CN103305511B - Wheat artificial micromolecule RNA expression vector as well as construction method and application thereof - Google Patents

Abstract

The invention provides an efficient wheat artificial micromolecule RNA expression vector as well as a construction method and an application thereof. A wheat miR171 precursor sequence is selected as a skeleton sequence, an amiRNA sequence is designed for a proper target site on a specific target gene according to the matching characteristics of miRNA and miRNA*, and the amiRNA sequence is constructed to an expression vector for plant transformation so as to be efficiently expressed in the wheat, the efficient and specific amiRNA is quickly designed in the complicated heterologous hexaploid genome of the wheat for a plurality of homologous copies of a gene or a single copy of any gene so as to regulate and control the expression level of the target gene, which has important value in wheat target trait improvement and candidate gene function verification, and the like.

Description

Wheat artificial micromolecule RNA expression vector, its construction process and application

Technical field

The invention belongs to molecular biology, gene engineering technology field, specifically, relate to a kind of Wheat artificial micromolecule RNA expression vector, its construction process and application.

Background technology

MiRNA is the endogenic microRNA of a class.In plant, it is mainly through the mode identification target site of base complementrity, cutting or suppression target mRNA, thus suppresses target gene to be expressed.

Artificial mi RNA (artificial miRNA, amiRNA) technology is that (RNA interference is disturbed in a kind of new RNA risen recent years in basis based on miRNA research, RNAi) technology, it is reached by miRNA/miRNA* sequence in displacement miRNA precursor to regulate particular target gene, thus become a kind of instrument of new functional genomics research.Artificial mi RNA technology one occurs, namely demonstrates the vigor that it is powerful, particularly in specificity and stability.Abroad, first this technology is set up and applied is in Human cell line, be reported in again the expression of successfully lowering reporter gene in Arabidopis thaliana subsequently, in tomato and tobacco, successfully lower endogenous targets gene, and in liver moss and chlamydomonas, lowered endogenous targets gene afterwards also succeed.Research in paddy rice then proves that this technology not only can efficiently promotor gene be reticent in monocotyledons, and in modern molecular breeding, can be used to the Main Agronomic Characters of high efficiency regulatory crop.In plant virus resistance research, the experiment taking the lead in carrying out in Arabidopis thaliana demonstrates the transgenic research that this technology can be applied to the multiple virus resistance of crop, and realizes plant virus resistance by special silencing virus key gene.

Existing several different structures artificial microRNA expression vector method at present, all lay particular emphasis on the operating aspect that miRNA precursor sequence is cloned and is connected with carrier, and how obtaining the amiRNA carrier of high expression, the complex genome aspect particularly artificial mi RNA technology being applied to wheat there is no relevant report.

Summary of the invention

The object of this invention is to provide a kind of Wheat artificial micromolecule RNA expression vector, its construction process and application efficiently.

The invention provides the artificial microRNA of a grow wheat, its nucleotides sequence is classified as:

5 '-AAUGGUCACUAU m ' M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' m ' M ' M ' M ' M ' M ' AgACCACGCCUGCCGGCCGGCCGUAGCCAUGCAUCUGCAUGCGGUGGUGGCUC uCAGUGCUCUUU-3 '; Wherein, M is A, U, G or C, and M ' is the base according to natural matching method and M complementation; Sequence UMMMMMMMMMMMMMMMMMMMM and sequence M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' A reverse complemental, and in sequence UMMMMMMMMMMMMMMMMMMMM, the base of the 4th, 9 and 12 forms mispairing with the base of the 18th, 13 and 10 in sequence M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' A respectively; Sequence UMMMMMMMMMMMMMMMMMMMM is encoded by wheat target gene, and it is 55% ~ 58% that its based composition meets G+C content.

In order to realize the object of the invention, a kind of Wheat artificial micromolecule RNA expression vector of the present invention, it is the expression vector for Plant Transformation containing following sequence:

5 '-AATGGTCACTAT n ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' AgACCACGCCTGCCGGCCGGCCGTAGCCATGCATCTGCATGCGGTGGTGGCTC tCAGTGCTCTTT-3 '; Wherein, N is A, T, G or C, and N ' is the base according to natural matching method and N complementation; Sequence TNNNNNNNNNNNNNNNNNNNN and sequence N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' A reverse complemental, and in sequence TNNNNNNNNNNNNNNNNNNNN, the base of the 4th, 9 and 12 forms mispairing with the base of the 18th, 13 and 10 in sequence N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' A respectively; Sequence TNNNNNNNNNNNNNNNNNNNN is from wheat target gene, and it is 55% ~ 58% that its based composition meets G+C content.

Preferably, the described expression vector for Plant Transformation is plant binary expression vector.

The present invention also provides the construction process of described Wheat artificial micromolecule RNA expression vector, and it is by sequence 5 '-AATGGTCACTAT by engineered method n ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' n ' AgACCACGCCTGCCGGCCGGCCGTAGCCATGCATCTGCATGCGGTGGTGGCTC tCAGTGCTCTTT-3 ' is integrated in the expression vector for Plant Transformation; Wherein, N is A, T, G or C, and N ' is the base according to natural matching method and N complementation; Sequence TNNNNNNNNNNNNNNNNNNNN and sequence N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' A reverse complemental, and in sequence TNNNNNNNNNNNNNNNNNNNN, the base of the 4th, 9 and 12 forms mispairing with the base of the 18th, 13 and 10 in sequence N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' A respectively; Sequence TNNNNNNNNNNNNNNNNNNNN is from wheat target gene, and it is 55% ~ 58% that its based composition meets G+C content.

The present invention further provides the application of described Wheat artificial micromolecule RNA expression vector in regulating plant genetic expression, Breeding objectives proterties and candidate gene functional verification.Wherein, described plant comprises monocotyledons and dicotyledons, and described plant optimization is wheat or tobacco.

Particularly, the construction process of a kind of efficient Wheat artificial micromolecule RNA expression vector of the present invention comprises:

1, the screening of wheat amiRNA skeleton

In other plant, screen part miRNA as artificial mi RNA frame sequence, such as in paddy rice, be that the artificial mi RNA carrier silencing of target genes that frame sequence builds succeeds with miR528, but in wheat, because the reasons such as genome does not check order cause the miRNA quantity of prediction and experimental verification little, conservative miRNA particularly between different plant species is less, can not find the miRNA with paddy rice miR528 homology, so existing result of study in other plant can not be used for reference in wheat, need to reselect suitable artificial mi RNA frame sequence.

In wheat in the miRNA of Bioinformatics Prediction and experimental verification, the secondary structure formed after analyses and comparison miRNA precursor sequence folds, reference factor important during using relatively simple secondary structure as selection skeleton, this expresses efficiently after being conducive to amiRNA carrier genetic transformation in acceptor.

According to above-mentioned condition, to the 85 (PMRD identified, plant microRNAdatabase) secondary structure of wheat miRNA carries out com-parison and analysis, wherein part wheat guards the secondary structure of miRNA as shown in Figure 1, in conjunction with the result of wheat small RNA high-flux sequence, with secondary structure simply for screening basis, thus determine the sequence of the precursor sequence of tae-miR171 as amiRNA skeleton.Tae-miR171 precursor sequence carries out the folding rear secondary loop-stem structure obtained as shown in Figure 2.

For the precursor sequence of selected tae-miR171, carry out certain sequence alterations, comprising:

(1) in the precursor sequence of wheat tae-miR171, the sequence of appropriate length is chosen as frame sequence, as shown in Seq ID No.1, total length 118bp;

(2) sequence editor is carried out to selected frame sequence two ends, introduce the double enzyme site being used for carrier construction.

The frame sequence of the amiR171 of reincarnate is as shown in Seq ID No.2.

2, for target gene design amiRNA sequence

According to the tae-miR171 precursor sequence screened, analyze the pairing feature of itself miRNA and miRNA*, select appropriate target site for target gene, design amiRNA sequence and the amiRNA* sequence of complementation formed according to natural pairing feature.

To above-mentioned selected frame sequence, the secondary structure that namely miR171 precursor sequence is formed is analyzed, and its feature is: miRNA first base is U; In based composition ratio, G+C content is 56.8%, belongs to moderate; MiRNA the 18th bit base and miRNA* form a GU and match; MiRNA the 4th, 9 and 12 bit base and miRNA* form mispairing, and base mismatch is respectively U, C and U, and it corresponds to miRNA* is C, A and U.According to these features above, analyze the based composition of target gene, find suitable target site, obtain amiRNA sequence, amiRNA* sequence is obtained again by base pair complementarity principle, replace original miRNA and miRNA* sequence in tae-MIR171 precursor sequence, when ensureing that amiRNA and amiRNA* is complementary, form the secondary structure similar with natural tae-miR171.

3, design and synthesize primer, pcr amplification obtains the precursor sequence containing amiRNA and amiRNA*

With the miR171 precursor sequence containing amiRNA and amiRNA* designed for template, design following primer:

amiR-KPN-F：5’-TCGGTACCTCTAGAAATGGTCACTAT-3’

amiR-F：5’-TCTAGAAATGGTCACTAT-amiRNA*-GACCACGCCTGCCGGCCGGC-3’

amiR-R：5’-CTGCAGAAAGAGCACTGA-amiRNA-GAGCCACCACCGCATGCAGA-3’

amiR-BMAH-R：5’-TCGGATCCCTGCAGAAAGAGCACTGA-3’

amiR-171-loop：

5’-GACCACGCCTGCCGGCCGGCCGTAGCCATGCATCTGCATGCGGTGGTGGCTC-3’

In above-mentioned primer, the overlap of the 20nt that all has an appointment between different primers, as shown in Figure 3, wherein: amiR-F and amiR-R includes amiRNA and amiRNA* of design; AmiR-171-loop is the loop district of miR171 precursor sequence; AmiR-KPN-F and amiR-BMAH-R is the primer containing restriction enzyme site, can cut to connect by enzyme to be inserted into general Plant Transformation expression vector, as in plant binary expression vector.

By Shanghai, Sheng Gong company synthesizes above-mentioned primer, is increased by regular-PCR, obtains artificial amiRNA precursor sequence, cloning and sequencing, confirms that artificial amiRNA precursor sequence is correct.

4, build on artificial amiRNA expression vector

Kpn I and the reaction of BamH I double digestion are carried out to the correct amiRNA precursor sequence of order-checking and plant binary expression vector, connected by ligase enzyme, obtain amiRNA expression vector plasmid (Fig. 4), enzyme cuts qualification and order-checking confirms, transformation Agrobacterium, for Genetic Transformation in Higher Plants.

A kind of efficient wheat provided by the invention artificial microRNA expression vector can be used to solve the problem that conventional T-DNA because the reasons such as Wheat volatiles is huge, tumor-necrosis factor glycoproteins is many and genome structure is complicated cause and transposon insertions technology cannot effectively use on wheat, improves and the aspect such as candidate gene functional verification provides a kind of new tool for wheat objective trait.

The construction process of the artificial microRNA expression vector of a kind of efficient wheat provided by the invention, the miRNA of endogenous high expression level in wheat is obtained by order-checking and experimental result, again the feature of this miRNA precursor sequence structure and miRNA and miRNA* pairing is analyzed, for the amiRNA of different target genes design differential high efficient, compared with designing with other amiRNA existing, there is unique advantage, major embodiment is both ways: one is select wheat self miRNA precursor sequence as frame sequence, and design the structure similar to natural miRNA, be conducive to high expression in wheat body, two in the allohexaploid genome of wheat complexity, for multiple homologous copies of certain gene, or certain single copy of any one gene, design efficiently special amiRNA rapidly, for regulating and controlling the expression level of target gene, this has important value in the improvement of wheat objective trait and candidate gene functional verification etc.

Accompanying drawing explanation

Fig. 1 is the secondary structure that wheat part guards miRNA, wherein, and A:miR156; B:miR159a; C:miR171; D:miR167; E:miR399; F:miR160.

Fig. 2 is the secondary loop-stem structure of tae-miR171 precursor sequence.

Fig. 3 is the frame sequence schematic diagram that pcr amplification contains amiRNA.

Fig. 4 is wheat amiRNA expression vector schematic diagram.

Fig. 5 is the result that Northern blot detects amiRNA, the target gene that wherein A is corresponding is wheat phytoene dehydrogenase (Phytoene desaturase, PDS) gene, the target gene that B is corresponding is RNA polymerase 1(RNA-dependentRNA-polymerase1, the RDR1 of wheat yellow dwarf virus RNA) gene.

Embodiment

Following examples for illustration of the present invention, but are not used for limiting the scope of the invention.If do not specialize, unreceipted concrete experimental technique in embodiment, all can conventionally carry out.As Sambrook equimolecular clone: condition described in laboratory manual (New York:Cold Spring HarborLabortary Press, 1989), or according to manufacturing the operation instruction of production firm, material therefor or reagent are commercial goods.

Embodiment 1 for frame sequence, builds amiRNA expression vector and the Efficiency testing of interference wheat phytoene dehydrogenase (PDS) gene with wheat tae-miR171 precursor sequence

According to the feature of miRNA and miRNA* pairing during tae-miR171 precursor sequence formation secondary structure, the site meeting these conditions is found in pds gene coded sequence, through compare of analysis, obtain two reasonable sites as target site: (1) TGGCTTAAGGAATAAAGTAAA, (2) GTTGTTTGCCAAGATTTTCCA, form the amiRNA that site is therewith corresponding, substantially the feature that tae-MIR171 has is met, such as first base is U, the 4th, 9 and 12 bit bases and miRNA* form the features such as mispairing, what obtain has the secondary structure similar with natural tae-MIR171 containing amiRNA precursor sequence.

With the amiR171 precursor sequence containing amiRNA and amiRNA* designed for template, design following primer, wherein adding double underline is amiRNA, and to add single underscore be that amiRNA* is specific as follows:

amiR-KPN-F：5’-TCGGTACCTCTAGAAATGGTCACTAT-3’

amiR171-pds-1-f：

5’-TCTAGAAATGGTCACTAT TGGTTTAAGCAACAAAGGAAAGACCACGCCTGCCGGCCGGC-3’

amiR171-pds-1-r：

5’-CTGCAGAAAGAGCACTGA GAGCCACCACCGCATGCAGA-3’

amiR171-pds-2-f：

5’-TCTAGAAATGGTCACTAT GTTGTTTGCGAAAATTTGCCAGACCACGCCTGCCGGCCGGC-3’

amiR171-pds-2-r：

5’-CTGCAGAAAGAGCACTGA GAGCCACCACCGCATGCAGA-3’

amiR-BMAH-R：TCGGATCCCTGCAGAAAGAGCACTGA-3’

amiR-171-loop：

5’-GACCACGCCTGCCGGCCGGCCGTAGCCATGCATCTGCATGCGGTGGTGGCTC-3’

PCR system and condition specific as follows:

PCR system:

PCR program:

94 DEG C, 3 minutes; 94 DEG C, 30 seconds, 55 DEG C, 30 seconds, 72 DEG C, 45 seconds, 35 circulations; 72 DEG C, 10 minutes.

Respectively by above-mentioned PCR primer according to TA cloning process Direct Cloning on pEASY-T1Simple; Connect product conversion bacillus coli DH 5 alpha, and expand numerous wherein, positive colony obtains artificial amiRNA precursor sequence through order-checking screening;

With Kpn I and the correct plasmid of the above-mentioned middle order-checking of BamH I double digestion and pCAMBIA2300-Ubi vector plasmid, purifying digestion products respectively, artificial amiRNA precursor sequence after purifying is carried out connecting product conversion intestinal bacteria with the pCAMBIA2300-Ubi carrier after purifying, PCR detects picking positive colony and checks order, and extracts the plasmid in the correct intestinal bacteria of sequencing result.

By Plastid transformation Agrobacterium correct for above-mentioned order-checking, after PCR detected result is correct, 28 DEG C are shaken bacterium and spend the night.

After centrifugal for above-mentioned bacterium liquid, with the resuspended thalline of MS-MES substratum to OD ₆₀₀=0.5, select the tobacco of 6 ~ 8 weeks sizes, with the 10mL syringe not with syringe needle, re-suspension liquid is injected in tobacco.The tobacco of injecting, places in 20 DEG C of lucifuges, samples, liquid nitrogen cryopreservation after 48 hours.

Extract above-mentioned sample total serum IgE, be separated microRNA, carry out Northern Blot detection.Probe used is:

anti-PDS-1：5’-TTTACTTTATTCCTTAAGCCA-3’

anti-PDS-2：5’-TGGAAAATCTTGGCAAACAAC-3’

Above two probes are respectively used to detect two amiRNA for pds gene, detected by Northern Blot, only have and just can be detected with the microRNA of designing probe complementation, result as shown in Figure 5A, between 21-24nt, there is amiRNA band of expression to occur, namely constructed artificial mi RNA carrier amiRNA171 normal transcription in cell creates the amiRNA of expectation, can combine with the mRNA complementation of pds, show the amiRNA expression vector high expression of constructed interference pds gene.

Embodiment 2 for frame sequence, builds RNA polymerase 1(RNA-dependent RNA-polymerase1, the RDR1 of interference wheat yellow dwarf virus RNA with wheat tae-miR171 precursor sequence) the amiRNA expression vector of gene and Efficiency testing

According to the feature of miRNA and miRNA* pairing during tae-miR171 precursor sequence formation secondary structure, the site meeting these conditions is found in rdr1 gene coded sequence, through compare of analysis, obtain two reasonable sites as target site: (1) CAGCTTTACAGAGGTCAAGAA, (2) CCGTCTCAGATTGGTGAAGGA, form the amiRNA that site is therewith corresponding, substantially the feature that tae-MIR171 has is met, such as first base is U, the 4th, 9 and 12 bit bases and miRNA* form the features such as mispairing, what obtain has the secondary structure similar with natural tae-MIR171 containing amiRNA precursor sequence.

With the amiR171 precursor sequence containing amiRNA and amiRNA* designed for template, design following primer, wherein adding double underline is amiRNA, and to add single underscore be that amiRNA* is specific as follows:

amiR-KPN-F：TCGGTACCTCTAGAAATGGTCACTAT

amiR171-RDR1-1-f：

TCTAGAAATGGTCACTAT CAGTTTTACTGAAGTCACGAAGACCACGCCTGCCGGCCGGC

amiR171-RDR1-1-r：

CTGCAGAAAGAGCACTGA GAGCCACCACCGCATGCAGA

amiR171-RDR1-2-f：

TCTAGAAATGGTCACTAT CCGTCTCAGTTTAGTGACGGAGACCACGCCTGCCGGCCGGC

amiR171-RDR1-2-r：

CTGCAGAAAGAGCACTGA GAGCCACCACCGCATGCAGA

amiR-BMAH-R：TCGGATCCCTGCAGAAAGAGCACTGA

amiR-171-loop：

GACCACGCCTGCCGGCCGGCCGTAGCCATGCATCTGCATGCGGTGGTGGCTC

PCR system and condition are with embodiment 1.

Above-mentioned PCR primer is directly connected on pEASY-T1Simple according to TA cloning process clone; Connect product conversion bacillus coli DH 5 alpha, and expand numerous wherein, positive colony obtains amiRNA precursor sequence through order-checking screening;

With Kpn I and the correct plasmid of the above-mentioned middle order-checking of BamH I double digestion and pCAMBIA2300-Ubi vector plasmid, purifying digestion products respectively, amiRNA precursor sequence after purifying is carried out connecting product conversion intestinal bacteria with the pCAMBIA2300-Ubi carrier after purifying, PCR detects picking positive colony and checks order, and extracts the plasmid in the correct intestinal bacteria of sequencing result.

By Plastid transformation Agrobacterium correct for above-mentioned order-checking, after PCR detected result is correct, 28 DEG C are shaken bacterium and spend the night.

After centrifugal for above-mentioned bacterium liquid, with the resuspended thalline of MS-MES substratum to OD ₆₀₀=0.5, select the tobacco of 6 ~ 8 weeks sizes, with the 10mL syringe not with syringe needle, re-suspension liquid is injected in tobacco.The tobacco of injecting, places in 20 DEG C of lucifuges, sampling after after 48 hours, liquid nitrogen cryopreservation.

Extract above-mentioned sample total serum IgE, be separated microRNA, carry out Northern Blot detection.In experiment, probe used is:

anti-RDR1-1：5’-TTCTTGACCTCTGTAAAGCTG-3’

anti-RDR1-2：5’-TCCTTCACCAATCTGAGACGG-3’

Above two probes are respectively used to detect two amiRNA carriers for rdr1 gene, detected by Northern Blot, only have and just can be detected with the microRNA of designing probe complementation, result as shown in Figure 5 B, between 21-24nt, there is amiRNA band of expression to occur, namely constructed artificial mi RNA carrier amiRNA171 normal transcription in cell creates the amiRNA of expectation, can combine with the mRNA complementation of rdr1, show the amiRNA expression vector high expression of constructed interference rdr1 gene.

Although above the present invention is described in detail with a general description of the specific embodiments, on basis of the present invention, can make some modifications or improvements it, this will be apparent to those skilled in the art.Therefore, these modifications or improvements without departing from theon the basis of the spirit of the present invention, all belong to the scope of protection of present invention.

Claims (6)

1. the artificial microRNA of wheat, its nucleotides sequence is classified as:

5’-AAUGGUCACUAU M’M’M’M’M’M’M’M’M’M’M’M’M’M’ M’M’M’M’M’M’AGACCACGCCUGCCGGCCGGCCGUAGCCAUGCAUCUGCAUGCGGUGGUGGCUC UCAGUGCUCUUU-3’；

Wherein, M is A, U, G or C, and M ' is the base according to natural matching method and M complementation; Sequence UMMMMMMMMMMMMMMMMMMMM and sequence M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' A reverse complemental, and in sequence UMMMMMMMMMMMMMMMMMMMM, the base of the 4th, 9 and 12 forms mispairing with the base of the 18th, 13 and 10 in sequence M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' M ' A respectively; Sequence UMMMMMMMMMMMMMMMMMMMM is encoded by wheat target gene, and it is 55% ~ 58% that its based composition meets G+C content.

2. a Wheat artificial micromolecule RNA expression vector, is characterized in that, it is the expression vector for Plant Transformation containing following sequence:

5’-AATGGTCACTAT N’N’N’N’N’N’N’N’N’N’N’N’N’N’N’N’N’N ’N’N’AGACCACGCCTGCCGGCCGGCCGTAGCCATGCATCTGCATGCGGTGGTGGCTC TCAGTGCTCTTT-3’；

Wherein, N is A, T, G or C, and N ' is the base according to natural matching method and N complementation; Sequence TNNNNNNNNNNNNNNNNNNNN and sequence N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' A reverse complemental, and in sequence TNNNNNNNNNNNNNNNNNNNN, the base of the 4th, 9 and 12 forms mispairing with the base of the 18th, 13 and 10 in sequence N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' A respectively; Sequence TNNNNNNNNNNNNNNNNNNNN is from wheat target gene, and it is 55% ~ 58% that its based composition meets G+C content.

3. Wheat artificial micromolecule RNA expression vector according to claim 2, is characterized in that, the described expression vector for Plant Transformation is plant binary expression vector.

4. the construction process of Wheat artificial micromolecule RNA expression vector described in Claims 2 or 3, is characterized in that, by engineered method by sequence 5 '-AATGGTCACTAT n ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' n ' AgACCACGCCTGCCGGCCGGCCGTAGCCATGCATCTGCATGCGGTGGTGGCTC tCAGTGCTCTTT-3 ' is integrated in the expression vector for Plant Transformation;

Wherein, N is A, T, G or C, and N ' is the base according to natural matching method and N complementation; Sequence TNNNNNNNNNNNNNNNNNNNN and sequence N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' A reverse complemental, and in sequence TNNNNNNNNNNNNNNNNNNNN, the base of the 4th, 9 and 12 forms mispairing with the base of the 18th, 13 and 10 in sequence N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' N ' A respectively; Sequence TNNNNNNNNNNNNNNNNNNNN is from wheat target gene, and it is 55% ~ 58% that its based composition meets G+C content.

5. the application of Wheat artificial micromolecule RNA expression vector described in Claims 2 or 3 in regulating plant genetic expression, Breeding objectives proterties and candidate gene functional verification.

6. application according to claim 5, is characterized in that, described plant comprises monocotyledons and dicotyledons.