by pichia preferred codon because of a natural L1 protein gene, and is characterized in that the nucleotide sequence of the HPV gene is shown as SEQ ID NO: 2.

2. An expression vector comprising the gene of claim 1.

3. The expression vector of claim 2, wherein the expression vector is a pichia pastoris expression vector.

4. The expression vector of claim 3, wherein the expression vector is a pPICZaB vector.

5. A Pichia strain containing the gene of claim 1 or the expression vector of any one of claims 2-4.

6. A Pichia strain according to claim 5, wherein the strain is selected from the group consisting of Pichia X-33, GS115, KM71 and SMD1168 strains.

7. A method for expressing HPV genes in Pichia pastoris, comprising the following steps:

cloning the nucleic acid molecule of the HPV gene according to claim 1 into an expression vector;

b, transforming the expression vector obtained in the step A into a pichia pastoris strain;

c, culturing and screening the transformant;

d, expressing the recombinant HPV protein by using the strain obtained in the step C.

8. The method of claim 7, wherein the expression vector is a pichia pastoris expression vector.

9. The method of claim 8, wherein the expression vector is a pPICZaB vector.

10. The method according to claim 7, wherein the Pichia strain is selected from the group consisting of Pichia pastoris X-33, GS115, KM71 and SMD1168 strains.

11. A method for preparing an anti-HPV vaccine, comprising preparing a recombinant HPV L1 protein virus-like particle by the method of any one of claims 7-10, and adding a pharmaceutically acceptable vaccine adjuvant.

12. The method of claim 11, wherein the pharmaceutically acceptable vaccine adjuvant is an aluminum adjuvant.