CN105802968B - Potato stu-miR9255 and its application - Google Patents

Potato stu-miR9255 and its application Download PDF

Info

Publication number
CN105802968B
CN105802968B CN201610230141.1A CN201610230141A CN105802968B CN 105802968 B CN105802968 B CN 105802968B CN 201610230141 A CN201610230141 A CN 201610230141A CN 105802968 B CN105802968 B CN 105802968B
Authority
CN
China
Prior art keywords
mir9255
stu
potato
sequence
target gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN201610230141.1A
Other languages
Chinese (zh)
Other versions
CN105802968A (en
Inventor
杨江伟
张宁
司怀军
周香艳
文义凯
唐勋
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Gansu Agricultural University
Original Assignee
Gansu Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Gansu Agricultural University filed Critical Gansu Agricultural University
Priority to CN201610230141.1A priority Critical patent/CN105802968B/en
Publication of CN105802968A publication Critical patent/CN105802968A/en
Application granted granted Critical
Publication of CN105802968B publication Critical patent/CN105802968B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C12N2310/141—MicroRNAs, miRNAs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/50—Physical structure
    • C12N2310/53—Physical structure partially self-complementary or closed
    • C12N2310/531—Stem-loop; Hairpin

Abstract

The present invention provides a kind of potato stu miR9255 and its applications.5 ' RACE of RLM survey inspection the result shows that stu miR9255 regulation and control julienne potatoes propylhomoserin/threonine kinases receptors gene (PGSC0003DMG 400019726), available for studying the function of the serine/threonine kinase acceptor gene, i.e., the physiological acoustic signals of plant are studied when by loss of expression or being overexpressed the serine/threonine kinase receptor.Quantitative fluorescent PCR survey inspection the result shows that, the expression of stu miR9255 is regulated and controled by drought stress, illustrate that it adapts to play an important role in drought stress in potato, the transgenic potato with high drought-resistant ability can be cultivated using it, be of great significance to improving potato yield.

Description

Potato stu-miR9255 and its application
Technical field
Patent of the present invention is related to a kind of microRNA（miRNA）And its application, specifically potato stu-miR9255 And its application.
Background technology
MiRNA is the single-stranded microRNA of a kind of non-coding, is about the endogenous non-protein coding RNA of 20 nt.miRNA Gene, which is initially transcribed, generates the pre-miRNAs with loop-stem structure.Subsequent pre-miRNA is transported out core, the quilt in cytoplasm Dicer enzyme effects are processed into ripe miRNA.It is combined by sequence complementation with the mRNA of specific target gene, usually after transcription Level causes mRNA to degrade or inhibits mRNA translations so as to play down regulation to the expression of gene.
Drought stress is one of most important abiotic stress, and the growth and development and yield to crops cause extremely tight The influence of weight.According to statistics, the 36% of the total land area arid or half-dried early region for belonging to water shortage, China's arid and half on the earth Dry morning region accounts about the 1/2 of state's land area.It even if, also would generally be by season in the agriculture main producing region of semi-moist and moistening Property and periodic drought invasion.Influence of the drought stress to crop yield, quality is equivalent to the sum of remaining natural calamity, Harmfulness account for the first in various natural environment stresses, is only second to pest and disease damage and is lost caused by crop.Solve Arid Problem Approach other than utilization ratio of the water-saving irrigation to improve moisture, exactly cultivates the new varieties of saving water, resisting drought to improve crop Itself resist the ability of arid.Reach this purpose, it is necessary to understand the molecular mechanism of Crop responses drought stress.Therefore, it is right The research of crop drought resistance mechanism improves the research hotspot problem that crop drought resistance ability is scientists from all over the world's concern to explore.Especially In recent years to the further investigation of arabidopsis, rice isotype plant, identify, cloned a large amount of drought-enduring relevant genes, ground Study carefully the regulation and control model for having understood the relevant gene of some salt tolerants.Drought resisting, resistant gene of salt are integrated by the means of genetic engineering In target plant genome or it is purposive inhibition or the expression of some drought related genes is induced to obtain transfer-gen plant, open The new way for cultivating height drought resistance New Crop Varieties is warded off.With the understanding to Drought Resistance Mechanism in Plants and transgenic technology It reaches its maturity, the new varieties of the breeding material of drought resisting or genetic improvement is obtained using transgenic technology, it has also become drought-resistant variety Cultivate most potential direction.
Plant Receptor-like protein ki-nase（Receptor- like protein kinases, RLKs）It is to swash with inherent The signal transduction substance of enzymatic activity, its this crucial regulating and controlling effect in plant stress-resistance signal transduction path.Dure（2010） 2 RLK genes are found that in tobacco（NtLRR1 and NtLRR2）Participate in salt stress response regulatory process.Esspelund etc. （1992）Also research finds that RLK7 plays important regulation and control work in seed sprouting and oxidative stress tolerance in arabidopsis With effect.Guo Peng etc.（2011）Also research finds to be overexpressed the LRR-RLK gene PdERECTA of willow, transgenosis in arabidopsis Strain significantly improves the utilization ratio of moisture.
Invention content
The technical problems to be solved by the invention are to provide the precursor sequence of potato stu-miR9255, stu-miR9255 Inhibit expression of target gene to study the application of target gene function, stu-miR9255 inhibition expression of target gene raising plant drought energy Power cultivates the application of drought resistant plant variety.
In order to solve the above technical problems, the technical solution adopted in the present invention is as follows：
The precursor sequence of potato stu-miR9255 is as follows（Listed nucleotide sequence is 5 ' → 3 ' in the present invention）： acauauccaagacccccuuuucugauugacuugugguuuucacauuccuuuucugucauauacacagcccauccaaa aaaggaaugugaaaaccacaagccaaucagaaaa（Sequence table SEQ ID NO：1）.
The secondary structure formula of the precursor sequence of potato stu-miR9255 is：From 5 ' end 8bp-10bp and 80bp-82bp shapes Circlewise, ring-type is formed from 5 ' end 33bp-34bp and 48bp-58bp, ring-type is formed from 5 ' end 37bp-45bp；Other bases are matched To forming loop-stem structure.
The DNA sequence dna for encoding the precursor sequence of above-mentioned potato stu-miR9255 is： acatatccaagacccccttttctgattgacttgtggttttcacattccttttctgtcatatacacagcccatccaaa aaaggaatgtgaaaaccacaagccaatcagaaaa（Sequence table SEQ ID NO：2）.
The mature sequence of above-mentioned potato stu-miR9255 is as follows：ucugauugacuugugguuuuc（Sequence table SEQ ID NO：3）.The mature sequence of stu-miR9255 is one section RNA sequence of the precursor sequence from 5 ' end 21bp-41bp.
Application of the precursor sequence of above-mentioned potato stu-miR9255 in gene function is studied, stu-miR9255 inhibit The expression of target gene serine/threonine kinase acceptor gene (PGSC0003DMG 400019726), the serine/Soviet Union's ammonia Acid kinase receptor gene sequence such as sequence table SEQ ID NO：Shown in 4.
Application of the precursor sequence of above-mentioned potato stu-miR9255 in drought resisting genetically modified plants are cultivated.
Preferably, the genetically modified plants are potato（Solanum tuberosum）.
Preferably, SEQ ID NO are overexpressed in potato：1 miRNA inhibits SEQ ID NO：Described in 1 The transgenic potato with high drought-resistant ability is cultivated in the expression of miRNA.
It is had technical effect that using caused by above-mentioned technical proposal：The present invention provides a kind of potato stu- MiR9255 and its application.RLM-5 ' RACE survey inspection the result shows that stu-miR9255 regulates and controls serine/threonine kinase receptor base Because of (PGSC0003DMG400019726), available for studying the function of the serine/threonine kinase acceptor gene, i.e., by lacking It loses expression or the physiological acoustic signals of plant is studied when being overexpressed the serine/threonine kinase receptor.Quantitative fluorescent PCR surveys inspection The result shows that the expression of stu-miR9255 is regulated and controled by drought stress, it is important to illustrate that it is played in potato adapts to drought stress Effect, can cultivate the transgenic potato with high drought-resistant ability using it, be of great significance to improving potato yield.
Description of the drawings
Fig. 1 is the secondary structure figure of potato stu-miR9255 of the present invention.
Fig. 2 is potato target gene degradation electrophoretogram of the present invention.
Fig. 3 is potato target gene degradation group sequencer map of the present invention.
Fig. 4 is the quantitative fluorescent PCR figure of potato stu-miR9255 of the present invention.
Specific embodiment
To make the object, technical solutions and advantages of the present invention clearer, specific embodiment is carried out specifically below It is bright.Embodiments of the present invention are only exemplary, and the present invention is not limited to these embodiments.
Here, it should also be noted that, in order to avoid because having obscured the present invention during unnecessary details, following embodiment is only The structure and/or processing step closely related with scheme according to the present invention are illustrated only, and little other of relationship are omitted Details.Also, various raw materials used in the present invention and items of equipment are conventional commercial product, can be purchased by market It buys and directly obtains；All quantitative tests, which are respectively provided with, to be repeated to test three times, and results are averaged.
Embodiment one：The confirmation of stu-miR9255 and target-gene sequence
The precursor sequence of potato stu-miR9255 is as follows（Listed nucleotide sequence is 5 ' → 3 ' in the present invention）： acauauccaagacccccuuuucugauugacuugugguuuucacauuccuuuucugucauauacacagcccauccaaa aaaggaaugugaaaaccacaagccaaucagaaaa（Sequence table SEQ ID NO：1）.
The secondary structure formula of the precursor sequence of potato stu-miR9255 is：From 5 ' end 8bp-10bp and 80bp-82bp shapes Circlewise, ring-type is formed from 5 ' end 33bp-34bp and 48bp-58bp, ring-type is formed from 5 ' end 37bp-45bp；Other bases are matched To forming loop-stem structure.
The DNA sequence dna for encoding the precursor sequence of above-mentioned potato stu-miR9255 is： acatatccaagacccccttttctgattgacttgtggttttcacattccttttctgtcatatacacagcccatccaaa aaaggaatgtgaaaaccacaagccaatcagaaaa（Sequence table SEQ ID NO：2）.
The mature sequence of above-mentioned potato stu-miR9255 is as follows：ucugauugacuugugguuuuc（Sequence table SEQ ID NO：3）.The mature sequence of stu-miR9255 is one section RNA sequence of the precursor sequence from 5 ' end 21bp-41bp.
Application of the precursor sequence of above-mentioned potato stu-miR9255 in gene function is studied, stu-miR9255 inhibit The expression of target gene serine/threonine kinase acceptor gene (PGSC0003DMG 400019726), the serine/Soviet Union's ammonia Acid kinase receptor gene sequence such as sequence table SEQ ID NO：Shown in 4.
Embodiment two：The preparation of stu-miR9255
1st, Potatoes are handled
The potato wedge in complete potato cultivar uniform in size " pale reddish brown white " and " Atlantic Ocean " is chosen, then by whole potato basin Plantation is planted is cultivated in Standard greenhouse；Six basins of each parallel plantation of kind, when plant grows to 20 centimetres or so, Mei Gepin Random 3 basin of selection of kind carries out Osmotic treatment, and remaining 3 basin waters and makes its normal growth on time.After January is handled.It adopts respectively Collect potato Osmotic treatment and the fresh blade of adjoining tree, and quick-frozen in liquid nitrogen immediately, be stored in 80 DEG C of refrigerators.
2nd, sample Total RNAs extraction and detection
（1）By the potato leaf of sampling in liquid nitrogen quick grind into powder, will about before liquid nitrogen not yet volatilizees The powder of 100 mg is transferred to immediately in the processed 1.5ml centrifuge tubes of DEPC of precooling, rapidly joins the Trizol solution of 1ml, It is vortexed after shaking abundant mixing and is placed at room temperature for 5~10min, nucleic acid is made to be kept completely separate with nucleoprotein.
（2）4 DEG C, 12000 r min-110 min are centrifuged, careful that supernatant is transferred to another DEPC is processed 1.5 in ml centrifuge tubes.
（3）The chloroform of 200 μ l is added in, vortex oscillation mixing is placed at room temperature for 5min.
（4）4 DEG C, 12000 r min-1After centrifuging 10 min, careful is transferred to upper strata aqueous phase at another DEPC In the 1.5ml centrifuge tubes managed, make sure to keep in mind not draw intermediate organic phase.
（5）The isopropanol of same volume is added in after separation, abundant mixing is then at being placed at room temperature for 15 min.
（6）4 DEG C, 12000 r min-110 min are centrifuged, supernatant is discarded, can obtain RNA precipitate；
（7）75% ethyl alcohol is added in the ratio of 2 75% ethyl alcohol of ml/ml Trizol（DEPC water dilutes）, gentle oscillation Centrifuge tube, washing precipitation（It is repeated once）.
（8）4 DEG C, 12000 r min-15 min are centrifuged, discard supernatant, precipitation can't be poured out.
（9）It is placed at room temperature for 5 ~ 10 min natural dryings, note：RNA sample not dried too, otherwise be difficult again completely molten Solution.
（10）With 40 ddHs of the μ l without RNase2O dissolves RNA precipitate, 55 ~ 60 DEG C of 5 ~ 10 min of water bath processing.It will dissolving Good RNA is sub-packed in centrifuge tubes of 1.5 mL without Rnase, is placed in -80 DEG C of ultra low temperature freezers and is preserved.
（11）The detection of RNA sample：Agarose gel electrophoresis analyzes RNA palliating degradation degrees and whether has pollution； Nanodrop detects the purity of RNA（OD260/280Ratio）；Qubit carries out accurate quantification to RNA concentration；2100 essences of Agilent The really integrality of detection RNA.
3rd, the structure in miRNA libraries and sequencing
The RNA of extraction after qualification, builds smRNA libraries using small RNA Sample Pre Kit respectively after testing, Utilize the special construction at the 3 ' of smRNA and 5 ' ends（There is hydroxyl at the 5 ' complete phosphate groups in end, 3 ' ends）, existed using RNA ligase Reverse transcription primer is added, prevents extra 3 ' connector from being connect with 5 ' connectors, reduces connector plus connector in the ends of smRNA 3 ' after purification From connect product object；Again plus 5 ' connectors, addition reverse transcriptase by above-mentioned smRNA reverse transcriptions into cDNA.Then with PCR amplification, Ran Houkuo Increase production object and target fragment is separated by electrophoresis with PAGE glue, gel extraction obtains being cDNA library.Exist using this cDNA library as template PCR amplification sequencings are carried out in Illumina sequenators.MiRNA separation, library construction and high-flux sequence application Illumina 2500 sequenators of HiSeq are completed.
4th, sequencing data analysis and miRNA screenings
The sequence for obtaining 50 nt or so will be sequenced through removing the reads of low-quality reads, removal 5 ' connectors pollution, going Except the reads without the 3 ' joint sequences and reads containing polyA, clean reads data are obtained.By clean reads It is compared with genbank and Rfam databases and reference gene group, obtains the annotation information of different sRNA.Then sequence is carried out Common sequence statistical analysis between row distribution of lengths statistics and sample, miRNA are concentrated mainly on the range of 20-24 nt.Except note All miRNA segments released choose the remaining prediction identified with new miRNA for not annotating miRNA known to the progress of miRNA segments Analysis.
MiRNA transcription initiation sites multidigit on the reverse complementary sequence of intergenic region, introne and coded sequence, Its precursor has significant hairpin structure, and the formation of ripe body is realized by the shearing of Dicer enzymes.For the life of miRNA Object feature for comparing to the sequence in reference gene group, carries out known and new miRNA using miRDeep2 softwares and identifies. Due to different plant species, miRNA percentages are also variant in each length, still carry out classification system by condition of length Meter.
Precursor miRNA (pre-miRNAs) is under Exportin-5 helps outside transporte to cells core, by cytoplasm Dicer enzymes It is handled, becomes ripe miRNAs after digestion, the specificity of restriction enzyme site causes miRNA maturation body sequences first place base-pair There is very strong skewed popularity in base U, in addition other sites are there are also statistics, such as：2 ~ No. 4 positions generally lack U, No. 10 It is partial to A in position (No. 10 position is usually shearing site when its target gene occurs for miRNA shear actions).
It is its most one of symbolic characteristic that can form hairpin structure for miRNA its precursor sequence.Pass through interception one Measured length sRNA can compare sequence in the genome, using miRDeep2 softwares to its two level knot of the sequence of certain length Structure, analysis Dicer restriction enzyme sites and calculate free energy, if it is possible to meet the requirement of miRNA, then be candidate new in potato miRNA.Standard, which should specifically be accorded with, is：(1) sequence of the certain length of interception can be folded into the two level knot of a hairpin structure Structure；(2) mature sequence of miRNA should be on the one arm of hairpin structure；(3) on miRNAs mature sequences and another arm The mispairing of miRNA* sequences should be less than 6 bases；(4) miRNAs mature sequences and miRNA* sequences cannot form cyclic structure Or it is broken；(5) secondary structure has a relatively low MFEs values and higher MFEIs values, and the content of A+U should high containing with C+G Amount.
Pass through RNA synthetic technologys, such as MALDI-TOF (matrix-assisted laser desorption Ionization-time-offlight it) synthesizes, and passes through HPLC and purity analysis is carried out to product RNA, can obtain described Stu-miR9255 products.
Embodiment three：The application of stu-miR9255
1st, miRNA microRNA target predictions
Using stu-miR9255 and potato gene mRNA sequence message file, carried out by TargetFinder softwares MicroRNA target prediction.MiRNA microRNA target prediction rules are：
(1) mispairing between sRNA and target gene must not exceed 4 (0.5 mispairing is thought in G-U pairings)；
(2) in miRNA/ target gene complexs, the mispairing that adjacent sites occur at 2 must not be had more than；
(3) in miRNA/ target gene complexs, the 2nd ~ 12 site must not have adjacent sites from the 5 ' ends of miRNA Mispairing all occurs；
(4) mispairing must not occur for the 10th ~ 11 site of miRNA/ target genes complex；
(5) in miRNA/ target gene complexs, the 1st ~ 12 site must not have more than 2.5 from the 5 ' ends of miRNA Mispairing；
(6) the minimum free energy (MFE) of miRNA/ target genes complex should be not less than the miRNA and its best complement With reference to when MFE 75%.
2nd, using the target gene of RLM-5 ' RACE verifications stu-miR9255
（1）The connection of 5 ' end connectors
RLM-5 ' RACE reactions are carried out using the GeneRaeer kits of Invitrogen companies.Connected first with T4 RNA Enzyme is connect by one section of RNA joint sequences (GCUGAUGGCGAUGAAUGAACACUGCGUUUGCUGGCUUUGAUG
AAA 5 ' the end of total serum IgE of 100ng) is connected directly between, prepares reaction solution on ice, abundant mixing, of short duration centrifugation, Then hatch 1 hour for 37 DEG C, cDNA is synthesized for reverse transcription.Connector reaction system is：Total serum IgE 2 μ L, 5 ' RACE Adapter 1 μ L, 10 × RNA Ligase buffer, 1 μ L, T4 RNA Ligase (2.5U/ μ L) 2 μ L, Nuclease-free Wate 4 μL。
（2）Reverse transcription synthesizes the first chains of cDNA
The 2 μ L of reaction solution for having connected 5 ' end connectors is taken to carry out reverse transcription, reverse transcription reaction system is：Ligated RNA 2 2 μ L, RNase Inhibitor of μ L, dNTP Mix 4 μ L, Random Decamers, 2 μ L, 10X RT Buffer, 1 μ 1 μ L, Nuclease-free Water To of L, M-MLV Reverse Transcriptase, 20 μ L.
Then abundant mixing, of short duration centrifugation are hatched 1 hour for 42 DEG C, the reverse transcription product of acquisition is used for nested PCR amplification Reaction.
（3）Nest-type PRC reaction amplification
Using the product of previous step reverse transcription as masterplate, the special external primers of target gene and the external primers of connector are utilized The first step for carrying out 5 ' RACE nest-type PRCs is reacted, and the external primers of gene external primers and connector are： AGCAGCTGTCATAGTGACCACACT and GCTTGTTCCAGCTGATGAGTGA, reaction solution are prepared on ice, and reaction system is： 5 μ L, dNTP Mix of RT reaction (from the previous step) 1 μ L, 10X PCR Buffer, 4 μ L, 5 ' RACE gene-specific outer primer (10 μM), 2 μ 2 μ L of L, 5 ' RACE Outer Primer, 50 μ L, thermostable DNA polymerase of Nuclease-free Water To (0.25 μ L of 5U/ μ L) 1.25U
Response procedures are：
Pre-degeneration： 94 ℃ 3min；
Amplification：94 DEG C of 30 s, 60 DEG C of 30 sec, 72 DEG C of 30 sec（35 cycles）；
Extension： 72℃ 7 min.
The product reacted by the use of the nest-type PRC first step is as template, in target gene special internal primer and connector The second step that portion's primer carries out nest-type PRC reacts, and the internal primer of gene internal primer and connector is： AGCAGCTGTCATAGTGACCACACT and GCTTGTTCCAGCTGATGAGTGA, reaction system are：Outer PCR (from The previous step) 2 μ L, 10X PCR Buffer, 5 μ L, dNTP Mix 4 μ L, 5 ' RACE gene- Specific innter primer (10 μM) 2 μ L, 5 ' RACE inner Primer 2 μ L, Nuclease-free 50 μ L, thermostable DNA polymerase of Water To (0.25 μ L of, 5 U/ μ L) 1.25U.Response procedures It is identical with nest-type PRC first step reaction.
（4）The connection of target fragment and carrier T
Amplified production is detected with 1% agarose gel electrophoresis, and testing result as shown in Figure 2, cuts target fragment day The pillar DNA plastic recovery kits recycling of root biochemical corp, the specific method for purifying recycling are operated in strict accordance with specification.Recycling Product is connected to pMD 18-T Vector, coupled reaction system：1 μ L, Solution I of pMD 18-T Vector, 4 μ L, Recycle segment 4 μ L, ddH2O 1 μL
（5）The conversion and sequencing of connection product
Connection product is converted into bacillus coli DH 5 alpha competent cell, each target gene is chosen to 10 positive colonies and used Solexa high throughput sequencing technologies are sequenced, and the result of sequencing is as shown in Figure 3（Arrow pointed location is miRNA degradation targets The fracture position of gene）.
With reference to the result of attached drawing 3 and attached drawing 4 illustrate, stu-miR9255 can by target gene serine/threonine kinase by Body gene (PGSC0003DMG 400019726) mRNA specific cleavages, so as to lower expression of target gene.
3rd, under drought stress stu-miR9255 expression quantity analysis
The RNA reverse transcriptions of different drought processing stage are synthesized into cDNA respectively.With SYBR Premix Ex TaqII Quantitative fluorescent PCR（qRT-PCR）Kit detects expression of the target gene in different drought processing stage, with elongation factors （ef1a）For gene as internal reference, reaction system is as follows：SYBR® Premix Ex TaqTM II（2×）10 μ L, qGUS-1 （10 μM）0.8 μ L, qGUS-2（10 μM）0.8 μ L, ROX Reference Dye II（50×）0.4 μ L, RT reaction solutions 1 μ L, ddH2O 7 μL。
QRT-PCR reaction conditions are：
95 DEG C of 10 min of pre-degeneration
95 DEG C of 15 sec of denaturation
60 DEG C of 1 min, 40 cycles
72℃ 30 sec
Calculation formula：Using formula RQ (relative expression quantity)=2–∆∆CtRelative expression quantity after calculating before treatment, Ct=（Ct processing sample-Ct ef1a）（Ct control sample-Ct ef1a）.Primer sequence is： CGCUCUGAUUGACUUGUGGUUUUC and Uni-miR qPCR Primer（TaKaRa RR717）.
The present invention has found a new miRNA in potato（stu-miR9255）, microRNA target prediction and experimental verification table Bright, targeting participates in planting in julienne potatoes propylhomoserin/threonine kinases receptors gene (PGSC0003DMG 400019726) Perception and transmission of the object to drought stress environment stress signal, so as to play important tune during plant response environment stress Control acts on.As shown in Figure 4, two kind Atlantic Ocean of potato and pale reddish brown white stu- after drought stress processing MiR9255 genes show significantly to raise, this shows that the expression of stu-miR9255 is regulated and controled by drought stress.Therefore, in horse Stu-miR9255 genes are overexpressed in bell potato or inhibit stu-miR9255 expression that will cultivate with high drought-resistant ability Potato transformed variety.
The stu-miR9255 genes that primer amplification obtains are designed, build strong constitutive promoter CaMV 35S drivings Stu-miR9255 expression vector pBI121-CaMV35S-GNA are imported using freeze-thaw method in agrobacterium tumefaciens lba4404. The genetic transformation of potato is carried out according to Agrobacterium tumefaciens transformation method.By the transgenic seedling of acquisition and blank seedling in Nutrition Soil Culture stops watering when length is to 20cm high, root was taken to measure proline content in the 16th day, while measure leaf r elative water content And stomatal conductance.The experimental results showed that transgenic potato proline content is significantly higher than blank group（P ＜ 0.01）, blade phase Blank group is significantly higher than to water content（P ＜ 0.05）, stomatal conductance is substantially less than blank group（P ＜ 0.01）.Therefore, stu- MiR9255 can improve potato osmotic adjustment ability, improve moisture holding capacity, transpiration be reduced, so as to improve drought-resistant ability.
The above is only the specific embodiment of the application, is only proposed as the enforceable technical solution of the present invention；It should It, for those skilled in the art, can also be to reality under the premise of the application principle is not departed from when pointing out It tests step and makes several improvements and modifications, these improvements and modifications also should be regarded as the protection domain of the application.
<110>Gansu Agriculture University
<120>Potato stu-miR9255 and its application
<160> 4
<210> 1
<211> 111
<212> RNA
<213>Potato（Solanum tuberosum）
<400> 1
acauauccaa gacccccuuu ucugauugac uugugguuuu cacauuccuu uucugucaua 60
uacacagccc auccaaaaaa ggaaugugaa aaccacaagc caaucagaaa a 111
<210> 2
<211> 111
<212> DNA
<213>Potato（Solanum tuberosum）
<400> 2
acatatccaa gacccccttt tctgattgac ttgtggtttt cacattcctt ttctgtcata 60
tacacagccc atccaaaaaa ggaatgtgaa aaccacaagc caatcagaaa a 111
<210> 3
<211> 21
<212> RNA
<213>Potato（Solanum tuberosum）
<400> 3
ucugauugac uugugguuuu c 21
<210> 4
<211> 1677
<212> RNA
<213>Potato（Solanum tuberosum）
<400> 4
atgtccatct tacttttctt ggtatttttc ccattgttta gtttaggaca cagacaagag 60
ggttgtgagg attcttggtg caagagtcat ggtcccatcg ttcatttccc attcagactc 120
agtcatcaac caaaacattg tggctatgat cctggatttg aactacattg caacaataaa 180
aaagacacca tccttgagct tccttcgtct gttcacttag ttgttgaaaa gattgattat 240
gtctcacagc aaattcacct ttatgtcgag tgcatagcag ccaagctacc aaaactgaat 300
ttgtcacaat ctaatttcac aaatgatgac gatcccacag acctatttaa ttgttctgca 360
ccattctcag acaataatta tgattattac ttggttccat gtcttggttc tcctggttac 420
caagtacatg ctgttgcttt gacttcaaga cttcaatact tcttgtctgg gccttgcaca 480
aaaattcatc agtacccata ctcagattca acatttggtg agaacatgct gcagctgaat 540
tggtctgtac cactctgtgg aaactgtata gttttaggta caacgctggt ttgcattatt 600
gtcttctcgc tttataagct atatttgaca agtagaaatg aaagagagag tcgagttaga 660
cttgaaaagt ttttggaaga ctacaaggcc atcagaccaa cacgatatac ttatgctgat 720
attaagaaga taacagatga ttttaatgaa aagttaggag aagggagtta tggaacaata 780
tacaaaggca gactttccag tgaaatcttt gttgcagtaa aagtcctaca cgattccaag 840
ggtaaagggg aagaatttat caatgaaatc ggtacaattg ggagaatcca ccatgttaac 900
gtggtccgct tagttggttt ttgtgctgat ggattcagac gagctctaat ctacgaatac 960
ctaccaaatg attcacttga aaggtttatt ttaccagtaa actcaagcac aggtagtgtc 1020
tcactcatca gctggaacaa gcttcaacat attgctctgg gtactgcaag agggattgag 1080
tatcttcacc agggatgtga tcagcaaatc ctacatttcg atatcaaacc acaaaacatc 1140
cttttagacc acaacttgaa tcccaaaata tgtgattttg gcctagccaa actgtgttct 1200
aaagaaaaaa gtgtggtcac tatgacagct gctaggggaa ccattggcta cattgcacca 1260
gaagttttat ctagaaactt tggtaaagtt tctcacaagt ctgatattta tagctttggg 1320
atgctcttgt tagaaatggt tgatgggagg ataaagatgg attctaagac gaacaatcac 1380
agcaaagtga attctttgga atggatatat agacatttag agaaagggga agaattaaag 1440
attcgtatag aggaagaagg agataataca attgtgagaa agttagctat tgttggactt 1500
tggtgcatac agtggcatcc aattgatagg ccttcaataa aagaagttac tcagatgctg 1560
gaaggagatg gcagccatct caacttgtcc ccaaatcctt ttatggctac taatacgcct 1620
aagttaaatg caagtccttt cagtgaagat ctagacgtga tattagaaat tgaataa 1677

Claims (7)

1. potato stu-miR9255, it is characterised in that the precursor sequence of the stu-miR9255 such as sequence table SEQ ID NO： Shown in 1.
2. potato stu-miR9255 according to claim 1, it is characterised in that the stu-miR9255 precursor sequences Secondary structure be：Ring-type is formed from 5 ' end 8bp-10bp and 80bp-82bp, is formed from 5 ' end 33bp-34bp and 48bp-58bp Ring-type forms ring-type from 5 ' end 37bp-45bp；Other base pairings form loop-stem structure.
3. potato stu-miR9255 according to claim 1, it is characterised in that encode the stu-miR9255 precursors The DNA sequence dna of sequence such as sequence table SEQ ID NO：Shown in 2.
4. potato stu-miR9255 according to claim 1, it is characterised in that the ripe sequence of the stu-miR9255 Row such as sequence table SEQ ID NO：Shown in 3.
5. potato stu-miR9255 according to claim 4, it is characterised in that the ripe sequence of the stu-miR9255 Row are one section RNA sequence of the precursor sequence from 5 ' end 21bp-41bp.
6. potato stu-miR9255 described in claim 1 is in target gene serine/threonine kinase function of receptors is verified Application, it is characterised in that target gene serine/threonine kinase receptor (PGSC0003DMG 400019726) sequence is such as Sequence table SEQ ID NO：Shown in 4.
7. potato stu-miR9255 according to claim 6 is in verification target gene serine/threonine kinase receptor work( Application in energy, it is characterised in that the stu-miR9255 makes expression of target gene lower and grind by selective degradation target gene Study carefully target gene function.
CN201610230141.1A 2016-04-14 2016-04-14 Potato stu-miR9255 and its application Expired - Fee Related CN105802968B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610230141.1A CN105802968B (en) 2016-04-14 2016-04-14 Potato stu-miR9255 and its application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610230141.1A CN105802968B (en) 2016-04-14 2016-04-14 Potato stu-miR9255 and its application

Publications (2)

Publication Number Publication Date
CN105802968A CN105802968A (en) 2016-07-27
CN105802968B true CN105802968B (en) 2018-07-03

Family

ID=56461001

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610230141.1A Expired - Fee Related CN105802968B (en) 2016-04-14 2016-04-14 Potato stu-miR9255 and its application

Country Status (1)

Country Link
CN (1) CN105802968B (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101906155A (en) * 2010-04-09 2010-12-08 北京市农林科学院 Protein ErNAC7 related to drought and salt resistance of plants and coding gene and application thereof
CN101939435A (en) * 2007-09-21 2011-01-05 巴斯夫植物科学有限公司 Plants with increased yield

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101939435A (en) * 2007-09-21 2011-01-05 巴斯夫植物科学有限公司 Plants with increased yield
CN101906155A (en) * 2010-04-09 2010-12-08 北京市农林科学院 Protein ErNAC7 related to drought and salt resistance of plants and coding gene and application thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
《Identification of Novel and Conserved MicroRNAs Related to Drought Stress in Potato by Deep Sequencing》;Ning Zhang等;《PLoS ONE》;20140418;第9卷(第4期);全文 *
《不同马铃薯品种根系提水能力与抗旱性研究》;李亚杰;《中国优秀硕士学位论文全文数据库农业科技辑》;20140415(第4期);全文 *
《马铃薯抗旱相关microRNA的鉴定及分析》;马骢毓;《中国优秀硕士学位论文全文数据库农业科技辑》;20130115(第1期);全文 *

Also Published As

Publication number Publication date
CN105802968A (en) 2016-07-27

Similar Documents

Publication Publication Date Title
CN104327173B (en) A kind of cotton WRKY transcription factors GarWRKY22 of regulation and control plant salt endurance and application
CN107937411A (en) Chinese white poplar PtoWRKY40 genes, its expression vector and construction method and application
CN102002101B (en) Plant root development related protein ZmNR1 and coding gene thereof
CN113337633B (en) Comparative transcriptional analysis method for differential expression of peanut leaf genes under intercropping corn
Sun et al. Cloning and preliminary functional analysis of PeUGE gene from moso bamboo (Phyllostachys edulis)
US11525142B2 (en) Zea mays NLP transcription factor ZmNLP5 and use thereof
CN102250949B (en) Application of rice miR166 in enhancing plant cadmium stress tolerance
CN104140971A (en) Application of paddy rice genes OsMADS27 to promoting tap root system plant lateral root growth
CN105802968B (en) Potato stu-miR9255 and its application
CN105647928B (en) Potato stu-miR5992a and stu-miR5992b and its application
CN114854768B (en) Duck grass vernalization gene DgPAPS4 and application thereof
CN116218876A (en) Gene OsB12D3 for regulating rice chalkiness, encoding protein and application thereof
CN101605901B (en) miRNA of plant, chip and the uses thereof
CN105647929B (en) Potato stu-miR4322 and its screening technique and application
CN109852634A (en) A method of cultivating high nodulation and nitrogen fixation genetically modified plants
Chen et al. Integration of small RNA, degradome, and transcriptome sequencing data illustrates the mechanism of low phosphorus adaptation in Camellia oleifera
CN108795927A (en) The clone of common wheat gene TaSPX3 coded sequences and its application
CN105695469B (en) Potato stu-miR9471 and its application
CN109207485A (en) Application of the OsAPS1 gene in improvement Rice Resistance characteristic of disease
CN104762305B (en) The gene TaUreG related to Drought-resistance in Wheat and its application
CN105647927A (en) Potato stu-miR156 member and application thereof
CN102250901B (en) Application of paddy rice miR192 in improving cadmium stress sensitivity of plant
CN105647926B (en) Application of the potato stu-miR8045 in degradation ubiquitin binding enzyme
CN113416749B (en) Application of millet small RNA SimiR396d in regulation and control of plant drought resistance
CN114525301B (en) Application of ZmPHR1 protein in regulating and controlling phosphorus content of corn

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20180703

Termination date: 20210414

CF01 Termination of patent right due to non-payment of annual fee