CN105647928B - Potato stu-miR5992a and stu-miR5992b and its application - Google Patents
Potato stu-miR5992a and stu-miR5992b and its application Download PDFInfo
- Publication number
- CN105647928B CN105647928B CN201610208514.5A CN201610208514A CN105647928B CN 105647928 B CN105647928 B CN 105647928B CN 201610208514 A CN201610208514 A CN 201610208514A CN 105647928 B CN105647928 B CN 105647928B
- Authority
- CN
- China
- Prior art keywords
- stu
- mir5992b
- mir5992a
- potato
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a kind of potato stu miR5992a and stu miR5992b and its applications.5 ' RACE of RLM survey inspection the result shows that stu miR5992a and stu miR5992b regulation and control potato NAC classes transcription factors (PGSC0003DMG400032555), available for the function of studying the NAC class transcription factor genes, i.e., the physiological acoustic signals of research plant when by loss of expression or being overexpressed the NAC class transcription factors.Quantitative fluorescent PCR survey inspection the result shows that, the expression of stu miR5992a and stu miR5992b are regulated and controled by drought stress, illustrate that it adapts to play an important role in drought stress in potato, the transgenic potato with high drought-resistant ability can be cultivated using it, be of great significance to improving potato yield.
Description
Technical field
Patent of the present invention is related to a kind of microRNA（miRNA）And its application, specifically potato stu-
MiR5992a and stu-miR5992b and its application.
Background technology
MiRNA is the single-stranded microRNA of a kind of non-coding, is about the endogenous non-protein coding RNA of 20 nt.miRNA
Gene, which is initially transcribed, generates the pre-miRNAs with loop-stem structure.Subsequent pre-miRNA is transported out core, the quilt in cytoplasm
Dicer enzyme effects are processed into ripe miRNA.It is combined by the complementary mRNA with specific target gene of sequence, usually after transcription
Level causes mRNA to degrade or inhibit mRNA translations so as to play down regulation to the expression of gene.
Drought stress is one of most important abiotic stress, and the growth and development and yield to crops cause extremely tight
The influence of weight.According to statistics, the 36% of the total land area arid or half-dried early region for belonging to water shortage, China's arid and half on the earth
Dry morning region accounts about the 1/2 of state's land area.Even if in the agriculture main producing region of semi-moist and moistening, would generally also be subject to season
Property and periodic drought invasion and attack.Influence of the drought stress to crop yield, quality is equivalent to the sum of remaining natural calamity,
Harmfulness account for the first in various natural environment stresses, is only second to pest and disease damage and is lost caused by crop.Solve Arid Problem
Approach in addition to utilization ratio of the water-saving irrigation to improve moisture, exactly cultivates the new varieties of saving water, resisting drought to improve crop
Itself resist the ability of arid.Reach this purpose, it is necessary to understand the molecular mechanism of Crop responses drought stress.Therefore, it is right
The research of crop drought resistance mechanism improves the research hotspot problem that crop drought resistance ability is scientists from all over the world's concern to explore.Especially
In recent years to the further investigation of arabidopsis, rice isotype plant, identify, cloned a large amount of drought-enduring relevant genes, ground
Study carefully the regulation and control model for having understood the relevant gene of some salt tolerants.Drought resisting, resistant gene of salt are integrated by the means of genetic engineering
In target plant genome or it is autotelic inhibition or the expression of some drought related genes is induced to obtain transfer-gen plant, open
The new way for cultivating height drought resistance New Crop Varieties is warded off.With the understanding to Drought Resistance Mechanism in Plants and transgenic technology
It reaches its maturity, the new varieties of the breeding material of drought resisting or genetic improvement is obtained using transgenic technology, it has also become drought-resistant variety
Cultivate most potential direction.
NAC classes transcription factor plays important regulating and controlling effect in the environment stresses such as plant responding arid, directly participate in or
Expression of the regulation and control plant connect to the stress responsive genes such as arid, with high salt, so as to the in vivo degeneration-resistant reaction of activated plant, maximum limit
Degree reduces or eliminates the adverse circumstances such as arid to the harm caused by plant.The study found that at least 5 in riceNACTranscription because
Zijia family member participates in positive regulation drought resisting and salt stress-resistant reaction, and expresses to be regulated and controled by ABA hormones.OverexpressionSNAC1The transgenic paddy rice of gene shows as loss of water rate and significantly reduces, and stomata is closed, and drought resistance enhancing, setting percentage carries
The features such as high.Chip analysis find largely with stomatal movement, the expression of membrane stability, osmotic adjustment, detoxication related gene
It is remarkably reinforced.There is research, it was also found that overexpressionOsNAC5O、ONAC045WithsNAC6/SNAC2Transgenic paddy rice drought resisting and
The ability of high salt tolerance significantly improves, and the expression quantity of stress-related genes also substantially raises.Equally there is research also foundOsNAC5
WithOsNAC6It can be withOsLEA3Promoter region sequence combine.OverexpressionOsNAC10The transgenic paddy rice of gene is to arid, height
The tolerance of salt significantly increases, and under drought condition the yield of rice can be made to increase by 25% ~ 42% or increase under normal operation
5%~14%.It willONAC063Gene is gone in arabidopsis, can also enhance plant enhancing drought resisting saline-alkaline tolerance.In arabidopsis,ATAF1After gene function is lost, expression by inhibitation system, drought-resistant ability significantly improves,COR47、KIN1、ERD10、RD22Wait drought resistings phase
The expression of correlation gene also enhances, and showsATAF1Expression of the gene by adjusting Stress responses gene is realized, and it is negative to have reacted drought resisting
Regulating and controlling effect；Also studies have found that overexpression wheat cdnaTaNAC2Transgenic arabidopsis to arid, with high salt and damage to plants caused by sudden drop in temperature
Tolerance enhances.Equally, the overexpression in tobaccoTaNAC2Homologous geneTaNAC2a, transgene tobacco can also be enhanced
To the tolerance of arid.
The content of the invention
The technical problems to be solved by the invention be to provide potato stu-miR5992a and stu-miR5992b sequence,
Stu-miR5992a and stu-miR5992b inhibit expression of target gene with study the application of target gene function, stu-miR5992a and
Stu-miR5992b inhibits expression of target gene and improves plant drought ability, cultivates the application of drought resistant plant variety.
In order to solve the above technical problems, the technical solution adopted in the present invention is as follows：
The sequence of potato stu-miR5992a is as follows（Listed nucleotide sequence is 5 ' → 3 ' in the present invention）：
cuuuuauugucugaagaugcaaguggaggaaaccugacuguaguuccuauuguuggaaugggcggugcggguaagac
aacacuagcuaaagcgguuuacaaugaugagaag （Sequence table SEQ ID NO：1）.
The sequence of potato stu-miR5992b is as follows：
uuauuaucugaagaugcaaguggaaaaaaguugacuguaguuucu
auuguuggaaugggcggcguggguaagacaacacuugcuaaagcgguuuacaaugaugagagggug（Sequence
List SEQ ID NO：2）.
The secondary structure formula of the sequence of potato stu-miR5992a is：It is formed from 5 ' end 11bp-17bp and 84bp-90bp
Ring-type, ring-type is formed from 5 ' end 18bp-20bp and 81bp-83bp, and ring-type is formed from 5 ' end 23bp-26bp and 75bp-78bp, from
5 ' end 26bp-30bp and 70bp-75bp form ring-type, ring-type are formed from 5 ' end 39bp-41bp and 57bp-60bp, from 5 ' ends
45bp-53bp forms ring-type, other base pairings form loop-stem structure.
The secondary structure formula of the sequence of potato stu-miR5992b is：Ring is formed from 5 ' end 3bp-6bp and 54bp-57bp
Shape, ring-type is formed from 5 ' end 16bp-18bp and 45bp-47bp, ring-type is formed from 5 ' end 19bp-23bp and 40bp-44bp, from 5 '
End 28bp-35bp forms ring-type, other base pairings form loop-stem structure.
The DNA sequence dna for encoding the sequence of above-mentioned potato stu-miR5992a is：
cttttattgtctgaagatgcaagtggaggaaacctgactgtagttcctattgttggaatgggcggtgcgggtaagac
aacactagctaaagcggtttacaatgatgagaag（Sequence table SEQ ID NO：3）.
The DNA sequence dna for encoding above-mentioned potato stu-miR5992b sequences is：
ttattatctgaagatgcaagtggaaaaaagttgactgtagtttctattgttggaatgggcggcgtgggtaagacaac
acttgctaaagcggtttacaatgatgagagggtg（Sequence table SEQ ID NO：4）.
Mature sequence common above-mentioned potato stu-miR5992a and stu-miR5992b is as follows：
aaagcgguuuacaaugaugag（Sequence table SEQ ID NO：5）.The common mature sequence is that stu-miR5992a is held from 5 '
One section of RNA sequence of 88bp-108bp；One section of RNA sequence that either stu-miR5992b sequences hold 85bp-105bp from 5 '.
Application of the precursor sequence of above-mentioned potato stu-miR5992a and stu-miR5992b in gene function is studied,
Stu-miR5992a and stu-miR5992b inhibits the table of target gene NAC classes transcription factor (PGSC0003DMG 400032555)
It reaches, the NAC classes transcription factor gene sequence such as sequence table SEQ ID NO：Shown in 6.
The application of above-mentioned potato stu-miR5992a and stu-miR5992b sequences in drought resisting genetically modified plants are cultivated.
Preferably, the genetically modified plants are potato（Solanum tuberosum）.
Preferably, SEQ ID NO are overexpressed in potato：1 miRNA inhibits SEQ ID NO：Described in 1
The transgenic potato with high drought-resistant ability is cultivated in the expression of miRNA.
It is had technical effect that using caused by above-mentioned technical proposal：The present invention provides a kind of potato stu-
MiR5992a and stu-miR5992b and its application.RLM-5 ' RACE survey inspection the result shows that stu-miR5992a and stu-
MiR5992b regulation and control NAC classes transcription factors (PGSC0003DMG400032555) are expressed, available for studying the NAC class transcription factors
The function of gene studies the physiological acoustic signals of plant when that is, by loss of expression or being overexpressed the NAC class transcription factors.Fluorescence
Quantitative PCR survey inspection the result shows that, the expression of stu-miR5992a and stu-miR5992b are regulated and controled by drought stress, illustrate it in horse
Bell potato adapts to play an important role in drought stress, can cultivate the transgenic potato with high drought-resistant ability using it, right
Potato yield is improved to be of great significance.
Description of the drawings
Fig. 1 is the secondary structure figure of potato stu-miR5992a of the present invention.
Fig. 2 is the secondary structure figure of potato stu-miR5992b of the present invention.
Fig. 3 is potato target gene degradation electrophoretogram of the present invention.
Fig. 4 is potato target gene degradation group sequencer map of the present invention.
Fig. 5 is the quantitative fluorescent PCR figure of potato stu-miR5992a and stu-miR5992b of the present invention.
Specific embodiment
To make the object, technical solutions and advantages of the present invention clearer, specific embodiment is carried out specifically below
It is bright.What embodiments of the present invention were merely exemplary, and the present invention is not limited to these embodiments.
Here, it should also be noted that, in order to avoid because having obscured the present invention during unnecessary details, following embodiment is only
The structure and/or processing step closely related with scheme according to the present invention are illustrated only, and little other of relation are omitted
Details.Also, various raw materials used in the present invention and items of equipment are conventional commercial product, can be purchased by market
It buys and directly obtains；All quantitative tests, which are respectively provided with, to be repeated to test three times, and results are averaged.
Embodiment one：The confirmation of stu-miR5992a and stu-miR5992b and target-gene sequence
The sequence of potato stu-miR5992a is as follows（Listed nucleotide sequence is 5 ' → 3 ' in the present invention）：
cuuuuauugucugaagaugcaaguggaggaaaccugacuguaguuccuauuguuggaaugggcggugcggguaagac
aacacuagcuaaagcgguuuacaaugaugagaag （Sequence table SEQ ID NO：1）.
The sequence of potato stu-miR5992b is as follows：
uuauuaucugaagaugcaaguggaaaaaaguugacuguaguuucu
auuguuggaaugggcggcguggguaagacaacacuugcuaaagcgguuuacaaugaugagagggug（Sequence
List SEQ ID NO：2）.
As shown in Figure 1, the secondary structure formula of the sequence of potato stu-miR5992a is：From 5 ' end 11bp-17bp and
84bp-90bp forms ring-type, and ring-type is formed from 5 ' end 18bp-20bp and 81bp-83bp, from 5 ' end 23bp-26bp and 75bp-
78bp forms ring-type, and ring-type is formed from 5 ' end 26bp-30bp and 70bp-75bp, from 5 ' end 39bp-41bp and 57bp-60bp shapes
Circlewise, ring-type is formed from 5 ' end 45bp-53bp, other base pairings form loop-stem structure.
As shown in Figure 2, the secondary structure formula of the sequence of potato stu-miR5992b is：From 5 ' end 3bp-6bp and
54bp-57bp forms ring-type, and ring-type is formed from 5 ' end 16bp-18bp and 45bp-47bp, from 5 ' end 19bp-23bp and 40bp-
44bp forms ring-type, forms ring-type from 5 ' end 28bp-35bp, other base pairings form loop-stem structure.
The DNA sequence dna for encoding the sequence of above-mentioned potato stu-miR5992a is：
cttttattgtctgaagatgcaagtggaggaaacctgactgtagttcctattgttggaatgggcggtgcgggtaagac
aacactagctaaagcggtttacaatgatgagaag（Sequence table SEQ ID NO：3）.
The DNA sequence dna for encoding the sequence of above-mentioned potato stu-miR5992b is：
ttattatctgaagatgcaagtggaaaaaagttgactgtagtttctattgttggaatgggcggcgtgggtaagacaac
acttgctaaagcggtttacaatgatgagagggtg（Sequence table SEQ ID NO：4）.
The common mature sequence of above-mentioned potato stu-miR5992a and stu-miR5992b is as follows：
aaagcgguuuacaaugaugag（Sequence table SEQ ID NO：5）.The common mature sequence is that stu-miR5992a is held from 5 '
One section of RNA sequence of 88bp-108bp；One section of RNA sequence that either stu-miR5992b sequences hold 85bp-105bp from 5 '.
Application of the precursor sequence of above-mentioned potato stu-miR5992a and stu-miR5992b in gene function is studied,
Stu-miR5992a and stu-miR5992b inhibits the table of target gene NAC classes transcription factor (PGSC0003DMG 400032555)
It reaches, the NAC classes transcription factor gene sequence such as sequence table SEQ ID NO：Shown in 6.
Embodiment two：The preparation of stu-miR5992a and stu-miR5992b
1st, Potatoes are handled
The potato wedge in complete potato cultivar uniform in size " pale reddish brown white " and " Atlantic Ocean " is chosen, then by whole potato basin
Plantation is planted is cultivated in Standard greenhouse；Six basins of each parallel plantation of kind, when plant grows to 20 centimetres or so, Mei Gepin
Random 3 basin of selection of kind carries out Osmotic treatment, and remaining 3 basin waters and makes its normal growth on time.After January is handled.It adopts respectively
Collect potato Osmotic treatment and the fresh blade of adjoining tree, and it is quick-frozen in liquid nitrogen immediately, it is stored in 80 DEG C of refrigerators.
2nd, sample Total RNAs extraction and detection
（1）By the potato leaf of sampling in liquid nitrogen quick grind into powder, will about before liquid nitrogen not yet volatilizees
The powder of 100 mg is transferred to immediately in the processed 1.5ml centrifuge tubes of DEPC of precooling, rapidly joins the Trizol solution of 1ml,
It is vortexed after shaking abundant mixing and is placed at room temperature for 5~10min, nucleic acid is made to be kept completely separate with nucleoprotein.
（2）4 DEG C, 12000 r min-110 min are centrifuged, careful that supernatant is transferred to another DEPC is processed
In 1.5 ml centrifuge tubes.
（3）The chloroform of 200 μ l is added in, vortex oscillation mixing is placed at room temperature for 5min.
（4）4 DEG C, 12000 r min-1After centrifuging 10 min, careful is transferred to upper strata aqueous phase at another DEPC
In the 1.5ml centrifuge tubes managed, make sure to keep in mind not draw intermediate organic phase.
（5）The isopropanol of same volume is added in after separation, abundant mixing is then at being placed at room temperature for 15 min.
（6）4 DEG C, 12000 r min-110 min are centrifuged, supernatant is discarded, can obtain RNA precipitate；
（7）75% ethyl alcohol is added in the ratio of 2 75% ethyl alcohol of ml/ml Trizol（DEPC water dilutes）, gentle vibration
Centrifuge tube, washing precipitation（It is repeated once）.
（8）4 DEG C, 12000 r min-15 min are centrifuged, discard supernatant, precipitation can't be poured out.
（9）It is placed at room temperature for 5 ~ 10 min natural dryings, note：RNA sample not dried too, otherwise be difficult again completely molten
Solution.
（10）With 40 ddHs of the μ l without RNase2O dissolves RNA precipitate, 55 ~ 60 DEG C of 5 ~ 10 min of water bath processing.It will dissolving
Good RNA is sub-packed in centrifuge tubes of 1.5 mL without Rnase, is placed in -80 DEG C of ultra low temperature freezers and is preserved.
（11）The detection of RNA sample：Agarose gel electrophoresis analyzes RNA palliating degradation degrees and whether has pollution；
Nanodrop detects the purity of RNA（OD260/280Ratio）；Qubit carries out accurate quantification to RNA concentration；2100 essences of Agilent
The really integrality of detection RNA.
3rd, the structure in miRNA libraries and sequencing
The RNA of extraction after qualification, builds smRNA libraries using small RNA Sample Pre Kit respectively after testing,
Utilize the special construction at the 3 ' of smRNA and 5 ' ends（There is hydroxyl at the 5 ' complete phosphate groups in end, 3 ' ends）, existed using RNA ligase
Reverse transcription primer is added, extra 3 ' connector is prevented to be connected with 5 ' connectors, reduces connector plus connector in the ends of smRNA 3 ' after purification
From connect product object；Again plus 5 ' connectors, addition reverse transcriptase by above-mentioned smRNA reverse transcriptions into cDNA.Then with PCR amplification, Ran Houkuo
Increase production object and target fragment is separated by electrophoresis with PAGE glue, gel extraction obtains being cDNA library.Exist using this cDNA library as template
PCR amplification sequencings are carried out in Illumina sequenators.MiRNA separation, library construction and high-flux sequence application Illumina
2500 sequenators of HiSeq are completed.
4th, sequencing data analysis and miRNA screenings
The sequence for obtaining 50 nt or so will be sequenced through removing the reads of low-quality reads, removal 5 ' connectors pollution, going
Except the reads without the 3 ' joint sequences and reads containing polyA, clean reads data are obtained.By clean reads
It is compared with genbank and Rfam databases and reference gene group, obtains the annotation information of different sRNA.Then sequence is carried out
Common sequence statistical analysis between row distribution of lengths statistics and sample, miRNA are concentrated mainly on the scope of 20-24 nt.Except note
All miRNA segments released choose the remaining prediction identified with new miRNA for not annotating miRNA known to the progress of miRNA segments
Analysis.
MiRNA transcription initiation sites multidigit on the reverse complementary sequence of intergenic region, introne and coded sequence,
Its precursor has significant hairpin structure, and the formation of ripe body is realized by the shearing of Dicer enzymes.For the life of miRNA
Object feature for comparing to the sequence in reference gene group, carries out known and new miRNA using miRDeep2 softwares and identifies.
Due to different plant species, miRNA percentages are also variant in each length, still carry out classification system by condition of length
Meter.
Precursor miRNA (pre-miRNAs) is under Exportin-5 helps outside transporte to cells core, by cytoplasm Dicer enzymes
It is handled, becomes ripe miRNAs after digestion, the specificity of restriction enzyme site causes miRNA maturation body sequences first place base-pair
There is very strong skewed popularity in base U, in addition other sites also there are some statistics, such as：2 ~ No. 4 positions generally lack U, No. 10
It is partial to A in position (No. 10 position is usually shearing site when its target gene occurs for miRNA shear actions).
It is its most one of symbolic characteristic that can form hairpin structure for miRNA its precursor sequence.Pass through interception one
Measured length sRNA can compare sequence in the genome, using miRDeep2 softwares to its two level knot of the sequence of certain length
Structure, analysis Dicer restriction enzyme sites and calculate free energy, if it is possible to meet the requirement of miRNA, then in potato candidate it is new
miRNA.Standard, which should specifically be accorded with, is：(1) sequence of the certain length of interception can be folded into the two level knot of a hairpin structure
Structure；(2) mature sequence of miRNA should be on the one arm of hairpin structure；(3) on miRNAs mature sequences and another arm
The mispairing of miRNA* sequences should be less than 6 bases；(4) miRNAs mature sequences and miRNA* sequences cannot form cyclic structure
Or it is broken；(5) secondary structure has a relatively low MFEs values and higher MFEIs values, and the content of A+U should high containing with C+G
Amount.
Pass through RNA synthetic technologys, such as MALDI-TOF (matrix-assisted laser desorption
Ionization-time-offlight) synthesize, and pass through HPLC and purity analysis is carried out to product RNA, can obtain described
Stu-miR5992a and stu-miR5992b products.
Embodiment three：The application of stu-miR5992a and stu-miR5992b
1st, miRNA microRNA target predictions
Using stu-miR5992a and stu-miR5992b and potato gene mRNA sequence message file, pass through
TargetFinder softwares carry out microRNA target prediction.MiRNA microRNA target prediction rules are：
(1) mispairing between sRNA and target gene must not exceed 4 (0.5 mispairing is thought in G-U pairings)；
(2) in miRNA/ target gene complexs, the mispairing that adjacent sites occur at 2 must not be had more than；
(3) in miRNA/ target gene complexs, the 2nd ~ 12 site must not have adjacent sites from the 5 ' ends of miRNA
Mispairing all occurs；
(4) mispairing must not occur for the 10th ~ 11 site of miRNA/ target genes complex；
(5) in miRNA/ target gene complexs, the 1st ~ 12 site must not have more than 2.5 from the 5 ' ends of miRNA
Mispairing；
(6) the minimum free energy (MFE) of miRNA/ target genes complex should be not less than the miRNA and its optimal complement
With reference to when MFE 75%.
2nd, using the target gene of RLM-5 ' RACE verifications stu-miR5992a and stu-miR5992b
（1）The connection of 5 ' end connectors
RLM-5 ' RACE reactions are carried out using the GeneRaeer kits of Invitrogen companies.Connected first with T4 RNA
Enzyme is connect by one section of RNA joint sequences (GCUGAUGGCGAUGAAUGAACACUGCGUUUGCUGGCUUUGAUG
AAA 5 ' the end of total serum IgE of 100ng) is connected directly between, prepares reaction solution on ice, abundant mixing, of short duration centrifugation,
Then when 37 DEG C of hatchings 1 are small, cDNA is synthesized for reverse transcription.Connector reaction system is：Total serum IgE 2 μ L, 5 ' RACE Adapter
1 μ L, 10 × RNA Ligase buffer, 1 μ L, T4 RNA Ligase (2.5U/ μ L) 2 μ L, Nuclease-free
Wate 4 μL。
（2）Reverse transcription synthesizes the first chains of cDNA
The 2 μ L of reaction solution for having connected 5 ' end connectors is taken to carry out reverse transcription, reverse transcription reaction system is：Ligated RNA 2
2 μ L, RNase Inhibitor of μ L, dNTP Mix 4 μ L, Random Decamers, 2 μ L, 10X RT Buffer, 1 μ
1 μ L, Nuclease-free Water To of L, M-MLV Reverse Transcriptase, 20 μ L.
Abundant mixing, of short duration centrifugation, when then 42 DEG C of hatchings 1 are small, the reverse transcription product of acquisition is used for nested PCR amplification
Reaction.
（3）Nest-type PRC reaction amplification
Using the product of previous step reverse transcription as masterplate, the special external primers of target gene and the external primers of connector are utilized
The first step for carrying out 5 ' RACE nest-type PRCs is reacted, and the external primers of gene external primers and connector are：
CAAGGCTCATTACAGGCCACC and CTGAACCTCCTTGTCACATGGC, reaction solution are prepared on ice, and reaction system is：RT
5 μ L, dNTP Mix of reaction (from the previous step) 1 μ L, 10X PCR Buffer 4 μ L, 5 '
2 μ 2 μ L of L, 5 ' RACE Outer Primer of RACE gene-specific outer primer (10 μM),
50 μ L, thermostable DNA polymerase of Nuclease-free Water To (0.25 μ L of 5U/ μ L)
1.25U
Response procedures are：
Pre-degeneration： 94 ℃ 3min；
Amplification：94 DEG C of 30 s, 60 DEG C of 30 sec, 72 DEG C of 30 sec（35 Xun Huans）；
Extension： 72℃ 7 min.
The product reacted by the use of the nest-type PRC first step is as template, in target gene special internal primer and connector
The second step that portion's primer carries out nest-type PRC reacts, and the internal primer of gene internal primer and connector is：
CAAGGCTCATTACAGGCCACC and CTGAACCTCCTTGTCACATGGC, reaction system are：Outer PCR (from the
Previous step) 2 μ L, 10X PCR Buffer, 5 μ L, dNTP Mix 4 μ L, 5 ' RACE gene-specific
22 μ L, Nuclease-free Water To of μ L, 5 ' RACE inner Primer of innter primer (10 μM)
50 μ L, thermostable DNA polymerase (0.25 μ L of, 5 U/ μ L) 1.25U.Response procedures and nest-type PRC
First step reaction is identical.
（4）The connection of target fragment and carrier T
Amplified production is detected with 1% agarose gel electrophoresis, and testing result as shown in Figure 2, cuts target fragment day
The pillar DNA plastic recovery kits recycling of root biochemical corp, the specific method for purifying recycling are operated in strict accordance with specification.Recycling
Product is connected to pMD 18-T Vector, coupled reaction system：1 μ L, Solution I of pMD 18-T Vector, 4 μ L,
Recycle segment 4 μ L, ddH2O 1 μL
（5）The conversion and sequencing of connection product
Connection product is converted into bacillus coli DH 5 alpha competent cell, each target gene is chosen to 10 positive colonies and used
Solexa high throughput sequencing technologies are sequenced, and the result of sequencing is as shown in Figure 3（Arrow pointed location is miRNA degradation targets
The fracture position of gene）.
Illustrate that stu-miR5992a and stu-miR5992b can be by target gene NAC with reference to the result of attached drawing 3 and attached drawing 4
Class transcription factor (PGSC0003DMG400032555) mRNA specific cleavages, so that expression of target gene is lowered.
3rd, under drought stress stu-miR5992a and stu-miR5992b expression quantity analysis
The RNA reverse transcriptions of different drought processing stage are synthesized into cDNA respectively.With SYBR Premix Ex TaqII
Quantitative fluorescent PCR（qRT-PCR）Kit detects expression of the target gene in different drought processing stage, with elongation factors
（ef1a）For gene as internal reference, reaction system is as follows：SYBR® Premix Ex TaqTM II（2×）10 μ L, qGUS-1
（10 μM）0.8 μ L, qGUS-2（10 μM）0.8 μ L, ROX Reference Dye II（50×）0.4 μ L, RT reaction solutions
1 μ L, ddH2O 7 μL。
QRT-PCR reaction conditions are：
95 DEG C of 10 min of pre-degeneration
95 DEG C of 15 sec of denaturation
60 DEG C of 1 min, 40 Xun Huans
72℃ 30 sec
Calculation formula：Using formula RQ (relative expression quantity)=2–∆∆CtRelative expression quantity after calculating before treatment,
Ct=（Ct processing sample-Ct ef1a）-（Ct control sample-Ct ef1a）.Primer sequence is：
CGAAAGCGGUUUACAAUGAUGAG and Uni-miR qPCR Primer（TaKaRa RR717）.
This research identifies the relevant new miRNA (unconservative_ST4.03ch11_ of potato arid
2997600/3000428) targeting is in NAC classes transcription factor (PGSC0003DMG400032555), under drought stress
MiRNA (stu-miR5992a and stu-miR5992b), which lowers expression, will cause its target gene NAC class transcription factors
(PGSC0003DMG400032555) up-regulation of expression quantity will enhance tolerance of the plant to arid.As shown in Figure 5, this hair
It is bright that the drought-enduring type product of miRNA (stu-miR5992a and stu-miR5992b) potato are shown by quantitative fluorescent PCR expression analysis
Expression, but arid responsive type kind Atlantic Ocean up-regulated expression again are lowered under the pale reddish brown white drought stress of kind.These results indicate that NAC
Transcription factor plays important regulating and controlling effect in the drought-resistant grade abiotic stresses of plant, especially poor to different cultivars drought-resistant ability
Different regulation and control will have potential application value in crop drought resistance breeding.Therefore, stu- is overexpressed in potato
MiR5992a and stu-miR5992b genes or inhibition stu-miR5992a and stu-miR5992b expression will be cultivated and provided
There is the potato transformed variety of high drought-resistant ability.
The above is only the specific embodiment of the application, is only proposed as the enforceable technical solution of the present invention；It should
It, for those skilled in the art, can also be to reality on the premise of the application principle is not departed from when pointing out
It tests step and makes several improvements and modifications, these improvements and modifications also should be regarded as the protection domain of the application.
<110>Gansu Agriculture University
<120>Potato stu-miR5992a and stu-miR5992b and its application
<160> 6
<210> 1
<211> 111
<212> RNA
<213>Potato（solanum tuberosum）
<400> 1
cuuuuauugu cugaagaugc aaguggagga aaccugacug uaguuccuau uguuggaaug 60
ggcggugcgg guaagacaac acuagcuaaa gcgguuuaca augaugagaa g 111
<210> 2
<211> 114
<212> RNA
<213>Potato（solanum tuberosum）
<400> 2
uuauuau cugaagaugc aaguggaaaa aaguugacug uaguuucuau uguuggaaug 60
ggcggcgugg guaagacaac acuugcuaaa gcgguuuaca augaugagag ggug 114
<210> 3
<211> 111
<212> DNA
<213>Potato（solanum tuberosum）
<400> 3
cttttattgt ctgaagatgc aagtggagga aacctgactg tagttcctat tgttggaatg 60
ggcggtgcgg gtaagacaac actagctaaa gcggtttaca atgatgagaa g 111
<210> 4
<211> 114
<212> DNA
<213>Potato（solanum tuberosum）
<400> 4
ttattat ctgaagatgc aagtggaaaa aagttgactg tagtttctat tgttggaatg 60
ggcggcgtgg gtaagacaac acttgctaaa gcggtttaca atgatgagag ggtg 114
<210> 5
<211> 21
<212> RNA
<213>Potato（solanum tuberosum）
<400> 5
aaagcgguuu acaaugauga g 21
<210> 6
<211> 1316
<212> RNA
<213>Potato（solanum tuberosum）
<400> 6
caactgaaac taacaaagca gcagcagcag cagcagaaac agcaacaaac agaggaagat 60
aaacagagga aattaagagg gagatttatc gaatcgaatc aaaagggaaa gggaagttac 120
gaagagtgag aatttgaagg aaatgaacaa aggagcaacc ggaaatcagc aattggagtt 180
accggcggga ttcagattcc atccgacaga cgacgaattg gtgcagcatt atctctgcag 240
gaaatgtgct ggacagccga ttgcagcatc aattataact gaaattgatc tttacaagtt 300
tgatccatgg cagttgcctg aaaaggcttt gtacggtgaa aaggagtggt attttttctc 360
accaagggat agaaaatatc cgaacggttc acgaccgaac cgagcagcag gaaccggtta 420
ttggaaggca accggagcag ataaaccggt gggaaaaccc aaaacgttag ggataaagaa 480
ggcacttgtg ttctatgctg gaaaagcacc tagaggaata aaaaccaatt ggattatgca 540
cgagtacagg ctcgccaatg tggaccgctc tgctggcaag aacaataact tgaggcttga 600
tgattgggta ttgtgtcgaa tttacaacaa gaaaggcaca cttgagaagc attacaatgt 660
ggacaacaag gaaactgcaa gctttggaga atttgatgaa gaaataaaac caaaaatatt 720
gcccacacaa ttagcacaga tgccaccacg gccccgatcg acaccgacac cgacaaacga 780
ctacttccat ttcgaatcat cggagtcaat gactagaatg cacaccacaa actcgagctc 840
tggctcagag catgtcttgt cgccatgtga caaggaggtt cagagcgcgc ccaaatggga 900
cgaagaccac agaaacaccc ttgattttca gctaaattat ttggatggtt tactaaatga 960
accatttgaa acccaaatgc agcagcaaat ttgcaacttt gaccagttca acaatttcca 1020
agacatgttc ttttacatgc aaaaacctta ctaaaattgt ataaattcat tggatctaaa 1080
ttgattgtga tccatgacat tttctttgtt ctttggtggt gtaggtcaac tttttattaa 1140
ttagtttaga aaagtacaaa atgcaagtca aatttggtgg cctgtaatga gccttgataa 1200
gcatagccaa agagtcatat agaagggctt attaatgtta ttattgtaag gaacatgtaa 1260
aacaaatgaa aatttgttaa tatcaagtta tcattcttca aatctctgtg attatg 1316
Claims (6)
1. potato stu-miR5992a and stu-miR5992b, it is characterised in that the sequence of the stu-miR5992a such as sequence
Table SEQ ID NO：Shown in 1；The sequence of the stu-miR5992b such as sequence table SEQ ID NO：Shown in 2.
2. potato stu-miR5992a and stu-miR5992b according to claim 1, it is characterised in that the stu-
The secondary structure of miR5992a sequences is：From 5 ' end 11bp-17bp and 84bp-90bp form ring-type, from 5 ' end 18bp-20bp and
81bp-83bp forms ring-type, and ring-type is formed from 5 ' end 23bp-26bp and 75bp-78bp, from 5 ' end 26bp-30bp and 70bp-
75bp forms ring-type, and ring-type is formed from 5 ' end 39bp-41bp and 57bp-60bp, and ring-type is formed from 5 ' end 45bp-53bp, other
Base pairing forms loop-stem structure；The secondary structure of the stu-miR5992b sequences is：From 5 ' end 3bp-6bp and 54bp-
57bp forms ring-type, and ring-type is formed from 5 ' end 16bp-18bp and 45bp-47bp, from 5 ' end 19bp-23bp and 40bp-44bp shapes
Circlewise, ring-type is formed from 5 ' end 28bp-35bp, other base pairings form loop-stem structure.
3. potato stu-miR5992a and stu-miR5992b according to claim 1, it is characterised in that described in coding
The DNA sequence dna of stu-miR5992a sequences such as sequence table SEQ ID NO：Shown in 3；Encode the stu-miR5992b sequences
DNA sequence dna such as sequence table SEQ ID NO：Shown in 4.
4. potato stu-miR5992a and stu-miR5992b according to claim 1, it is characterised in that the stu-
Mature sequence common miR5992a and stu-miR5992b such as sequence table SEQ ID NO：Shown in 5.
5. potato stu-miR5992a and stu-miR5992b according to claim 4, it is characterised in that the stu-
Mature sequence common miR5992a and stu-miR5992b is one section from 5 ' end 88bp-108bp of stu-miR5992a sequences
RNA sequence；One section of RNA sequence that either stu-miR5992b sequences hold 85bp-105bp from 5 '.
6. potato stu-miR5992a and stu-miR5992b described in claim 1 is in drought resisting transgenic potato is cultivated
Application.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610208514.5A CN105647928B (en) | 2016-04-06 | 2016-04-06 | Potato stu-miR5992a and stu-miR5992b and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610208514.5A CN105647928B (en) | 2016-04-06 | 2016-04-06 | Potato stu-miR5992a and stu-miR5992b and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105647928A CN105647928A (en) | 2016-06-08 |
| CN105647928B true CN105647928B (en) | 2018-05-29 |
Family
ID=56497115
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610208514.5A Expired - Fee Related CN105647928B (en) | 2016-04-06 | 2016-04-06 | Potato stu-miR5992a and stu-miR5992b and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105647928B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020005667A1 (en) * | 2018-06-29 | 2020-01-02 | Pioneer Hi-Bred International, Inc. | Compositions and methods for editing an endogenous nac gene in plants |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101906155A (en) * | 2010-04-09 | 2010-12-08 | 北京市农林科学院 | Protein ErNAC7 related to drought and salt resistance of plants and coding gene and application thereof |
| CN101939435A (en) * | 2007-09-21 | 2011-01-05 | 巴斯夫植物科学有限公司 | Plants with increased yield |
-
2016
- 2016-04-06 CN CN201610208514.5A patent/CN105647928B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101939435A (en) * | 2007-09-21 | 2011-01-05 | 巴斯夫植物科学有限公司 | Plants with increased yield |
| CN101906155A (en) * | 2010-04-09 | 2010-12-08 | 北京市农林科学院 | Protein ErNAC7 related to drought and salt resistance of plants and coding gene and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| 《Identification of Novel and Conserved MicroRNAs Related to Drought Stress in Potato by Deep Sequencing》;Ning Zhang等;《PLoS ONE》;20140418;第9卷(第4期);全文 * |
| 《不同马铃薯品种根系提水能力与抗旱性研究》;李亚杰;《中国优秀硕士学位论文全文数据库农业科技辑》;20140415(第4期);全文 * |
| 《马铃薯抗旱相关microRNA的鉴定及分析》;马骢毓;《中国优秀硕士学位论文全文数据库农业科技辑》;20130115(第1期);全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105647928A (en) | 2016-06-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Yu et al. | Identification of differentially expressed microRNA in the stems and leaves during sugar accumulation in sweet sorghum | |
| US11525142B2 (en) | Zea mays NLP transcription factor ZmNLP5 and use thereof | |
| CN113337633B (en) | Comparative transcriptional analysis method for differential expression of peanut leaf genes under intercropping corn | |
| Wang et al. | Specific downregulation of the bacterial-type PEPC gene by artificial microRNA improves salt tolerance in Arabidopsis | |
| CN105647928B (en) | Potato stu-miR5992a and stu-miR5992b and its application | |
| Tahir et al. | Different miRNAs and hormones are involved in PEG-induced inhibition of adventitious root formation in apple | |
| CN108048469A (en) | The Ravenna grass class Calmodulin Gene ErCML30 expressed in Ravenna grass wild species by low temperature stress | |
| CN105647929B (en) | Potato stu-miR4322 and its screening technique and application | |
| CN107266544A (en) | The application of protein s iNADP ME3 and its encoding gene in regulation and control stress resistance of plant | |
| CN101605901B (en) | miRNA of plant, chip and the uses thereof | |
| Chen et al. | Integration of small RNA, degradome, and transcriptome sequencing data illustrates the mechanism of low phosphorus adaptation in Camellia oleifera | |
| CN101029314B (en) | Corn starch branching enzyme gene sirna expression carrier | |
| Wang et al. | Origin and evolution of MIR1444 genes in Salicaceae | |
| CN105647927A (en) | Potato stu-miR156 member and application thereof | |
| CN105695469B (en) | Potato stu-miR9471 and its application | |
| CN105647926B (en) | Application of the potato stu-miR8045 in degradation ubiquitin binding enzyme | |
| CN106222171B (en) | Method for improving soybean yield by using RNAi technology | |
| CN105802968B (en) | Potato stu-miR9255 and its application | |
| CN108728569A (en) | A kind of okra reference gene and its application | |
| CN107177608A (en) | The Thadh4 genes of the resistance to water logging characteristic of mountain China fir and its application in a kind of regulation and control | |
| CN110791503B (en) | Low-phosphorus inducible promoter and application thereof | |
| Su et al. | Response adaptive mechanisms of three mangrove (Avicennia marina, Aegiceras corniculatum, and Bruguiera gymnorrhiza) plants to waterlogging stress revealed by transcriptome analysis | |
| CN105732785B (en) | Application of protein GhDHN1 in regulation and control of plant stress resistance | |
| CN108841842B (en) | Festuca arundinacea gene EfWRKY62 expressed by wild species of the saccharum arundinacea under low temperature stress | |
| CN113584024B (en) | Malus xiaojinensis Mx-miR175-5p gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20180529 Termination date: 20210406 |