CN104513826A - Human papilloma virus genes, vector, strain, and expression method thereof - Google Patents
Human papilloma virus genes, vector, strain, and expression method thereof Download PDFInfo
- Publication number
- CN104513826A CN104513826A CN201310454513.5A CN201310454513A CN104513826A CN 104513826 A CN104513826 A CN 104513826A CN 201310454513 A CN201310454513 A CN 201310454513A CN 104513826 A CN104513826 A CN 104513826A
- Authority
- CN
- China
- Prior art keywords
- gene
- expression
- protein
- expression vector
- hpv
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The present invention relates to genes of the Pichia pastoris expression codon-optimized main capsid protein L1 of human papilloma virus types 52,31 and 45, a vector containing the genes, a strain, a preparation method, and an expression method thereof.
Description
Technical field
This area relates to biology field, specifically, the present invention relates to through codon optimized and be suitable for the HPV52 that expresses in pichia spp, HPV31, the gene of HPV45 type human papillomavirus Major capsid protein L1, and containing the carrier of this gene, bacterial strain and the method expressing this gene.
Background technology
Cervical cancer is the second largest gynecologic malignant tumor being only second to mammary cancer, and the whole world has the women more than 500,000 to be diagnosed as cervical cancer every year, and 270,000 women die from this disease, and age standardization infection rate reaches 10.5%.As far back as the beginning of the eighties, Harald zur Hausen is finder's papilloma virus (human papilloma virus just, HPV) infection is relevant with cervical cancer pathogenesis, and follow-up large quantity research has also proved that HPV and cervical cancer and precancerous lesion thereof have close ties.Up to the present, found over one hundred kind of HPV genotype, wherein about 40 kinds can be infected genital tract mucosa.Wherein high-risk HPV type is HPV16,18,31,33,45,52 and 58, and the cervical cancer of more than 90% is relevant with them.
According to the report of WHO in 2010, HPV52 is that in world wide, in cervical cancer, verification and measurement ratio accounts for the high-risk type of the 7th, main relevant to the cervical cancer of Asia, and recall rate comes the 3rd in the high of cervical cell pathological changes.Certain geographical skewed popularity is distributed with unlike HPV52 with HPV16 and HPV18 type.Asia HPV infects in type, and HPV52 type recall rate is higher, and the multinomial research that China carries out shows the type that HPV52 type also belongs to more common.
According to the report of WHO in 2010, HPV31 is that in world wide, in cervical cancer, verification and measurement ratio accounts for the high-risk type of the 6th, and recall rate comes the 2nd in the high of cervical cell pathological changes.HPV31 is considered to one of 4 kinds of high-risk-types the most general in Cervix Squamous Cell cancer, extensively exists in asymptomatic patient.HPV31 type is main relevant to the formation of dysplasia pathology and cervical cancer in epithelium of cervix uteri specifically.
The incidence that HPV45 HPV in Chinese women infects hypotype is 2.3%, belong at higher HPV hypotype (the China Human Papillomavirus and Related Cancers of Chinese incidence, Fact Sheet2010, WHO/ICO Information Centre on HPV and Cervical Cancer, Sep15,2010).
HPV is without coating icosahedral symmetry virus, its virus genom DNA is closed hoop, length is about 7200-8000bp, is made up of early stage coding region (early region), coding region in late period (late region) and the long control region (long control region) be positioned between the two.Its middle and advanced stage coding region contains two open reading frame (ORF), encoding virus coat proteins L1 and L2.L1 molecular weight of albumen is about 55kDa, is major capsid protein, supports whole viral capsid structure with the form of 72 pentamers, aminoacid sequence high conservative in different type, and body can be stimulated to produce protection antibody.L2 molecular weight of albumen is less, and multidigit is in L1 active site of protein.
The multiple expression systems such as insect expression system, yeast expression system, prokaryotic expression system and mammalian cell can obtain virus-like particle (VLP) by the mode of single expression Major capsid protein L1 or Combined expression L1+L2.The VLP that L1 single expression obtains and natural viral capsid structure similar, can be used for inducing the high titer virus Neutralizing antibody response relevant with being protected from virus attack.
Therefore, in view of L1 albumen is guarded in different genes type internal height, and single expression can form VLP, the target protein researched and developed using L1 albumen as HPV vaccine has higher feasibility.But, solve many technical problems to express VLP that recombinant viral proteins obtains as the commercial development of HPV vaccine and need of production, wherein first the technical issues that need to address are exactly how to improve the expression level of recombinant viral proteins.And L1 albumen is in the expression systems such as intestinal bacteria, pichia spp, baculovirus, the restriction being often subject to amino acid codes frequency of utilization in these organisms causes expression level lower even without expression.As the U.S. Patent No. 7,498 of Merck company, record in 036, the expression amount of wild-type VLP albumen in yeast saccharomyces cerevisiae is 35 μ g/mg (the VLP/ bacteria break supernatant liquid total protein in bacteria break supernatant liquid) left and right.
Therefore, need a kind of high level expression HPV52L1, HPV31L1 in this area, and the method for HPV45L1 gene, described method should be able at a high level, easy and simple to handle and express HPV52L1 at low cost, HPV31L1, and HPV45L1 gene.
Summary of the invention
In order to solve the problems of the technologies described above, according to a first aspect of the invention, a kind of HPV52 that can express in pichia spp is provided, HPV31, HPV45 gene, described gene has SEQ ID NO:2, SEQ ID NO:4, and the nucleotide sequence shown in SEQ ID NO:6.
Utilize pichia spp as the expression system of expressing recombinant protein, there is the features such as expression amount is high, easy and simple to handle, cost is low, and be more conducive to large-scale industrial production compared to more high insect cell and mammalian cell.Because between different plant species, amino acid codes frequency of utilization differs, when utilizing Pichia anomala expression recombinant protein, after often optimizing and revising according to the aminoacid sequence codon of target protein, obtain the DNA sequence dna being more conducive to translate.Therefore, the HPV52 after codon optimization of the present invention, HPV31, HPV45 gene can obtain higher expression level in pichia spp, is more conducive to the research and development for the preventative vaccine of HPV52, HPV31, HPV45 and production.As shown in the embodiment of the present application, the HPV52 of codon optimized mistake of the present invention, the expression amount of HPV31, HPV45 gene in pichia spp can be up to about 140 μ g/mg respectively, 110 μ g/mg, 150 μ g/mg (the VLP/ bacteria break supernatant liquid total protein in bacteria break supernatant liquid).
According to a second aspect of the invention, provide a kind of method expressing HPV L1 gene in pichia spp, comprise the steps:
(1) HPV52, HPV31, HPV45L1 gene of the present invention is cloned in expression vector respectively separately;
(2) expression vector of step (1) gained is converted in Pichi strain;
(3) use the conversion bacterial strain of microbiotic to step (2) gained to screen, obtain one or more bacterial strains that growing state is best;
(4) screened further by the bacterial strain of expression amount to step (3) gained of test HPV52, HPV31, HPV45L1 gene, obtain one or more bacterial strains that expression amount is the highest;
(5) use the bacterial strain of step (4) gained to express, obtain HPV52 respectively, HPV31, HPV45L1 albumen.
According to a specific embodiments of the present invention, the expression vector described in described step (1) is pPICZ α B carrier, and the microbiotic used in described step (3) is Zeocin.。
According to a specific embodiments of the present invention, the Pichi strain used in described step (2) is pichia pastoris X-33 bacterial strain.
According to a specific embodiments of the present invention, in described step (4), the operation of the expression amount of test HPV52, HPV31, HPV45L1 gene is undertaken by Western blot method.
According to a specific embodiments of the present invention, the expression step in described step (5) is the fermentation step carried out in fermentor tank.
According to a third aspect of the invention we, the expression vector containing HPV52, HPV31, HPV45L1 gene of the present invention is provided.
According to a specific embodiments of the present invention, the described expression vector containing HPV52, HPV31, HPV45L1 gene of the present invention derives from pPICZ α B carrier.
According to a forth aspect of the invention, provide containing HPV52 of the present invention, HPV31, the Pichi strain of HPV45L1 gene or expression vector, described bacterial strain can Expression product HPV52, HPV31 at a high level, HPV45L1 albumen, be more conducive to for HPV52, HPV31, and the research and development of the preventative vaccine of HPV45 and production.
Accompanying drawing explanation
Fig. 1 shows agarose electrophoresis figure after HPV52L1 gene double digestion.HPV520.7% agarose gel electrophoresis qualification double digestion result 1: expression plasmid (HindIII+KpnI); 2:DNA Marker.
Fig. 2 shows brokenly HPV52L1 supernatant liquor Western-blot after bacterium and identifies.Western-blot identifies 52L1 ' abduction delivering situation, 1-8: recombinant strains; 9:PageRuler Prestained Protein Ladder; 10: empty Host Strains.
Fig. 3 shows HPV52L1 protein sample SDS-PAGE electrophorogram.Virus-like particle SDS-PAGE electrophoresis calibrating after HPV52L1 purifying, 1Marker; Virus-like particle after the final purifying of 2HPV52L1.
Fig. 4 shows in HPV52L1 protein sample and presents virus-like particle electromicroscopic photograph.Virus-like particle electromicroscopic photograph after HPV52L1 purifying.
Fig. 5 shows HPV31L1-pPIC Z α B double digestion qualification result.1:DNA Marker; 2,3,6,8:31L1-pPIC Z α B mono-clonal plasmid; 4,5,7,9:31L1-pPIC Z α B mono-clonal plasmid double digestion (KpnI/BstBI).
Fig. 6 shows HPV31L1 abduction delivering situation Western-blot and identifies.1-8: recombinant strains; 9: positive protein stoste; 10:PageRuler Prestained Protein Ladder.
After Fig. 7 shows HPV31L1 purifying, virus-like particle SDS-PAGE electrophoresis is examined and determine.1Marker; HPV3IL1 after 2 purifying
Fig. 8 shows virus-like particle electromicroscopic photograph after HPV31L1 purifying
Fig. 9 shows HPV45L10.8% agarose gel electrophoresis qualification double digestion result.1: expression plasmid (HindIII+KpnI double digestion); 2:DNA Marker
Figure 10 shows HPV45L1Western-blot and identifies 45L1 ' abduction delivering situation.1: empty Host Strains; 2-8,10: recombinant strains; 9:PageRuler Prestained Protein Ladder
After Figure 11 shows HPV45L1 purifying, SDS-PAGE electrophoresis is examined and determine.1HPV45L1 albumen; 2Marker
Figure 12 shows virus-like particle electromicroscopic photograph after HPV45L1 purifying
Sequence explanation
SEQ ID NO:1 is wild-type HPV52L1 aminoacid sequence.
SEQ ID NO:2 is the nucleotide sequence of HPV52L1 gene of the present invention.
SEQ ID NO:3 is wild-type HPV31L1 aminoacid sequence.
SEQ ID NO:4 is the nucleotide sequence of HPV31L1 gene of the present invention.
SEQ ID NO:5 is wild-type HPV45L1 aminoacid sequence.
SEQ ID NO:6 is the nucleotide sequence of HPV45L1 gene of the present invention.
The nucleotide sequence forward primer of SEQ ID NO:7HPV52L1 gene.
The nucleotide sequence reverse primer of SEQ ID NO:8HPV52L1 gene.
The nucleotide sequence forward primer of SEQ ID NO:9HPV45L1 gene.
The nucleotide sequence reverse primer of SEQ ID NO:10HPV45L1 gene.
Embodiment
The present invention is described in detail, so that those of ordinary skill in the art can understand the present invention better by following examples.Following embodiment, only for exemplary purpose, is not intended to limit scope of the present invention.Endeavour to ensure the accuracy of Values (as quantity, temperature etc.), but should consider there is some errors and deviation.Except as otherwise noted, temperature by DEG C in units of or for envrionment temperature, pressure close to or equal normal atmosphere.Except as otherwise noted, the restriction enzyme used in each of the embodiments described below is all purchased from New England Biolab company.Should be understood that, except as otherwise noted, plant and instrument used in following each embodiment is the conventional equipment of this area.Except as otherwise noted, the substratum used is commercially available conventional medium, and those skilled in the art all know composition wherein and content.In order to for simplicity, likely use various general abbreviation in this article, those skilled in the art can understand its implication completely.
Embodiment
The codon optimized design of embodiment 1:HPV52L1
According to wild-type HPV52L1 aminoacid sequence (GenBank:CAA52590.1, SEQ ID NO:1) and pichia spp preferences codon, synthesis 52L1 sequence.Wild-type HPV52L1DNA sequence is transformed, all codons all adopt the codon that in pichia spp, frequency of utilization is higher or the highest, and consider the formation of secondary structure and the selection of restriction enzyme site, finally obtain the nucleotide sequence SEQ ID NO:2 of HPV52L1 gene of the present invention.
Embodiment 2:HPV52L1 recombinant expression vector builds
The 52L1 sequence of synthesis gained is cloned into pPICZalphaB carrier (Invitrogen) by following method.Increase in the mode of PCR and obtain two ends respectively with the 52L1DNA fragment of BstBI and KpnI, PCR primer: forward primer: 5 ' CAGGTGATCTTCGAAACGATGAGTGTTTGGAGAC3 ' (BstBI) (SEQ ID NO:7); Reverse primer: 5 ' ATTGGTACCCTATTATCTTTTAACT3 ' (KpnI) (SEQ ID NO:8).PCR program: 94 DEG C 5 minutes, 94 DEG C 30 seconds, 55 DEG C 30 seconds, 72 DEG C 1 point 50 seconds circulation 30 times, 72 DEG C 10 minutes, 10 DEG C 10 minutes, end of run.PCR primer is identified with agarose gel electrophoresis and is reclaimed 1500bp place band (Qiagen gel extraction kit).Recovery fragment is combined enzyme with pPICZalphaB with BstBI and KpnI (New England Biolab) and is cut, and agarose gel electrophoresis qualification also reclaims about 1500bp and 3600bp fragment respectively.After reclaiming 52L1 and pPICZalphaB with mol ratio be 5: 1 ratio spend the night with T4 ligase enzyme (Takara) 16 DEG C and connect, within second day, connect product conversion and enter E.coli DH5 α, coat less salt LB flat board (containing 25ug/mL Zeocin), 37 DEG C of incubated overnight.Picking Partial Conversion rear clone extracting plasmid, double digestion (HindIII+KpnI) is identified, agarose electrophoresis detects (Fig. 1).Qualification gained Positive recombinant clones is preserved after DNA sequencing checking is correct, this recombinant vectors called after pPICZ52L1.
Embodiment 3:HPV52L1 recombinant strains construction and expression
With SacI linearizing pPICZ52L1, endonuclease reaction terminates rear phenol: chloroform removes albumen, then adds 2.5 times of volume dehydrated alcohols, and 1/10 volume 3M NaAc (pH5.2) precipitates DNA, and gained precipitates after 75% washing with alcohol, oven dry with a small amount of aseptic ddH
2o dissolution precipitation, electricity turns pichia spp Host Strains (Invitrogen), coats YPDS flat board (containing 180 μ g/mL Zeocin), and cultivate 3 days for 30 DEG C, total hectogram is grand.Therefrom the tens of clone of picking is inoculated in YPD flat board (containing 1500 μ g/mL Zeocin), and screening plasmid height copy bacterial strain, cultivates 2 days for 30 DEG C.Part clonal growth is very fast, and the best several clones of picking growing state are inoculated in 5mL YPD liquid nutrient medium, change BMMY substratum, 0.5% methanol induction 48 h before harvest thalline after 24 hours.Thalline is after granulated glass sphere fragmentation, and centrifugal gained supernatant liquor is with Western-blot qualification (Fig. 2), and primary antibodie used resists for making rabbit by oneself more.Get the highest bacterial strain of expression amount frozen in-80 DEG C, as fermentor cultivation work seed.
The fermentor cultivation of embodiment 4:HPV52L1 recombinant protein
Get 1 bacterial classification glycerine cryopreservation tube, i.e. the genetic engineering bacterium of the expression HPV52L1 of embodiment 3 gained from work seed bank, draw 100 μ L after melting and access 5mL YPD substratum, 280 revs/min (rpm), cultivate 20 hours for 30 DEG C.Cell density reaches OD
600be about 1-2.Microscopy is without living contaminants.The activation solution 1mL be up to the standards is accessed 500mL YPD substratum, 280rpm, cultivate 20 hours for 30 DEG C.Cell density reaches OD
600be about 2-6.Microscopy is without living contaminants.Fermentation basal salt media BSM1 (K
2sO
4273g, MgSO
4109g, CaSO
42H
2o17.6g, H
3pO
4400.5mL, KOH62g, glycerine 600g, PTM160mL, bubble enemy 1mL, deionized water adds to 15L), not containing microbiotic, after preparation, in 30L fermentor tank (Bioengineering company), carry out real tank sterilizing.Sterilising conditions is 121 DEG C, 30 minutes, is chilled to 30 DEG C after disappearing.Be inoculated in planting liquid after above-mentioned activation in tank with 1: 15.Leavening temperature is 30.0 ± 0.5 DEG C, initial pH5.00 ± 0.05, and initial rotating speed 300rpm cultivates, air flow 0.5vvm, D0 (oxygen dissolving value) 100%, adds PTM1 (CuSO
45H
2o6.0g, NaI0.008g, MnSO
43.0g, NaMoO
40.2g, H
3bO
30.02g, ZnSO
420.0g, CoCl
20.5g, FeSO
47H
2o65.0g, biotin0.2g, H
2sO
45.0mL, deionized water adds to 1L) trace salt.About 24 hours of initial multiplicative stage, maintain oxygen dissolving value and be not less than 20%, when carbon source is exhausted, oxygen dissolving value promptly rises, and thalline weight in wet base reaches about 100g/L.Within initial two hours, add the glycerine solution (often liter is added 12mL PTM1) of volume percent 50% with the speed of 200mL/h per hour.Feed supplement changed 300mL/h into after two hours.Dissolved oxygen level is made to maintain more than 30% by regulating mixing speed, air flow quantity, tank pressure (<0.8bar).Add about 4 hours, when thalline weight in wet base is about 200g/L, stop feed supplement, oxygen dissolving value rises.PH value is controlled to be adjusted to 6.00 ± 0.05 simultaneously, start to add methyl alcohol (often liter is added 12mL PTM1) induction.Initial methanol add-on controls at 30mL/h.The add-on of slow increase methyl alcohol, feed rate was set as 90mL/h after 4 hours by methanol induction.Maintain oxygen dissolving value higher than volume percent 20%, temperature maintains 30 DEG C, and it is 6.00 ± 0.05 that pH value controls.Fermented liquid is released at the end of inducing 40 hours fermentation.4 DEG C of collected by centrifugation thalline, thalline weight in wet base reaches 390g/L.
Embodiment 5:HPV52L1 protein purification
The thalline collected breaks bacterium (broken bacterium damping fluid: 200mM MOPS, pH7.0,0.7NaCl, 0.05%Tween-80) centrifugal after, after getting brokenly bacterium, supernatant liquor is through chromatography method purifying, obtain the L1 albumen being self-assembled into virus-like particle, concrete steps are as follows: will express the Pichia pastoris of HPV52L1VLP, add brokenly the mixing of bacterium damping fluid by 1: 5, after abundant mixing, the above cell suspension of high pressure fragmentation, and repetitive operation, make the cytoclasis of 90%.By the broken bacterium liquid of high pressure fragmentation, in 9000rpm, 30min, 10 DEG C of centrifugations, collect centrifuged supernatant.By the bacteria break supernatant liquid through centrifugal clarification, by POROS50HS, (Applied Biosystems company chromatography column carries out preliminary purification, type of elution is: 100% buffer A (0.5M NaCl, 50mM MOPS pH7.0,0.05%Tween-80) to 100% buffer B (1.5M NaCl, 50mM MOPS pH7.0,0.05%Tween-80) linear gradient elution, collect elution fraction, and adopting SDS-PAGE, Western-blot detects.
After elution fraction containing HPV52L1 albumen is merged, CHT (BIO-RAD TypeII) chromatography column is used to be further purified, type of elution is: 100% buffer A (5mM PB, 0.6M NaCl, 50mM MOPSpH6.5,0.05%Tween-80) buffer B (200mM PB, 0.6M NaCl to 100%, pH6.5,0.05%Tween-80) linear gradient elution.Collect elution fraction, and adopt SDS-PAGE and Western-blot to detect, the component containing HPV52L1VLP is merged, is last purification of samples.SDS-PAGE electrophoresis detection L1 purity of protein, the virus-like particle purity of scanning result display purifying is greater than 90% (Fig. 3).Observe in purification of samples through Electronic Speculum (Fudan University in Shanghai department of chemistry Electron Microscopy Room) and present virus-like particle (Fig. 4), result display particle diameter is between 60-100nm.
Embodiment 6: the expression amount of HPV52L1 recombinant protein of the present invention measures
After the fermentation that the present embodiment records according to Bradford method, the expression amount of the HPV52L1VLP that total protein content and Elisa sandwich assay record in thalline bacteria break supernatant liquid, calculates the content of HPV52L1VLP after broken bacterium in total protein.Concrete steps are as follows:
1. use Bradford method to measure total protein content in fermentation thalli bacteria break supernatant liquid
The commercially available K4000Bradford protein quantitation reagent test kit in lottery industry bio tech ltd, Shanghai is used to measure.
0 μ l is once added in 7 1.5ml EP pipes, 10 μ l, 20 μ l, 40 μ l, 80 μ l, the bacteria break supernatant liquid 40 μ l (dilute 100 times) of the fermentation thalli obtained in 100 μ l BSA standard substance (0.5mg/ml) and embodiment 4, complementing to cumulative volume with water is 100 μ l, mixes.Each concentration establishes 3 Duplicate Samples.Often pipe adds 900 μ l Bradford solution, and mix immediately, room temperature measures OD after placing 10 minutes respectively
595absorbance value.Make protein concentration to light absorption value typical curve according to 6 groups of BSA standard substance and calculate linear equation, then calculate the total protein content of fermentation thalli bacteria break supernatant liquid according to bacteria break supernatant liquid gained absorbance value and typical curve linear equation.
2. with the content in Elisa sandwich method for determining HPV52L1VLP after fermentation thalline bacteria break supernatant liquid
Use the HPV52L1VLP of purifying to do standard protein concentration curve, the thalline before induction is as negative control.
With coating buffer (1.6g Na
2cO
3, 2.95g NaHCO
3) by how anti-for anti-for rabbit HPV52L1VLP dilution 2000 times, the rabbit then respectively added in each shrinkage pool of enzyme plate after 0.1ml dilution resists more, and 4 DEG C are spent the night.Remove coating buffer, wash shrinkage pool with 0.3ml PBST (PBS, pH7.0,0.05%Tween-20), then use 0.3ml confining liquid (5% skim-milk+PBST) in 37 DEG C of insulations 2 hours.
With diluent (PBS, pH7.0) in the mode of continuous doubling dilution, by the purifying HPV52L1VLP of acquisition in embodiment 5 from concentration 2 μ g/ml gradient dilution to 0.0625 μ g/ml, in this, as standard model.The bacteria break supernatant liquid of the fermentation thalli obtained in embodiment 4 is diluted 200 times simultaneously, then respectively to the HPV52L1VLP solution of the different concns added in shrinkage pool after 0.1ml gradient dilution or the bacteria break supernatant liquid after diluting, in 37 DEG C of insulations after 1 hour, remove antigen liquid, and wash shrinkage pool with 0.3ml PBST.Then join in shrinkage pool after using antibody dilution buffer (PBS, pH7.0,2% skim-milk) to be diluted by MAB885 mouse-anti HPV52L1VLP monoclonal antibody (purchased from CHEMICON company) 1000 times, every hole adds 0.1ml, and 37 DEG C are incubated 1 hour.Remove monoclonal antibody solution, wash shrinkage pool with 0.3ml PBST.In each shrinkage pool, add the sheep anti-mouse igg 0.1ml marked with the HRP that antibody dilution buffer dilutes 5000 times again, 37 DEG C are incubated 0.5 hour.Remove antibody-solutions, and wash shrinkage pool with 0.3ml PBST, in shrinkage pool, respectively add 0.1ml DAB nitrite ion (purchased from Amresco company), room temperature effect 20 minutes.0.05ml2M H is added in each shrinkage pool
2sO
4stop buffer with termination reaction, and measures OD with enzyme mark photoelectric color comparator
450light absorption value.
Utilize the OD of the HPV52L1VLP of gradient dilution
450detected result, production standard protein concentration curve, then to be converted to obtain the fermentation expression amount of HPV52L1 albumen by standard protein concentration curve.
The result of the present embodiment is shown in table 1.As can be seen from Table 1, the expression amount of HPV52L1 gene of the present invention can reach 140 μ g/mg (the HPV52L1VLP/ bacteria break supernatant liquid total protein in bacteria break supernatant liquid).
Table 1: the expression amount of HPV52L1 gene of the present invention
Prepared by embodiment 7:HPV52L1 vaccine
With reference to the method in the Pharmacopoeia of the People's Republic of China (version in 2005), by the L1 albumen that purifying in embodiment 5 obtains, absorption Aluminium phosphate adjuvant, prepares and has immunogenic HPV52L1 vaccine.
The immunogenic mensuration of embodiment 8:HPV52L1 gene expression product
Choose the SPF level BALB/c mouse (Shanghai western pul Bi Kai laboratory animal company limited) in 6 ~ 8 week age, be divided into 4 groups, often organize 8 mouse.Inject the VLP (as test set) of Al adsorption adjuvant that 0.5mL concentration is 2 μ g/mL, 0.2 μ g/mL, 0.02 μ g/mL respectively for 1st ~ 3 groups, 4th group of mouse contains buffer reagent (the 0.32M sodium-chlor of aluminium adjuvant with 0.1mL, 0.01% tween-80,0.01M Histidine, pH6.5) immunity (as negative control group) is carried out in 0 day subcutaneous abdomen, 5 injecting immunes once, immunity blood sampling in latter 28 days.After the blood collected is placed 2h in 37 DEG C, the centrifugal 5min of 8000rpm, draw supernatant, namely obtain mouse immune serum, deposit in-20 DEG C, and detect the Conversion rate of mouse serum, concrete grammar is as follows: with HPV52L1 to the 1 μ g/mL of the Pichia anomala expression of coating buffer dilution purifying, bag is by 96 hole enzyme plates, and every hole adds 0.1mL, and 4 DEG C are spent the night.Remove coating buffer, clean 3 times with 0.3mLPBST, then use 0.3mL confining liquid (5% skim-milk+PBST) in 37 DEG C of insulations 2 hours, clean 3 times.Every hole adds by dilution buffer (2% skim-milk+PBST) with the tested serum of 1: 1000 dilution, and 100 μ l/ holes, duplicate hole adds enzyme plate, hatches 1 hour for 37 DEG C.Clean 6 times, dilute the sheep anti-mouse igg of HRP mark with diluent 1: 5000,100 μ l/ holes add enzyme plate, hatch 0.5 hour for 37 DEG C, clean 6 times, then add 100 μ l/ hole TMB and develop the color, and 37 DEG C are developed the color 10 minutes, add 2M H
2sO
450 μ l termination reactions.OD is measured with enzyme mark photoelectric color comparator
450reading, OD
450be worth as shown in table 2.Turn positive rate result of three test set is as shown in table 3.
Table 2HPV52L1 immune mouse gained serum turns positive rate and detects (OD
450reading)
| Various dose is divided into groups | 1 μ g group | 0.1 μ g group | 0.01 μ g group |
| Conversion rate | 100％ | 100％ | 12.5％ |
Table 3HPV52L1 turns positive rate result
Negative mean value: 0.007; Cutoff value: 0.014
Note: Cutoff value is the OD of the tested serum antibody of adjuvant group
450the mean value of value is multiplied by 2.1, OD
450the mice serum that value is greater than Cutoff value is judged to be the positive, OD
450the mice serum that value is less than Cutoff value is judged to be feminine gender.
In sum, 52 type human papilloma virus major capsid protein L 1 genes provided by the invention are a kind of optimised L1 genes, have the following advantages: the gene through optimizing is more suitable for high-efficient expression target protein in yeast host, and can meet the requirement of suitability for industrialized production; Simultaneously, 52 type human papillomavirus vaccines provided by the invention, self-assembly can form VLPs structure, after the VLPs absorption adjuvant of purifying, turned the mensuration of positive rate by serum, illustrate that this vaccine can produce stronger immunogenicity in Mice Body, and owing to adopting pichia yeast expression system, therefore the method has the following advantages: cost is low, and output is high, and product property is stable homogeneous more.
The codon optimized design of embodiment 9:1HPV31L1
According to wild-type HPV31L1 aminoacid sequence (GenBank:AEI61021.1, SEQ ID NO:3) and pichia spp preferences codon, synthesis 31L1 sequence.Wild-type HPV31L1DNA sequence is transformed, all codons all adopt the codon that in pichia spp, frequency of utilization is higher or the highest, and consider the formation of secondary structure and the selection of restriction enzyme site, finally obtain the nucleotide sequence SEQ ID NO:4 of HPV31L1 gene of the present invention.
Embodiment 10:HPV31L1 recombinant expression vector builds
The 31L1 sequence of Kpn I (GGTACC), Bst BI (TTCGAA) is introduced at synthesis two ends respectively, is loaded into carrier pGH.
Carry out double digestion with restriction endonuclease KpnI, BstBI to plasmid 31L-pGH, carrier pPIC Z α B, agarose gel electrophoresis qualification also reclaims about 1500bp and 3600bp fragment respectively.Reclaim after 31L1 and pPIC Z α B with mol ratio be 3: 1 ratio connect 2 hours with T4 ligase enzyme (Takara) room temperature, connect product conversion and enter E.coli DH5 α competent cell, coat less salt LB flat board (containing 25ug/ml Zeocin), 37 DEG C of incubated overnight.After picking 8 transforms, mono-clonal bacterium colony carries out colony PCR, and agarose gel electrophoresis qualification PCR primer, what amplified band size was correct is cloned in LB less salt liquid nutrient medium, 37 DEG C of incubated overnight.Incubated overnight bacterium liquid extracting plasmid (Axygen), double digestion (BstB I+KpnI) is identified, agarose electrophoresis detects (Fig. 5).Qualification gained Positive recombinant clones is preserved after DNA sequencing checking is correct, this recombinant vectors called after 31L1-pPIC Z α B.
Embodiment 11:HPV31L1 recombinant strains construction and expression
With SacI linearizing 31L1-pPIC Z α B, endonuclease reaction terminates rear phenol: chloroform removes albumen, add 2.5 times of volume dehydrated alcohols again, 1/10 volume 3M NaAc (pH5.2) precipitates DNA, and gained precipitates after 75% washing with alcohol, oven dry with a small amount of aseptic ddH
2o dissolution precipitation, electricity turns pichia spp (Invitrogen), coats YPDS flat board (containing 100 μ g/ml Zeocin), and cultivate 3 days for 30 DEG C, total hectogram is grand.Therefrom the tens of clone of picking is inoculated in YPD flat board (containing 1500 μ g/ml Zeocin), and screening plasmid height copy bacterial strain, cultivates 2 days for 30 DEG C.Part clonal growth is very fast, and the best several clones of picking growing state are inoculated in 5ml YPD liquid nutrient medium, change BMMY substratum, 1% methanol induction 72 h before harvest thalline after 24 hours.Thalline is after granulated glass sphere fragmentation, and centrifugal gained supernatant liquor is with Western-blot qualification (Fig. 6), and primary antibodie used resists for making rabbit by oneself more.Get the highest bacterial strain of expression amount frozen in-80 DEG C, as fermentor cultivation work seed.
The fermentor cultivation of embodiment 12:HPV31L1 recombinant protein
Get 1 bacterial classification glycerine cryopreservation tube, i.e. the genetic engineering bacterium of the expression HPV31L1 of embodiment 11 gained from work seed bank, draw 100 μ L after melting and access 5mL YPD substratum, 280 revs/min (rpm), cultivate 20 hours for 30 DEG C.Cell density reaches OD
600be about 1-2.Microscopy is without living contaminants.The activation solution 1mL be up to the standards is accessed 500mL YPD substratum, 280rpm, cultivate 20 hours for 30 DEG C.Cell density reaches OD
600be about 2-6.Microscopy is without living contaminants.Fermentation basal salt media BSM1 (K
2sO
4273g, MgSO
4109g, CaSO
42H
2o17.6g, H
3pO
4400.5mL, KOH62g, glycerine 600g, PTM160mL, bubble enemy 1mL, deionized water adds to 15L), not containing microbiotic, after preparation, in 30L fermentor tank (Bioengineering company), carry out real tank sterilizing.Sterilising conditions is 121 DEG C, 30 minutes, is chilled to 30 DEG C after disappearing.Be inoculated in planting liquid after above-mentioned activation in tank with 1: 15.Leavening temperature is 30.0 ± 0.5 DEG C, initial pH5.00 ± 0.05, and initial rotating speed 300rpm cultivates, air flow 0.5vvm, DO (oxygen dissolving value) 100%, adds PTM1 (CuSO
45H
2o6.0g, NaI0.008g, MnSO
43.0g, NaMoO
40.2g, H
3bO
30.02g, ZnSO
420.0g, CoCl
20.5g, FeSO
47H
2o65.0g, biotin0.2g, H
2sO
45.0mL, deionized water adds to 1L) trace salt.About 24 hours of initial multiplicative stage, maintain oxygen dissolving value and be not less than 20%, when carbon source is exhausted, oxygen dissolving value promptly rises, and thalline weight in wet base reaches about 100g/L.Within initial two hours, add the glycerine solution (often liter is added 12mL PTM1) of volume percent 50% with the speed of 200mL/h per hour.Feed supplement changed 300mL/h into after two hours.Dissolved oxygen level is made to maintain more than 30% by regulating mixing speed, air flow quantity, tank pressure (<0.8bar).Add about 4 hours, when thalline weight in wet base is about 200g/L, stop feed supplement, oxygen dissolving value rises.PH value is controlled to be adjusted to 6.00 ± 0.05 simultaneously, start to add methyl alcohol (often liter is added 12mL PTM1) induction.Initial methanol add-on controls at 30mL/h.The add-on of slow increase methyl alcohol, feed rate was set as 90mL/h after 4 hours by methanol induction.Maintain oxygen dissolving value higher than volume percent 20%, temperature maintains 30 DEG C, and it is 6.00 ± 0.05 that pH value controls.Fermented liquid is released at the end of inducing 40 hours fermentation.4 DEG C of collected by centrifugation thalline, thalline weight in wet base reaches 420g/L.
Embodiment 13:HPV31L1 protein purification
The thalline collected break bacterium (broken bacterium damping fluid: 200mM MOPS, pH7.0,0.7NaCl, 0.05%Tween-80) centrifugal after, after getting brokenly bacterium, supernatant liquor is through chromatography method purifying, and obtain the L1 albumen being self-assembled into virus-like particle, concrete steps are as follows:
To express the Pichia pastoris of HPV31L1VLP, add brokenly the mixing of bacterium damping fluid by 1: 5, fully after mixing, the above cell suspension of high pressure fragmentation, and repetitive operation, make the cytoclasis of 90%.By the broken bacterium liquid of high pressure fragmentation, in 9000rpm, 30min, 1O DEG C of centrifugation, collect centrifuged supernatant.
Bacteria break supernatant liquid through centrifugal clarification is carried out preliminary purification by POROS50HS (Applied Biosystems company) chromatography column, type of elution is: 100% buffer A (0.5M NaCl, 50mM MOPS pH7.0,0.05%Tween-80) to 100% buffer B (1.5M NaCl, 50mM MOPS pH7.0,0.05%Tween-80) linear gradient elution, collect elution fraction, and adopting SDS-PAGE, Western-blot detects.
After elution fraction containing HPV31L1 albumen is merged, CHT (BIO-RAD TypeII) chromatography column is used to be further purified, type of elution is: 100% buffer A (5mM PB, 0.6M NaCl, 50mM MOPS pH6.5,0.05%Tween-80) buffer B (200mM PB, 0.6M NaCl to 100%, pH6.5,0.05%Tween-80) linear gradient elution.Collect elution fraction, and adopt SDS-PAGE and Western-blot to detect, the component containing HPV31L1VLP is merged, is last purification of samples.SDS-PAGE electrophoresis detection L1 purity of protein, the virus-like particle purity of scanning result display purifying is greater than 90% (Fig. 7.Observe in purification of samples through Electronic Speculum (Fudan University in Shanghai department of chemistry Electron Microscopy Room) and present virus-like particle (Fig. 8), result display particle diameter is between 30-60nm.
Embodiment 14: the expression amount of HPV31L1 recombinant protein of the present invention measures
After the fermentation that the present embodiment records according to Bradford method, the expression amount of the HPV31L1VLP that total protein content and Elisa sandwich assay record in thalline bacteria break supernatant liquid, calculates the content of HPV31L1VLP after broken bacterium in total protein.Concrete steps are as follows:
1. use Bradford method to measure total protein content in fermentation thalli bacteria break supernatant liquid
The commercially available K4000Bradford protein quantitation reagent test kit in lottery industry bio tech ltd, Shanghai is used to measure.
0 μ l is once added in 7 1.5ml EP pipes, 10 μ l, 20 μ l, 40 μ l, 80 μ l, the bacteria break supernatant liquid 40 μ l (dilute 100 times) of the fermentation thalli obtained in 100 μ l BSA standard substance (0.5mg/ml) and embodiment 12, complementing to cumulative volume with water is 100 μ l, mixes.Each concentration establishes 3 Duplicate Samples.Often pipe adds 900 μ l Bradford solution, and mix immediately, room temperature measures OD after placing 10 minutes respectively
595absorbance value.Make protein concentration to light absorption value typical curve according to 6 groups of BSA standard substance and calculate linear equation, then calculate the total protein content of fermentation thalli bacteria break supernatant liquid according to bacteria break supernatant liquid gained absorbance value and typical curve linear equation.
2. with the content in Elisa sandwich method for determining HPV31L1VLP after fermentation thalline bacteria break supernatant liquid
Use the HPV31L1VLP of purifying to do standard protein concentration curve, the thalline before induction is as negative control.
With coating buffer (1.6g Na
2cO
3, 2.95g NaHCO
3) by how anti-for anti-for rabbit HPV31L1VLP dilution 2000 times, the rabbit then respectively added in each shrinkage pool of enzyme plate after 0.1ml dilution resists more, and 4 DEG C are spent the night.Remove coating buffer, wash shrinkage pool with 0.3ml PBST (PBS, pH7.0,0.05%Tween-20), then use 0.3ml confining liquid (5% skim-milk+PBST) in 37 DEG C of insulations 2 hours.
With diluent (PBS, pH7.0) in the mode of continuous doubling dilution, by the purifying HPV31L1VLP of acquisition in embodiment 13 from concentration 2 μ g/ml gradient dilution to 0.0625 μ g/ml, in this, as standard model.The bacteria break supernatant liquid of the fermentation thalli obtained in embodiment 12 is diluted 200 times simultaneously, then respectively to the HPV31L1VLP solution of the different concns added in shrinkage pool after 0.1ml gradient dilution or the bacteria break supernatant liquid after diluting, in 37 DEG C of insulations after 1 hour, remove antigen liquid, and wash shrinkage pool with 0.3ml PBST.Then join in shrinkage pool after using antibody dilution buffer (PBS, pH7.0,2% skim-milk) to be diluted by MAB885 mouse-anti HPV52L1VLP monoclonal antibody (purchased from CHEMICON company) 1000 times, every hole adds 0.1ml, and 37 DEG C are incubated 1 hour.Remove monoclonal antibody solution, wash shrinkage pool with 0.3ml PBST.In each shrinkage pool, add the sheep anti-mouse igg 0.1ml marked with the HRP that antibody dilution buffer dilutes 5000 times again, 37 DEG C are incubated 0.5 hour.Remove antibody-solutions, and wash shrinkage pool with 0.3ml PBST, in shrinkage pool, respectively add 0.1ml DAB nitrite ion (purchased from Amresco company), room temperature effect 20 minutes.0.05ml2M H is added in each shrinkage pool
2sO
4stop buffer with termination reaction, and measures OD with enzyme mark photoelectric color comparator
450light absorption value.
Utilize the OD of the HPV31L1VLP of gradient dilution
450detected result, production standard protein concentration curve, then to be converted to obtain the fermentation expression amount of HPV31L1 albumen by standard protein concentration curve.
The result of the present embodiment is shown in table 4.As can be seen from Table 4, the expression amount of HPV31L1 gene of the present invention can reach 110 μ g/mg (the HPV31L1VLP/ bacteria break supernatant liquid total protein in bacteria break supernatant liquid).
Table 4: the expression amount of HPV31L1 gene of the present invention
Prepared by embodiment 15:HPV31L1 vaccine
With reference to the method in the Pharmacopoeia of the People's Republic of China (version in 2005), by the L1 albumen that purifying in embodiment 13 obtains, absorption Aluminium phosphate adjuvant, prepares and has immunogenic HPV31L1 vaccine.
The immunogenic mensuration of embodiment 16:HPV31L1 gene expression product
Choose the SPF level BALB/c mouse (Shanghai western pul Bi Kai laboratory animal company limited) in 6 ~ 8 week age, be divided into 4 groups, often organize 8 mouse.Inject the VLP (as test set) of Al adsorption adjuvant that 0.5mL concentration is 2 μ g/mL, 0.2 μ g/mL, 0.02 μ g/mL respectively for 1st ~ 3 groups, 4th group of mouse contains buffer reagent (the 0.32M sodium-chlor of aluminium adjuvant with 0.1mL, 0.01% tween-80,0.01M Histidine, pH6.5) immunity (as negative control group) is carried out in 0 day subcutaneous abdomen, 5 injecting immunes once, immunity blood sampling in latter 28 days.After the blood collected is placed 2h in 37 DEG C, the centrifugal 5min of 8000rpm, draw supernatant, namely obtain mouse immune serum, deposit in-20 DEG C, and detect the Conversion rate of mouse serum, concrete grammar is as follows: with HPV31L1 to the 1 μ g/mL of the Pichia anomala expression of coating buffer dilution purifying, bag is by 96 hole enzyme plates, and every hole adds 0.1mL, and 4 DEG C are spent the night.Remove coating buffer, clean 3 times with 0.3mLPBST, then use 0.3mL confining liquid (5% skim-milk+PBST) in 37 DEG C of insulations 2 hours, clean 3 times.Every hole adds by dilution buffer (2% skim-milk+PBST) with the tested serum of 1: 1000 dilution, and 100 μ l/ holes, duplicate hole adds enzyme plate, hatches 1 hour for 37 DEG C.Clean 6 times, dilute the sheep anti-mouse igg of HRP mark with diluent 1: 5000,100 μ l/ holes add enzyme plate, hatch 0.5 hour for 37 DEG C, clean 6 times, then add 100 μ l/ hole TMB and develop the color, and 37 DEG C are developed the color 10 minutes, add 2M H
2sO
450 μ l termination reactions.OD is measured with enzyme mark photoelectric color comparator
450reading, OD
450be worth as shown in table 5.Turn positive rate result of three test set is as shown in table 6.
Table 5HPV31L1 immune mouse gained serum turns positive rate and detects (OD
450reading)
| Various dose is divided into groups | 1 μ g group | 0.1 μ g group | 0.01 μ g group |
| Conversion rate | 100％ | 100％ | 100％ |
Table 6HPV31L1 turns positive rate result
Negative mean value: 0.005; Cutoff value: 0.01
Note: Cutoff value is the OD of the tested serum antibody of adjuvant group
450the mean value of value is multiplied by 2.1, OD
450the mice serum that value is greater than Cutoff value is judged to be the positive, OD
450the mice serum that value is less than Cutoff value is judged to be feminine gender.
In sum, HPV31 type human papilloma virus major capsid protein L 1 gene provided by the invention is a kind of optimised L1 gene, have the following advantages: the gene through optimizing is more suitable for high-efficient expression target protein in yeast host, and can meet the requirement of suitability for industrialized production; Simultaneously, HPV31 type human papillomavirus vaccine provided by the invention, self-assembly can form VLPs structure, after the VLPs absorption adjuvant of purifying, turned the mensuration of positive rate by serum, illustrate that this vaccine can produce stronger immunogenicity in Mice Body, and owing to adopting pichia yeast expression system, therefore the method has the following advantages: cost is low, and output is high, and product property is stable homogeneous more.
The codon optimized design of embodiment 17:HPV45L1
According to wild-type HPV45L1 aminoacid sequence (GenBank:ABP99831.1, SEQ ID NO:5) and pichia spp preferences codon, synthesis 45L1 sequence.Wild-type HPV45L1DNA sequence is transformed, all codons all adopt the codon that in pichia spp, frequency of utilization is higher or the highest, and consider the formation of secondary structure and the selection of restriction enzyme site, finally obtain the nucleotide sequence SEQ ID NO:6 of HPV45L1 gene of the present invention.
Embodiment 18:HPV45L1 recombinant expression vector builds
The 45L1 sequence of synthesis gained is cloned into pPICZalphaB carrier (Invitrogen) by following method.
Increase in the mode of PCR and obtain two ends respectively with the 45L1DNA fragment of BstBI and KpnI, PCR primer: forward primer: 5 ' CAGGTGATCTTCGAAACGATGGCTTTGTGG3 ' (BstBI) (SEQ ID NO:9); Reverse primer: 5 ' CGGGGTACCCTATTACTTTTTGG3 ' (KpnI) (SEQ ID NO:10).PCR program: 94 DEG C 5 minutes, 94 DEG C 30 seconds, 55 DEG C 30 seconds, 72 DEG C 1 point 50 seconds circulation 30 times, 72 DEG C 10 minutes, 10 DEG C 10 minutes, end of run.PCR primer is identified with agarose gel electrophoresis and is reclaimed 1500bp place band (Qiagen gel extraction kit).Recovery fragment is combined enzyme with pPICZalphaB with BstBI and KpnI (New England Biolab) and is cut, and agarose gel electrophoresis qualification also reclaims about 1500bp and 3600bp fragment respectively.After reclaiming 45L1 and pPICZalphaB with mol ratio be 5: 1 ratio spend the night with T4 ligase enzyme (Takara) 16 DEG C and connect, within second day, connect product conversion and enter E.coli DH5 α, coat less salt LB flat board (containing 25ug/mL Zeocin), 37 DEG C of incubated overnight.Picking Partial Conversion rear clone extracting plasmid, double digestion (HindIII+KpnI) is identified, agarose electrophoresis detects (Fig. 9).Qualification gained Positive recombinant clones is preserved after DNA sequencing checking is correct, this recombinant vectors called after pPICZ45L1.
Embodiment 19:HPV45L1 recombinant strains construction and expression
With SacI linearizing pPICZ45L1, endonuclease reaction terminates rear phenol: chloroform removes albumen, then adds 2.5 times of volume dehydrated alcohols, and 1/10 volume 3M NaAc (pH5.2) precipitates DNA, and gained precipitates after 75% washing with alcohol, oven dry with a small amount of aseptic ddH
2o dissolution precipitation, electricity turns pichia spp Host Strains (Invitrogen), coats YPDS flat board (containing 180 μ g/mL Zeocin), and cultivate 3 days for 30 DEG C, total hectogram is grand.Therefrom the tens of clone of picking is inoculated in YPD flat board (containing 1500 μ g/mL Zeocin), and screening plasmid height copy bacterial strain, cultivates 2 days for 30 DEG C.Part clonal growth is very fast, and the best several clones of picking growing state are inoculated in 5mL YPD liquid nutrient medium, change BMMY substratum, 0.5% methanol induction 48 h before harvest thalline after 24 hours.Thalline is after granulated glass sphere fragmentation, and centrifugal gained supernatant liquor is with Western-blot qualification (Figure 10), and primary antibodie used resists for making rabbit by oneself more.Get the highest bacterial strain of expression amount frozen in-80 DEG C, as fermentor cultivation work seed.
The fermentor cultivation of embodiment 20:HPV45L1 recombinant protein
Get 1 bacterial classification glycerine cryopreservation tube, i.e. the genetic engineering bacterium of the expression HPV45L1 of embodiment 19 gained from work seed bank, draw 100 μ L after melting and access 5mL YPD substratum, 280 revs/min (rpm), cultivate 20 hours for 30 DEG C.Cell density reaches OD
600be about 1-2.Microscopy is without living contaminants.The activation solution 1mL be up to the standards is accessed 500mL YPD substratum, 280rpm, cultivate 20 hours for 30 DEG C.Cell density reaches OD
600be about 2-6.Microscopy is without living contaminants.Fermentation basal salt media BSM1 (K
2sO
4273g, MgSO
4109g, CaSO
42H
2o17.6g, H
3pO
4400.5mL, KOH62g, glycerine 600g, PTM160mL, bubble enemy 1mL, deionized water adds to 15L), not containing microbiotic, after preparation, in 30L fermentor tank (Bioengineering company), carry out real tank sterilizing.Sterilising conditions is 121 DEG C, 30 minutes, is chilled to 30 DEG C after disappearing.Be inoculated in planting liquid after above-mentioned activation in tank with 1: 15.Leavening temperature is 30.0 ± 0.5 DEG C, initial pH5.00 ± 0.05, and initial rotating speed 300rpm cultivates, air flow 0.5vvm, DO (oxygen dissolving value) 100%, adds PTM1 (CuSO
45H
2o6.0g, NaI0.008g, MnSO
43.0g, NaMoO
40.2g, H
3bO
30.02g, ZnSO
420.0g, CoCl
20.5g, FeSO
4h
2o65.0g, biotin0.2g, H
2sO
45.0mL, deionized water adds to 1L) trace salt.About 24 hours of initial multiplicative stage, maintain oxygen dissolving value and be not less than 20%, when carbon source is exhausted, oxygen dissolving value promptly rises, and thalline weight in wet base reaches about 100g/L.Within initial two hours, add the glycerine solution (often liter is added 12mL PTM1) of volume percent 50% with the speed of 200mL/h per hour.Feed supplement changed 300mL/h into after two hours.Dissolved oxygen level is made to maintain more than 30% by regulating mixing speed, air flow quantity, tank pressure (<0.8bar).Add about 4 hours, when thalline weight in wet base is about 230g/L, stop feed supplement, oxygen dissolving value rises.PH value is controlled to be adjusted to 6.00 ± 0.05 simultaneously, start to add methyl alcohol (often liter is added 12mL PTM1) induction.Initial methanol add-on controls at 30mL/h.The add-on of slow increase methyl alcohol, feed rate was set as 90mL/h after 4 hours by methanol induction.Maintain oxygen dissolving value higher than volume percent 20%, temperature maintains 30 DEG C, and it is 6.00 ± 0.05 that pH value controls.Fermented liquid is released at the end of inducing 40 hours fermentation.4 DEG C of collected by centrifugation thalline, thalline weight in wet base reaches 440g/L.
Embodiment 21:HPV45L1 protein purification
The thalline collected break bacterium (broken bacterium damping fluid: 200mM MOPS, pH7.0,0.7NaCl, 0.05%Tween-80) centrifugal after, after getting brokenly bacterium, supernatant liquor is through chromatography method purifying, and obtain the L1 albumen being self-assembled into virus-like particle, concrete steps are as follows:
To express the Pichia pastoris of HPV45L1VLP, add brokenly the mixing of bacterium damping fluid by 1: 5, fully after mixing, the above cell suspension of high pressure fragmentation, and repetitive operation, make the cytoclasis of 90%.By the broken bacterium liquid of high pressure fragmentation, in 9000rpm, 30min, 10 DEG C of centrifugations, collect centrifuged supernatant.
Bacteria break supernatant liquid through centrifugal clarification is carried out preliminary purification by POROS50HS (Applied Biosystems company) chromatography column, type of elution is: 100% buffer A (0.5M NaCl, 50mM MOPS pH7.0,0.05%Tween-80) to 100% buffer B (1.5M NaCl, 50mM MOPS pH7.0,0.05%Tween-80) linear gradient elution, collect elution fraction, and adopting SDS-PAGE, Western-blot detects.
After elution fraction containing HPV45L1 albumen is merged, CHT (BIO-RAD TypeII) chromatography column is used to be further purified, type of elution is: 100% buffer A (5mM PB, 0.6M NaCl, 50mM MOPS pH6.5,0.05%Tween-80) buffer B (200mM PB, 0.6M NaCl to 100%, pH6.5,0.05%Tween-80) linear gradient elution.Collect elution fraction, and adopt SDS-PAGE and Western-blot to detect, the component containing HPV45L1VLP is merged, is last purification of samples.SDS-PAGE electrophoresis detection L1 purity of protein, the virus-like particle purity of scanning result display purifying is greater than 90% (Figure 11).Observe in purification of samples through Electronic Speculum (Shanghai East China Normal University Electronic Speculum center) and present virus-like particle (Figure 12), result display particle diameter is between 60-100nm.
Embodiment 22: the expression amount of HPV45L1 recombinant protein of the present invention measures
After the fermentation that the present embodiment records according to Bradford method, the expression amount of the HPV45L1VLP that total protein content and Elisa sandwich assay record in thalline bacteria break supernatant liquid, calculates the content of HPV45L1VLP after broken bacterium in total protein.Concrete steps are as follows:
1. use Bradford method to measure total protein content in fermentation thalli bacteria break supernatant liquid
The commercially available K4000Bradford protein quantitation reagent test kit in lottery industry bio tech ltd, Shanghai is used to measure.
0 μ l is once added in 7 1.5ml EP pipes, 10 μ l, 20 μ l, 40 μ l, 80 μ l, the bacteria break supernatant liquid 40 μ l (dilute 100 times) of the fermentation thalli obtained in 100 μ l BSA standard substance (0.5mg/ml) and embodiment 20, complementing to cumulative volume with water is 100 μ l, mixes.Each concentration establishes 3 Duplicate Samples.Often pipe adds 900 μ l Bradford solution, and mix immediately, room temperature measures OD after placing 10 minutes respectively
595absorbance value.Make protein concentration to light absorption value typical curve according to 6 groups of BSA standard substance and calculate linear equation, then calculate the total protein content of fermentation thalli bacteria break supernatant liquid according to bacteria break supernatant liquid gained absorbance value and typical curve linear equation.
2. with the content in Elisa sandwich method for determining HPV45L1VLP after fermentation thalline bacteria break supernatant liquid
Use the HPV45L1VLP of purifying to do standard protein concentration curve, the thalline before induction is as negative control.
With coating buffer (1.6g Na
2cO
3, 2.95g NaHCO
3) by how anti-for anti-for rabbit HPV45L1VLP dilution 2000 times, the rabbit then respectively added in each shrinkage pool of enzyme plate after 0.1ml dilution resists more, and 4 DEG C are spent the night.Remove coating buffer, wash shrinkage pool with 0.3ml PBST (PBS, pH7.0,0.05%Tween-20), then use 0.3ml confining liquid (5% skim-milk+PBST) in 37 DEG C of insulations 2 hours.
With diluent (PBS, pH7.0) in the mode of continuous doubling dilution, by the purifying HPV45L1VLP of acquisition in embodiment 21 from concentration 2 μ g/ml gradient dilution to 0.0625 μ g/ml, in this, as standard model.The bacteria break supernatant liquid of the fermentation thalli obtained in embodiment 20 is diluted 200 times simultaneously, then respectively to the HPV45L1VLP solution of the different concns added in shrinkage pool after 0.1ml gradient dilution or the bacteria break supernatant liquid after diluting, in 37 DEG C of insulations after 1 hour, remove antigen liquid, and wash shrinkage pool with 0.3ml PBST.Then join in shrinkage pool after using antibody dilution buffer (PBS, pH7.0,2% skim-milk) to be diluted by MAB885 mouse-anti HPV45L1VLP monoclonal antibody (purchased from CHEMICON company) 1000 times, every hole adds 0.1ml, and 37 DEG C are incubated 1 hour.Remove monoclonal antibody solution, wash shrinkage pool with 0.3ml PBST.In each shrinkage pool, add the sheep anti-mouse igg 0.1ml marked with the HRP that antibody dilution buffer dilutes 5000 times again, 37 DEG C are incubated 0.5 hour.Remove antibody-solutions, and wash shrinkage pool with 0.3ml PBST, in shrinkage pool, respectively add 0.1ml DAB nitrite ion (purchased from Amresco company), room temperature effect 20 minutes.0.05ml2M H is added in each shrinkage pool
2sO
4stop buffer with termination reaction, and measures OD with enzyme mark photoelectric color comparator
450light absorption value.
Utilize the OD of the HPV45L1VLP of gradient dilution
450detected result, production standard protein concentration curve, then to be converted to obtain the fermentation expression amount of HPV45L1 albumen by standard protein concentration curve.
The result of the present embodiment is shown in table 7.As can be seen from Table 7, the expression amount of HPV45L1 gene of the present invention can reach 150 μ g/mg (the HPV45L1VLP/ bacteria break supernatant liquid total protein in bacteria break supernatant liquid).
Table 7: the expression amount of HPV45L1 gene of the present invention
Prepared by embodiment 23:HPV45L1 vaccine
With reference to the method in the Pharmacopoeia of the People's Republic of China (version in 2005), by the L1 albumen that purifying in embodiment 21 obtains, absorption Aluminium phosphate adjuvant, prepares and has immunogenic HPV45L1 vaccine.
The immunogenic mensuration of embodiment 24:HPV45L1 gene expression product
Choose the SPF level BALB/c mouse (Shanghai western pul Bi Kai laboratory animal company limited) in 6 ~ 8 week age, be divided into 4 groups, often organize 8 mouse.Inject the VLP (as test set) of Al adsorption adjuvant that 0.5mL concentration is 2 μ g/mL, 0.2 μ g/mL, 0.02 μ g/mL respectively for 1st ~ 3 groups, 4th group of mouse contains buffer reagent (the 0.32M sodium-chlor of aluminium adjuvant with 0.5mL, 0.01% tween-80,0.01M Histidine, pH6.5) immunity (as negative control group) is carried out in abdominal injection immunity in 0 day once, immunity blood sampling in latter 28 days.After the blood collected is placed 2h in 37 DEG C, the centrifugal 5min of 8000rpm, draw supernatant, namely obtain mouse immune serum, deposit in-20 DEG C, and detect the Conversion rate of mouse serum, concrete grammar is as follows: with HPV45L1 to the 1 μ g/mL of the Pichia anomala expression of coating buffer dilution purifying, bag is by 96 hole enzyme plates, and every hole adds 0.1mL, and 4 DEG C are spent the night.Remove coating buffer, clean 3 times with 0.3mLPBST, then use 0.3mL confining liquid (5% skim-milk+PBST) in 37 DEG C of insulations 2 hours, clean 3 times.Every hole adds by dilution buffer (2% skim-milk+PBST) with the tested serum of 1: 1000 dilution, and 100 μ l/ holes, duplicate hole adds enzyme plate, hatches 1 hour for 37 DEG C.Clean 6 times, dilute the sheep anti-mouse igg of HRP mark with diluent 1: 5000,100 μ l/ holes add enzyme plate, hatch 0.5 hour for 37 DEG C, clean 6 times, then add 100 μ l/ hole TMB and develop the color, and 37 DEG C are developed the color 10 minutes, add 2M H
2sO
450 μ l termination reactions.OD is measured with enzyme mark photoelectric color comparator
450reading, OD
450be worth as shown in table 8.Turn positive rate result of three test set is as shown in table 9.
Table 8HPV45L1 immune mouse gained serum turns positive rate and detects (OD
450reading)
| Various dose is divided into groups | 1 μ g group | 0.1 μ g group | 0.01 μ g group |
| Conversion rate | 100％ | 100％ | 75％ |
Table 9HPV45L1 turns positive rate result
Negative mean value: 0.005; Cutoff value: 0.01111
Note: Cutoff value is the OD of the tested serum antibody of adjuvant group
450the mean value of value is multiplied by 2.1, OD
450the mice serum that value is greater than Cutoff value is judged to be the positive, OD
450the mice serum that value is less than Cutoff value is judged to be feminine gender.
In sum, 45 type human papilloma virus major capsid protein L 1 genes provided by the invention are a kind of optimised L1 genes, have the following advantages: the gene through optimizing is more suitable for high-efficient expression target protein in yeast host, and can meet the requirement of suitability for industrialized production; Simultaneously, 45 type human papillomavirus vaccines provided by the invention, self-assembly can form VLPs structure, after the VLPs absorption adjuvant of purifying, turned the mensuration of positive rate by serum, illustrate that this vaccine can produce stronger immunogenicity in Mice Body, and owing to adopting pichia yeast expression system, therefore the method has the following advantages: cost is low, and output is high, and product property is stable homogeneous more.
Claims (11)
1. a Human Papillomavirus DNA, described gene be natural L1 protein gene through the optimization of pichia spp preference codon, it is characterized in that, the nucleotide sequence of HPV gene as SEQ ID NO:2, SEQ ID NO:4, or shown in SEQ ID NO:6.
2. HPV gene according to claim 1, the protein of wherein this genetic expression can be self-assembled into virus-like particle in pichia spp.
3. in pichia spp, express a method for HPV gene, comprise the steps:
A by the cloned nucleic acid molecule of a HPV gene according to claim 1 in expression vector;
B by steps A expression vector be converted in Pichi strain;
C cultivates and screening transformant;
The bacterial strain that D uses step C to obtain expresses the HPV albumen of restructuring.
4. expression vector according to claim 3, is characterized in that, a kind of yeast expression vector.
5. expression vector according to claim 4, is characterized in that, pPICZaB carrier.
6. Pichi strain according to claim 3, is characterized in that, is selected from pichia pastoris X-33, GS115, KM71 and SMD1168 bacterial strain.
7. Pichi strain according to claim 6, containing the expression vector described in one of claim 4 or 5 item.
8. prepare anti-human papilloma virus (anti-HPV) 52 for one kind, 31, or 45 methods of type vaccine, it is characterized in that, comprise any one of the method for employing described in claim 1-6, bacterial strain, carrier, gene, albumen, prepare recombinant human papilloma virus 52,31, or 45 type L1 prion sample particles, then add pharmaceutically can vaccine adjuvant.
9. method according to claim 8, is characterized in that, described pharmaceutically can vaccine adjuvant be aluminium adjuvant.
10. vaccine according to claim 8, is characterized in that, for prevention of human papillomavirus relative disease, is selected from recombinant human papilloma virus 52,31, or 45 type L1 prion sample particles, comprises the purposes in wherein one or more composition.
11. purposes according to claim 10, is characterized in that, described disease is selected from: tumour, cervical intraepithelial neoplasia (CIN), genitalia wart.
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310454513.5A CN104513826B (en) | 2013-09-29 | 2013-09-29 | Human papilloma virus gene, vector, strain and expression method |
| CN202011023653.3A CN112280792B (en) | 2013-09-29 | 2013-09-29 | Human papilloma virus gene, vector, strain and expression method |
| CN202011023673.0A CN112280793B (en) | 2013-09-29 | 2013-09-29 | Human papilloma virus gene, vector, strain and expression method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310454513.5A CN104513826B (en) | 2013-09-29 | 2013-09-29 | Human papilloma virus gene, vector, strain and expression method |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011023653.3A Division CN112280792B (en) | 2013-09-29 | 2013-09-29 | Human papilloma virus gene, vector, strain and expression method |
| CN202011023673.0A Division CN112280793B (en) | 2013-09-29 | 2013-09-29 | Human papilloma virus gene, vector, strain and expression method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104513826A true CN104513826A (en) | 2015-04-15 |
| CN104513826B CN104513826B (en) | 2020-10-20 |
Family
ID=52789698
Family Applications (3)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011023673.0A Active CN112280793B (en) | 2013-09-29 | 2013-09-29 | Human papilloma virus gene, vector, strain and expression method |
| CN201310454513.5A Active CN104513826B (en) | 2013-09-29 | 2013-09-29 | Human papilloma virus gene, vector, strain and expression method |
| CN202011023653.3A Active CN112280792B (en) | 2013-09-29 | 2013-09-29 | Human papilloma virus gene, vector, strain and expression method |
Family Applications Before (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011023673.0A Active CN112280793B (en) | 2013-09-29 | 2013-09-29 | Human papilloma virus gene, vector, strain and expression method |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011023653.3A Active CN112280792B (en) | 2013-09-29 | 2013-09-29 | Human papilloma virus gene, vector, strain and expression method |
Country Status (1)
| Country | Link |
|---|---|
| CN (3) | CN112280793B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106893730A (en) * | 2015-12-18 | 2017-06-27 | 上海泽润生物科技有限公司 | Restructuring human papilloma protein expression |
| CN109750050A (en) * | 2017-11-07 | 2019-05-14 | 上海泽润生物科技有限公司 | The expression of 45 subtype protein of recombinant human papilloma virus |
| CN109750049A (en) * | 2017-11-07 | 2019-05-14 | 上海泽润生物科技有限公司 | The expression of 52 subtype protein of recombinant human papilloma virus |
| WO2022142523A1 (en) | 2021-01-04 | 2022-07-07 | 中国医学科学院基础医学研究所 | Human papillomavirus type 18 chimeric protein and use thereof |
| WO2022142524A1 (en) | 2021-01-04 | 2022-07-07 | 中国医学科学院基础医学研究所 | Human papillomavirus type 31 chimeric protein and use thereof |
Family Cites Families (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7276243B2 (en) * | 2003-03-24 | 2007-10-02 | Merck & Co., Inc. | Optimized expression of HPV31 L1 in yeast |
| WO2004098497A2 (en) * | 2003-04-28 | 2004-11-18 | Genencor International, Inc. | Cd4+ human papillomavirus (hpv) epitopes |
| MY140664A (en) * | 2003-09-29 | 2010-01-15 | Merck Sharp & Dohme | Optimized expression of hpv 45 l1 in yeast |
| CN101115766B (en) * | 2004-06-18 | 2013-05-08 | 印度免疫有限公司 | Codon-optimized HPV16LI for salmonella vaccine strains against human papillomavirus type 16 |
| ES2668802T3 (en) * | 2010-04-23 | 2018-05-22 | Genomic Vision | HPV DNA reorganization detection |
| CN101857870B (en) * | 2010-06-12 | 2012-09-05 | 上海泽润生物科技有限公司 | HPV58 L1 gene, vector, strain and expression method |
| CN102154325B (en) * | 2011-01-01 | 2013-08-21 | 上海生物制品研究所有限责任公司 | Vaccine against human papillomavirus (HPV) as well as preparation method and application thereof |
| CN102719453B (en) * | 2012-01-16 | 2014-08-20 | 王昌华 | Human papilloma virus 18 L1 (HPV18L1) polynucleotide sequence and its expression vector, host cell and use |
-
2013
- 2013-09-29 CN CN202011023673.0A patent/CN112280793B/en active Active
- 2013-09-29 CN CN201310454513.5A patent/CN104513826B/en active Active
- 2013-09-29 CN CN202011023653.3A patent/CN112280792B/en active Active
Non-Patent Citations (2)
| Title |
|---|
| E.C. COIMBRA: "Production of L1 protein from different types of HPV in Pichia pastoris using an integrative vector", 《BRAZILIAN JOURNAL OF MEDICAL AND BIOLOGICAL RESEARCH》 * |
| 仝光杰 楼觉人: "HPV52 L1蛋白在毕赤酵母中的优化表达", 《第五次全国免疫诊断暨疫苗学术研讨会论文集》 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106893730A (en) * | 2015-12-18 | 2017-06-27 | 上海泽润生物科技有限公司 | Restructuring human papilloma protein expression |
| CN106893730B (en) * | 2015-12-18 | 2021-06-11 | 上海泽润生物科技有限公司 | Recombinant human papilloma protein expression |
| CN109750050A (en) * | 2017-11-07 | 2019-05-14 | 上海泽润生物科技有限公司 | The expression of 45 subtype protein of recombinant human papilloma virus |
| CN109750049A (en) * | 2017-11-07 | 2019-05-14 | 上海泽润生物科技有限公司 | The expression of 52 subtype protein of recombinant human papilloma virus |
| CN109750050B (en) * | 2017-11-07 | 2023-08-18 | 上海泽润生物科技有限公司 | Recombinant human papilloma virus 45 subtype protein expression |
| CN109750049B (en) * | 2017-11-07 | 2023-08-18 | 上海泽润生物科技有限公司 | Recombinant human papillomavirus subtype 52 protein expression |
| WO2022142523A1 (en) | 2021-01-04 | 2022-07-07 | 中国医学科学院基础医学研究所 | Human papillomavirus type 18 chimeric protein and use thereof |
| WO2022142524A1 (en) | 2021-01-04 | 2022-07-07 | 中国医学科学院基础医学研究所 | Human papillomavirus type 31 chimeric protein and use thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104513826B (en) | 2020-10-20 |
| CN112280792A (en) | 2021-01-29 |
| CN112280792B (en) | 2022-06-24 |
| CN112280793B (en) | 2022-06-24 |
| CN112280793A (en) | 2021-01-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Finnen et al. | Interactions between papillomavirus L1 and L2 capsid proteins | |
| CN101293918B (en) | Shorten human papilloma virus 16 type L1 protein | |
| CN101343314B (en) | The Human Papillomavirus Type 11 L1 albumen of brachymemma | |
| CN104513826A (en) | Human papilloma virus genes, vector, strain, and expression method thereof | |
| CN102229660B (en) | Truncated human papillomavirus 33 type L1 protein | |
| Kim et al. | Purification and immunogenicity study of human papillomavirus type 16 L1 protein in Saccharomyces cerevisiae | |
| CN101343315B (en) | Shorten human papilloma virus 6 type L1 protein | |
| CN101857870B (en) | HPV58 L1 gene, vector, strain and expression method | |
| CN101570571B (en) | Truncated human papilloma virus 18 type L1 protein | |
| CN104212818A (en) | Optimized gene sequence of human papillomavirus 31 type L1 protein | |
| CN104164447B (en) | The method for generating HPV45 L1 albumen with expressed by Hansenula yeast system | |
| CN104164374B (en) | The method for generating HPV31 L1 albumen with expressed by Hansenula yeast system | |
| CN104845985A (en) | Recombinant human papilloma virus protein expression | |
| CN103215302B (en) | The method for generating HPV18 L1 albumen with expressed by Hansenula yeast system | |
| CN104211782A (en) | Truncated human papillomavirus 45 type L1 protein | |
| CN103361280B (en) | The method for generating HPV11 L1 albumen with expressed by Hansenula yeast system | |
| CN105420249A (en) | Genotype 4 swine hepatitis E virus structural region capsid protein gene and use thereof in preparing swine hepatitis E virus-like particles | |
| CN102234661A (en) | Preparation method of human papilloma virus virions, exogenous protein expression cassette and expression system | |
| CN104164446B (en) | The method for generating HPV33L1 albumen with expressed by Hansenula yeast system | |
| CN104745605A (en) | Expression of 6 and 11 subtype proteins of recombinant human papilloma virus by pichia yeast | |
| CN109535229A (en) | 2 type Rep albumen of recombinant porcine circovirus, ELISA detection kit and the preparation method and application thereof | |
| CN104120089A (en) | Method using hansenula expression system for production of HPV52 L1 protein | |
| CN106893730A (en) | Restructuring human papilloma protein expression | |
| CN107916234A (en) | The method that HPV6 L1 albumen is produced with expressed by Hansenula yeast system | |
| CN104164373A (en) | Method for producing HPV68 L1 protein by using Hansenula polymorpha expression system |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |