CN103290036A - 5-enolpyruvyl-shikimate-3-phosphate (EPSP) synthase gene from ochrobactrum anthropi and application thereof - Google Patents
5-enolpyruvyl-shikimate-3-phosphate (EPSP) synthase gene from ochrobactrum anthropi and application thereof Download PDFInfo
- Publication number
- CN103290036A CN103290036A CN2013102335240A CN201310233524A CN103290036A CN 103290036 A CN103290036 A CN 103290036A CN 2013102335240 A CN2013102335240 A CN 2013102335240A CN 201310233524 A CN201310233524 A CN 201310233524A CN 103290036 A CN103290036 A CN 103290036A
- Authority
- CN
- China
- Prior art keywords
- plant
- gene
- glyphosate
- sequence
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a 5-enolpyruvyl-shikimate-3-phosphate (EPSP) synthase gene from ochrobactrum anthropi and application thereof. The invention also provides genetic engineering intermediates (such as an expression cassette, a carrier and a cell) of the gene, a method for obtaining a plant with glyphosate resistance, and application of the method, and provides an identification method for judging whether the plant has the glyphosate resistance. The EPSP synthase gene plays an important role in research and development of the glyphosate-resistant plant.
Description
Technical field
The invention belongs to microbiological genetic engineering field and genetically engineered plant and learn the field, be specifically related to a kind of the derive from epsp synthase gene of human pallid bacillus and the application in transfer-gen plant thereof.
Background technology
(N-phosphonomethyl-glycine glyphosate) is a kind of organophosphorus herbicide to glyphosate.Early 1970s is developed by Monsanto Company, generally is made into isopropyl amine salt or sodium salt when using usually.Its isopropyl amine salt is the activeconstituents of famous weedicide trade mark " Roundup ".
Glyphosate is go out natural disposition, the outstanding weedicide of inner sucting conduction type of a kind of wide spectrum, is one of weedicide of whole world usage quantity maximum.The herbicidal performance excellence of glyphosate is very easily absorbed by plant leaf and conducts to the plant whole body, and annual and perennial weeds are had very high activity.But this weedicide is a kind of nonselective herbicide, and farm crop are possessed lethality equally.Use glyphosate widely for making in farm crop produce, must cultivate the farm crop with resistance glyphosate resistance or degradation property.
The toxic action mechanism of glyphosate is the activity of the 5-enol acetone shikimic acid-3-phosphate synthase (5-enolpyruvyl-shikimate-3-phosphate synthase, EPSPS are called for short epsp synthase) in the competitive inhibition shikimic acid pathway.Epsp synthase is die aromatischen Aminosaeuren in plant and the microbe, a key enzyme in the biosynthetic processes such as tryptophane, tyrosine and phenylalanine.Glyphosate can transport by the phloem of plant, and is combined with epsp synthase, thereby the biosynthesizing of blocking-up die aromatischen Aminosaeuren causes necrocytosis.
Glyphosate also can suppress epsp synthase activity in the biosynthesizing of die aromatischen Aminosaeuren in most of bacterium, but has found that the glyphosate of EPSPS of part bacterium has resistance, and is obtained by the clone.Plant can obtain the ability of resistance glyphosate by the resistance EPSPS of transgene expression bacterium.For example Agrobacterium (
Agrobacterium tumefaciensSp CP4) and
Salmonella typhimuriumThe EPSPS of CT7 expresses in plant and the resistance that obtains is used (United States Patent (USP) 453590,4769061,5094945) aborning.But for the resistance level that improves transgenic crop and the diversity that increases resistant gene, still need new Antiglyphosate gene and transgenosis anti-glyphosate plants based on this in the production application.
Along with the development of information biology, can from the full genome database of bacterium, find many EPSPS genes, but these EPSPS genes can not directly provide Antiglyphosate gene.This be because, whether the EPSPS of a kind of bacterium the height of resistance glyphosate and resistance, be can not be by EPSPS the aminoacid sequence prediction, and need carry out the resistance glyphosate functional verification to them because the EPSPS One's name is legion, the functional verification workload is huge.But the EPSPS gene of known array is for the clone of resistant gene provides simple more method.
China has obtained certain progress in the research aspect the transgenosis glyphosate resistant crops, does not change the report that the Antiglyphosate gene crop enters the commercialization stage but still have at present.Therefore, this area presses for the EPSPS of the new resistance glyphosate of exploitation, thereby obtains the transgenosis anti-glyphosate plants.
The present invention screens the bacterium that a strain has glyphosate resistance from mud, utilize the information of its genome sequence to clone its EPSPS gene, and further in plants such as Arabidopis thaliana, tobacco, cotton, paddy rice, corn, soybean, wheat, rape, turfgrass and herbage, proved resistance glyphosate ability and the purposes in development transgenosis resistance glyphosate farm crop thereof of this EPSPS gene, had broad application prospects.
Summary of the invention
Technical problem to be solved by this invention is that the plant that makes that provides new has gene and the proteins encoded thereof of glyphosate resistance.In addition, the present invention also provide this gene the genetically engineered intermediate (as, expression cassette, carrier and cell etc.), obtain to have the methods and applications of the plant of glyphosate resistance, and provide and judge whether plant has the authentication method of glyphosate resistance.
Particularly, in first aspect, the invention provides a kind of new gene that glyphosate is had high resistance, be a kind of new epsp synthase gene (hereinafter referred to as the O-EPSP synthase gene) that the contriver screens and is cloned into, the O-EPSP synthase gene be from a plant height glyphosate resistance bacterial strain human pallid bacillus (
Ochrobactrum anthropiKT-CGL-7-7) clone obtains in.
Ochrobactrum anthropiKT-CGL-7-7 has the active bacterial strain of high tolerance through what a large amount of experiments such as primary dcreening operation and multiple sieve obtained to glyphosate for the inventor from the experimental plot soil that sprays glyphosate.This bacterial classification is preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center (CGMCC) on June 19th, 2012, and deposit number is CGMCC No. 6230.The O-EPSP synthase gene is one of following nucleotide sequence:
1) nucleotide sequence shown in the SEQ ID NO:1 in the sequence table;
2) have 90% above similarity and coding identical function protein DNA sequence with SEQ ID NO:1 sequence;
3) compare with SEQ ID NO:1, have part, section and/or fragment (comprise and close on fragment and compare inside and/or terminal deletion with full-length molecule), its variant, mutant, mosaic and the fusions of SEQ ID NO:1 sequence and the nucleotide sequence that codified is given the protein of high glyphosate resistance activity;
4) according to SEQ ID NO:1, utilize same amino acid whose different codons and the different nucleotide sequence that obtains, the protein and peptide of the high glyphosate resistance activity of these sequence encodings;
5) other variations by importing the nucleotide sequence shown in the SEQ ID NO:1 but still coding has the nucleotide sequence of the protein of resistance glyphosate ability.
The nucleotide sequence of the glyphosate resistance gene of first aspect present invention can have multiple different variation, include but not limited to: 1) utilize same amino acid whose different codons and the different nucleotide sequence that obtains, the protein and peptide of the identical activity of these sequence encodings; 2) other variations by importing nucleotide sequence but still coding has the nucleotide sequence of the protein of resistance glyphosate ability.This variation can be variation at random, also can be to put variation targetedly, can also be the variation of inserting or lacking.One of ordinary skill in the art just can produce above-mentioned variation by molecular biological method.
In second aspect, the invention provides the proteins encoded that glyphosate is had a kind of new epsp synthase gene of high resistance, by the genes encoding of first aspect present invention, this albumen is the protein with one of following amino acid residue sequences:
1) protein of being formed by the aminoacid sequence of SEQ ID No:2 representative;
2) compare with the protein sequence of SEQ ID No:2 representative, alternative by having, lack or add the protein that high glyphosate resistance activity is formed and given to one or several amino acid whose aminoacid sequence;
3) compare with the protein sequence of SEQ ID No:2 representative, part, section and/or fragment (comprise and close on fragment and compare inside and/or terminal deletion with full-length molecule), its variant, mutant, mosaic and the fusions with SEQ ID No:2 sequence and the albumen of giving high glyphosate resistance activity are arranged.
Knowing under the prerequisite of concrete sequence, by routine techniques, as the method for PCR method, recombination method or synthetic, those skilled in the art can be easy to obtain nucleic acid molecule or its fragment of the albumen of coding of the present invention shown in SEQ ID No:2.In addition, can be by having the mutant gene of the present invention of identical function as side-directed mutagenesis etc. is synthetic with mutant.
Certainly, those skilled in the art are according to the enlightenment of this paper, by one or several amino acid whose mode in the albumen shown in disappearance, replacement and/or the interpolation SEQ ID No:2, perhaps by hybridize to search can be under stringent condition can with the nucleic acid of the nucleic acid hybridization of the albumen shown in the coding SEQ ID No:2, select the mutant protein and the gene thereof that are equal to gene function of the present invention, this also includes within the scope of the present invention.
Gene of the present invention can merge to produce chimeric or fusion rotein with other genes and protein.Useful gene of the present invention and protein not only comprise the full length sequence of concrete example, also comprise part, section and/or fragment (comprise and close on fragment and compare inside and/or terminal deletion with full-length molecule), its variant, mutant, mosaic and the fusions of these sequences.By the whole bag of tricks, for example cut by the multiple protein enzyme, and the partial sequence of excision protein, and after excision, still keep and show activity and function, the protein that is produced by this method is also included within the scope of the present invention.
As long as keep required functionally active, protein of the present invention can have the amino acid of replacement.Not to activity of proteins/functional having a negative impact, these also within the scope of the invention by changing protein three-dimensional feature and other NM multifrequency natures (for example conservative type amino acid is replaced).
Be used for the sequence optimisation of expression of plants also within the scope of the present invention.For better high expression level foreign gene in plant, described gene may preferably be redesigned so that its more effective expression in vegetable cell.For example can utilize the vegetable codon preference to transform foreign gene again to obtain optimal expression.
O-EPSP synthase gene of the present invention and proteins encoded thereof are given the active to the tolerance of the height of glyphosate of microorganism, and its maximum tolerated concentration reaches 6500 mg/L, and simultaneously in contrast Agrobacterium (
Agrobacterium tumefaciens) maximum tolerated concentration of the glyphosate of AgL0 has only 3000 mg/L.
In the third aspect, the invention provides the carrier that comprises the described O-EPSP synthase gene of first aspect present invention.Term herein " carrier " refers to bacterial plasmid, clay, phagemid, yeast plasmid, vegetable cell virus, animal virus and other various virus vector commonly used in this area.According to applied purpose difference, " carrier " can be divided into " cloning vector ", " expression vector " and " conversion carrier " in this article, refer to employed purpose respectively at clone and checking gene, express corresponding gene and corresponding gene transformed.The carrier that is suitable among the present invention includes but not limited to: the carrier (prokaryotic expression carrier) of expressing usefulness in bacterium, in yeast, express the carrier of usefulness (as pichia vector, debaryomyces hansenii carrier etc.), baculovirus vector in expressed in insect cells, in mammalian cell, express the carrier (vaccinia virus vector of usefulness, retroviral vector, adenovirus carrier, adeno-associated virus carrier etc.), the various carriers of in plant, expressing the plant viral vector of usefulness and in mammal galactophore, expressing usefulness.Except cloning vector necessary in clone's process, also the carrier in the preferred fourth aspect present invention is conversion carrier, especially plant conversion carrier, the particularly carrier of suitable Agrobacterium-mediated Transformation plant.Above-mentioned recombinant vectors also comprises foreign gene or exogenous dna fragment.
In fourth aspect, the invention provides the cell that comprises the described O-EPSP synthase gene of first aspect present invention.Cell can be prokaryotic cell prokaryocyte, also can be eukaryotic cell, as, bacterial cell, yeast cell, vegetable cell, insect cell, mammalian cell etc.Preferred cell can be agrobatcerium cell, utilizes it goal gene can be transformed into plant.Microorganism cells preferably in addition, as bacterial cell, they can be used as the host cell of cloning vector or conversion carrier.
Aspect the 5th, the invention provides plant, it comprises the O-EPSP synthase gene of first aspect present invention, and/or it expresses the protein of second aspect present invention.Owing to introduced the O-EPSP synthase gene of first aspect present invention and the protein of second aspect present invention, the plant of fifth aspect present invention has glyphosate resistance.In this article, plant refers to by photosynthesis, maintain single plant, plant group or its reproductive material of existence with inorganicss such as water, carbonic acid gas and inorganic salt with regard to energy synthetic carbohydrate, protein, comprise the bred part of plant, plant variety, plant, plant event, plant offspring, plant seed or other plant.Wherein, the plant offspring itself is exactly plant, the plant offspring who comprises the plant offspring that produces by transgenic technology, produces with the other plant mixing breed and backcrossing or plant offspring that selfing produces also comprises offspring's transgenic plant cells, tissue, organ, seed.
The plant of fifth aspect present invention can be dicotyledons, also can be monocotyledons.Preferred plant and vegetable cell are Arabidopis thaliana, tobacco, cotton, paddy rice, corn, soybean, wheat, rape, turfgrass and herbage etc.Can also produce the transgenic plant of other types according to the present invention, as fruit, vegetables and trees.Protein coding gene of the present invention can be introduced in multiple microorganism or the plant host.The present invention includes transgenic plant cells and transgenic plant.
Aspect the 6th, the invention provides the application of the described gene of first aspect present invention in obtaining to have the transgenic plant process of glyphosate resistance.Under the condition of known, the method of cultivating transgenic plant is precedented, mode that for example can be by Agrobacterium-mediated Transformation or the mode of microparticle bombardment or electroporation be in gene transfered plant or its tissue, cultivates this plant or its tissue then and screen in having the environment of glyphosate.Preferably in this article, described plant is Arabidopis thaliana, tobacco, cotton, paddy rice, corn, soybean, wheat, rape, turfgrass and herbage etc.
In this article, obtain to comprise preparation, cultivation, production or otherwise produce to obtain, comprise by the transgenic breeding mode obtaining, as making it to express the protein of second aspect present invention behind the gene transferred plant with first aspect present invention; Also comprise by non-transgenic breeding mode obtaining, as by hybridize, backcross, the plant of selfing or vegetative propagation fifth aspect present invention and sub-elect the gene that still comprises first aspect present invention and express the plant of the protein of second aspect present invention.Therefore, the application that a sixth aspect of the present invention provides comprises, the application in obtaining to have the transgenic plant process of glyphosate resistance and obtaining has the application in the non-transgenic plant process of glyphosate resistance.
Aspect the 7th, the invention provides the method that acquisition has the plant of glyphosate resistance, it comprises the steps:
(1) make plant comprise the gene of first aspect present invention; And/or,
(2) make the protein of expression of plants second aspect present invention.
Can adopt transgenosis and non-transgenic method aforementioned or that those skilled in the art can be known, make plant comprise the gene of first aspect present invention, perhaps make the protein of expression of plants second aspect present invention.Implement the method for seventh aspect present invention, can obtain the plant of fifth aspect present invention.Preferably in a seventh aspect of the present invention, the step that can adopt comprises transgenosis, hybridizes, backcrosses, selfing or vegetative propagation step.These steps itself all can be known and be implemented for the technician in transgenosis or non-transgenic breeding field.
In eight aspect, the method for the plant that the method for the plant of identifying fifth aspect present invention or seventh aspect present invention of the invention provides obtains, it comprises the steps:
(1) measures the gene whether described plant comprises first aspect present invention; And/or,
(2) measure the protein whether described plant expresses second aspect present invention.
The step of measuring can be undertaken by detection of nucleic acids and/or the protein detection method of routine, and the method that only need be able to detect gene or its proteins encoded can.Exemplary method comprises protein sequencing, nucleic acid sequencing, polymerase chain reaction (PCR) detection, probe hybridization detection etc.
As from as described in carry out the amplification of the described O-EPSP synthase gene of first aspect present invention or its homologous sequence transgenic plant or its offspring, the seed, the sequence that amplifies is carried out sequential analysis and is compared with the described O-EPSP synthase sequence of first aspect present invention.Wherein Kuo Zeng method is known, as pcr amplification.Because the described O-EPSP synthase gene of first aspect present invention separates from bacterium and obtains, do not contain this gene in natural plant or its seed, if it is identical with the described O-EPSP synthase gene of first aspect present invention to amplify sequence and this sequence from plant or its seed, this plant or its seed are exactly to have imported the transgenic plant of glyphosate resistance of the described O-EPSP synthase gene of first aspect present invention or its offspring, seed so.
For the ease of understanding, below will the present invention be described in detail by concrete drawings and Examples.It needs to be noted that specific examples and accompanying drawing only are in order to illustrate, not constitute limitation of the scope of the invention.Obviously those of ordinary skill in the art can illustrate according to this paper, within the scope of the invention the present invention is made various corrections and change, and these corrections and change are also included in the scope of the present invention.
Description of drawings
Sequence table 1 be from
Ochrobactrum anthropiThe nucleotide sequence of the glyphosate resistance gene O-EPSP synthase gene that amplification obtains among the KT-CGL-7-7.
Sequence table 2 be from
Ochrobactrum anthropiThe aminoacid sequence of the glyphosate resistance gene O-EPSP synthase gene that amplification obtains among the KT-CGL-7-7.
Fig. 1 is for being inserted into the O-EPSP synthase gene in the PTG2-OEPS vector construction synoptic diagram that plant expression vector PTG2 obtains.
Fig. 2 is that T1 sprays glyphosate experimental result photo for the transgenic arabidopsis seedling, and Fig. 2 A is for spraying the preceding Arabidopis thaliana growth conditions of glyphosate; Fig. 2 B is for spraying the survival condition of 2.5mM glyphosate after one week, and wild-type and non-transgenic seedling are withered, positive control and transgenic seedling survival.
Fig. 3 is that T2 sprays glyphosate experimental result photo for the transgenic arabidopsis seedling, WT is wild-type, the positive contrast of CP4-EPSP, O-EPSP-1 ,-2 and-3 is respectively the T2 different transgenic line of three strains in generation, spray 5mM(A respectively), 10mM(B) and glyphosate 20mM(C) a week back survival condition, wild-type is withered, and transgenic arabidopsis is uninfluenced.
Fig. 4 detects transgenic arabidopsis T2 for electrophorogram for PCR, and M is marker, and 1-7 is transgenic arabidopsis ,-negative contrast ,+positive contrast.
Fig. 5 is that T1 sprays glyphosate experiment photo for transgene tobacco, and T1 after 30 days, sprays the glyphosate of 2.5mM for the growth of transgene tobacco seedling, through the survival condition after 1 week, and transgene tobacco uninfluenced (A), the non-transgenic tobacco is withered (B).
Fig. 6 is that T1 sprays glyphosate experiment photo for transgenosis and non-transgenic paddy rice seedling, T1 grew for the transgenic paddy rice seedling after two weeks, sprayed the glyphosate of 2.5mM, through the survival condition after 1 week, the non-transgenic paddy rice is withered (A), transgenic paddy rice uninfluenced (B).
Fig. 7 is that T1 sprays glyphosate experimental result photo for transgenic corns seedling and non-transgenic corn.Figure is that maize seedling was grown after two weeks, sprays the glyphosate of 2.5mM, through spraying the glyphosate of 2.5mM after two weeks again, through one week the back survival condition, A is that transgenic corns is uninfluenced, B is that the non-transgenic corn is withered.
To be T1 spray glyphosate experiment photo for the genetically engineered soybean seedling to Fig. 8, and figure is that big bean seedlings were grown after two weeks, sprays the glyphosate of 2.5mM, through spraying the glyphosate of 2.5mM after two weeks again, through survival condition after the week, A is that the non-transgenic soybean is withered, and B is that genetically engineered soybean is uninfluenced.。
Embodiment
Method therefor is ordinary method if no special instructions among the following embodiment, solvent in the substratum is water, concrete steps can be referring to " Molecular Cloning:A Laboratory Manual " (Sambrook, J., Russell, David W., Molecular Cloning:A Laboratory Manual, 3
RdEdition, 2001, NY, Cold Spring Harbor).The primer and dna sequence dna are synthetic by Shanghai Ying Jun Bioisystech Co., Ltd.
1780 change substratum (1L): K
2HPO
40.61g, KH
2PO
40.39g, KCl 0.25g, MgSO
47H
2O 0.13g, liquid microelement 1.0ml.Glyphosate is added to required final concentration in sterilization cooling back.Wherein every 1000ml liquid microelement comprises CaCl
22H
2O 0.0004g, FeSO
47H
2O 0.04g, MnSO
44H
2O 0.04g, ZnSO
47H
2O 0.02g, CuSO
45H
2O 0.005g, CoCl
26H
2O 0.004g, NaCl 1.0g, Na
2MoO
42H
2O 0.005g.
1/10LB liquid nutrient medium (1L): yeast powder 0.5g, peptone 1g, NaCl 10g; Glyphosate is added to required final concentration in sterilization cooling back.
LB liquid nutrient medium (1L): peptone 10g, yeast powder 5g, NaCl 10g.
2 * YT substratum (1L): yeast extract 16g, peptone 16g, NaCl 5 g, agar powder 12g.
YEB substratum (1L): beef extract 5g, peptone 10g, yeast extract 5g, glucose 5g, NaCl 5g, solid medium adds the 15g agar powder.
As needs, in above substratum, add corresponding microbiotic.Kantlex final concentration 50 μ g/ml, Rifampin final concentration 40 μ g/ml.
1, pedotheque source
5cm collection pedotheque under the experiment field soil layer that sprays glyphosate.
2, the separation of glyphosate resistance bacterial strain, purifying
The enrichment of bacterial strain: take by weighing 20 gram pedotheques respectively, a copy of it pedotheque joins (liquid amount is the 50ml/300ml triangular flask) in the 1/10LB liquid nutrient medium that contains the 100mg/L glyphosate, another part pedotheque joins and contains 1780 of 100mg/L glyphosate and change (liquid amount is the 50ml/300ml triangular flask) in the liquid nutrient medium, puts 30
o200rpm carries out enrichment culture in the C shaking table.
The domestication of bacterial strain and purifying: each enrichment culture 7 days, with the centrifugal 10min of culture 3000rpm, abandon supernatant, add substratum in the precipitation again, continue domestication.Tame four all after dates, beginning progressively improves in the substratum glyphosate concentration, and (the glyphosate concentration gradient is: 200mg/L, 300mg/L, 500 mg/L, 750 mg/L, 800 mg/L, 900 mg/L, 1000mg/L and 1200mg/L), 7 days is an acclimation period, and when each acclimation period finishes, get simultaneously nutrient solution and change solid plate 1780 and be coated with 30
oThe C constant temperature culture, picking list bacterium colony, the separation and purification of ruling repeatedly obtains single bacterium colony.Wherein, when taming concentration for 750mg/L, glyphosate screens KT-CGL-7-7 of the present invention.
3, glyphosate tolerance experiment:
In glyphosate resistance bacterial strain screening process, be separated to 52 strain resistant strains altogether, respectively they carried out the glyphosate tolerance experiment.The glyphosate tolerance concentration gradient is respectively (mg/L): 100,200,500,1000,1,200 3000,5000,5500,6000,6500 and 7000, and the tolerance substratum is the LB liquid nutrient medium, puts 30
o200rpm cultivated three days in the C shaking table, measured the OD of nutrient solution
600The result: the resistance bacterium that can tolerate 5000mg/L glyphosate concentration has 6 strains, two strains wherein can be the highest the glyphosate of tolerance 6500mg/L, wherein the KT-CGL-7-7 of the present invention concentration that can tolerate glyphosate is up to 6500mg/L.
4, extraction and the strain identification of the total DNA of glyphosate resistance bacterial strain KT-CGL-7-7
In 3ml liquid LB substratum, cultivate 16h with separating the KT-CGL-7-7 that obtains, extract test kit (day root biochemical technology company limited) with bacterial genomes and extract the total DNA of thalline.
Be template with total DNA of extracting, utilize bacterial 16 S rRNA universal primer 27F (AGAGTTTGATCCTGGCTCAG) and 1492R(GGTTACCTTGTTACGACTT) amplification resistant strain 16SrRNA gene.PCR product 1% sepharose reclaims the back and connects the pEASYBlunt carrier, transforms DH5 α, and the picking positive colony is delivered to the order-checking of Ying Jun company.Sequencing result carries out sequence alignment in NCBI, the result show KT-CGL-7-7 belong to human pallid bacillus (
Ochrobactrum anthrop), so called after
Ochrobactrum anthropiKT-CGL-7-7.
The dna fragmentation clone of embodiment 2 glyphosate highly-tolerants
1, PCR method obtains the dna fragmentation of part glyphosate highly-tolerant
According to what announce among the NCBI
Ochrobactrum anthropiThe epsp synthase gene sequences Design
Primer 1-F(sequence is shown in SEQ ID No:3): 5 '-ATGCAGGCCATGGGTGCCAGGATT-3 '
Primer 1-R(sequence is shown in SEQ ID No:4): 5 '-GCGATGCGGTGGTCGAGGTGGGTT-3 '
According to what announce among the NCBI
Brucella melitensisThe epsp synthase gene sequences Design
Primer 2-F(sequence is shown in SEQ ID No:5): 5 '-CGGGATCC ATGTCCCATTCCGCATGCCCG-3 '
Primer 2-R (sequence is shown in SEQ ID No:6): 5 '-CCGCTCGAGCGACATTCTGCACCGCTTTCGGCAAT-3 '
According to
O. anthropiWith
B. melitensisThe homologous sequence design primer of epsp synthase gene
Primer 3-F(sequence is shown in SEQ ID No:7): 5 '-GATGCCTCGCTTTCCAAGCGCC-3 '
Primer 3-R(sequence is shown in SEQ ID No:8): 5 '-GCCAGACGATCCGATTCCTTGAC-3 '
With high-fidelity Taq enzyme KOD-FX from
Ochrobactrum anthropiThe partial sequence of amplification epsp synthase gene in the KT-CGL-7-7 genome, PCR program: 98
oC 10 sec, 60
oC 30 sec, 68
oC 2min, totally 30 circulations.
The PCR product of primer 3-F and primer 3-R is the dna fragmentation of 713bp, and the PCR product of primer 3-F and primer 1-R is the dna fragmentation of 848bp, and the PCR product of primer 2-F and primer 3-R is 1076bp.Utilize DNAMAN software to carry out sequence assembly, obtain the partial sequence 1211bp of the dna fragmentation of glyphosate highly-tolerant altogether.
2, utilize inverse PCR to obtain the complete sequence of the dna fragmentation of glyphosate highly-tolerant:
Partial sequence according to the dna fragmentation of the glyphosate highly-tolerant that has obtained designs two pairs of inverse PCR primers, and primer sequence is as follows:
Primer 4-Up1(sequence is shown in SEQ ID No:9): 5 '-CGTGTTGAGACCGGCGAGCAGCA-3 ',
Primer 4-Down1(sequence is shown in SEQ ID No:10): 5 '-GACCCCTCCTCGACCGCTTTCCC-3 ';
Primer 5-Up2(sequence is shown in SEQ ID No:11): 5 '-GTGATCGGATTGGCTGTCCTGGG-3 ',
Primer 5-Down2(sequence is shown in SEQ ID No:12): 5 '-GTAAGATCGTCGGACCTCAAGGG-3 '
Use restriction enzyme ClaI, NcoI, HindIII, PstI, SphI and XbaI enzyme cutting respectively
Ochrobactrum anthropiThe KT-CGL-7-7 genomic dna, the small pieces segment DNA oneself who enzyme is cut with dna ligase connects cyclisation then, and get 5 μ l as the dna profiling of inverse PCR, utilize the flanking sequence of the dna fragmentation of primer 4-Up1 and Down1, primer 5-Up2 and Down2 amplification glyphosate highly-tolerant.Flanking sequence checks order after connecting the T carrier.With the partial sequence splicing of flanking sequence with the dna fragmentation of the glyphosate highly-tolerant of the 1211bp that obtains before, obtain the complete splicing sequence of the dna fragmentation of glyphosate highly-tolerant, and the design primer, primer 6-F and primer 6-R, sequence is as follows:
Primer 6-F(sequence is shown in SEQ ID No:13): 5 '-CGGATCCATGTCCCATTCCGCATGCCCG-3 '
Primer 6-R(sequence is shown in SEQ ID No:14): 5 '-GCTCGAGCGACATTCTGCTGCGCCCGGTTC-3 '
From
Ochrobactrum anthropiIn the KT-CGL-7-7 genomic dna, with Taq enzyme KOD-FX high-fidelity enzyme, utilize the complete sequence of the dna fragmentation of primer primer 6-F and 6-R pcr amplification glyphosate highly-tolerant.The result obtains PCR product 1353bp altogether, called after O-EPSP synthase gene.The O-EPSP synthase gene is made up of 1353 Nucleotide, shown in SEQ ID No:1; O-EPSP synthase gene encoded protein matter is made up of 450 amino acid, shown in SEQ ID No:2.
The structure of embodiment 3 plant expression vector PTG2-OEPS
According to the O-EPSP synthase sequence, design primer 7-F and 7-R
Primer 7-F(sequence is shown in SEQ ID No:15): ACATGTATGTCCCATTCCGCATGC
Primer 7-R(sequence is shown in SEQ ID No:16): CCCGGGTCATTCTGCTGCGCCCG
Carry out pcr amplification with primer 7-F and the O-EPSP synthase sequence of 7-R, cut with Pci I and Xma I enzyme then, obtain inserting fragment; The company of getting cuts with Pci I and Xma I enzyme from the PTG1 carrier of preserving, connect above-mentioned insertion fragment and carrier with ligase enzyme then, to connect product transformed into escherichia coli DH5 α bacterial strain, select positive colony after 2 * YT culture medium culturing screening through containing the 50mg/L kantlex, extract plasmid and select the correct clone of sequence by order-checking, the plasmid that must have target gene, called after PTG2-OEPS sees accompanying drawing 1.
Embodiment 4: Plant Transformation, screening in seedling stage
Plant Transformation: the plant expression vector that builds is transformed Agrobacterium AgL0, be used for transforming and plant (work) thing: Arabidopis thaliana, tobacco, cotton, paddy rice, corn, soybean, wheat, rape, turfgrass and herbage etc.
The arabidopsis thaliana transformation result is as follows:
T1 screens for the Arabidopis thaliana seedling:The Agrobacterium-mediated Transformation Arabidopis thaliana that contains recombinant vectors, results T0 spray the glyphosate of 2.5mM for seed and sowing when it grows 4 leaves.After 7 days, not genetically modified Arabidopis thaliana seedling is withered, and transgenic positive seedling growth conditions is good.The results are shown in accompanying drawing 2.
Arabidopis thaliana T2 detects for the experiment of transgenic positive seedling glyphosate tolerance and PCR
Positive transgenosis T1 is expanded numerous to T2 generation for Arabidopis thaliana, when it grows 4 leaves, spray the glyphosate of 5mM, 10mM and 20mM respectively.Obtain well-grown transgenosis T2 generation (the results are shown in accompanying drawing 3) after 7 days.Wherein, change the transgenic arabidopsis of O-EPSP synthase gene and the glyphosate that positive control (changeing the CP4-EPSP synthase gene) can both tolerate 20mM.Carry out PCR with primer 7-F and 7-R, further verify the positive of transgenic line at molecular level.Two tender leafs are got in every strain, extract plant genome DNA with the CTAB method.Utilizing primer 7-F and 7-R respectively, is template with the resistant plant genomic dna, amplification O-EPSP synthase gene fragment.The PCR product is carried out 0.8% agarose gel electrophoresis detect, can detect the purpose fragment (the results are shown in accompanying drawing 4) of 1353bp.We have carried out the PCR experiment to 7 strain systems, and the result all is positive.This has proved that further the Arabidopis thaliana plant that we obtain is the transgenic positive strain system with glyphosate resistance.
The result of transformation of tobacco is as follows:
T0 is for the screening stage of tobacco seedling:The Agrobacterium conversion tobacco that contains recombinant vectors, results T0 spray the glyphosate of 2.5mM for seed and sowing when it grows 4-5 sheet spire.After 7 days, not genetically modified tobacco seedling is withered, and transgenic positive seedling growth conditions is good.
The Molecular Detection in transgenic tobacco plant T0 generation:
The transgenic tobacco plant T0 that the preliminary screening of learning from else's experience obtains is for blade, extracts genomic dna, carries out PCR with primer 7-F and primer 7-R and detects, and expands to such an extent that big or smallly be the OEPSP synthase gene of 1353bp.Positive more than 86% as a result.The positive tobacco T0 that finishing screen is selected is for plant 15 strains.
For the tobacco plant resistance screening:
The T1 that obtains is carried out the glyphosate resistance experiment for 15 strains systems of tobacco, at first with on per approximately 100 sections that are planted in experimental box of tobacco seed, wait to grow spire 4-5 leaf in the time of about 30 days, seedling is sprayed certain density glyphosate.
Be that the glyphosate of 2.5mM, 5mM, 10mM and 20mM sprays seedling with concentration, add wild-type as negative control, found that handle under the condition of 2.5mM one week the back wild-type all withered, the transgenosis sample there is no obvious damage (accompanying drawing 5); And under the condition of 20mM, just all withered behind the wild-type processing 2d, still had a large amount of transgenic tobacco plant well-growns, show good glyphosate resistance.This shows that the tobacco portion plant division system that changes the O-EPSP synthase gene has shown good glyphosate tolerant, this gene has been realized good expression in tobacco.
The converting cotton result is as follows:
T0 is for the screening of transgenic cotton flower seedling:Recombinant vectors transforms the plant cotton, with glyphosate as selective agent screening T0 for transgene cotton, from transgenic seedling, extract genomic dna and carry out the PCR Molecular Detection with primer 7-F and 7-R, from positive T0 for gathering in the crops T1 the transgenic cotton plant for seed.
Resistance screening for cotton strain system:
The screening that T1 for the cotton strain is: T1 is for seed in sowing, treats the long 4-5 leaf that arrives of strain system during the phase, sprinkling glyphosate screening resistance seedling.The glyphosate experimental concentration that sprays has 2.5mM, 5mM, 10mM and 20mM.Found that: the wild-type cotton is withered during 2.5mM, the transgene cotton well-grown.When glyphosate concentration reached 20mM, transgene cotton still showed good resistance glyphosate ability.
Can draw from the resistance result: the cotton part strain system that changes the O-EPSP synthase gene has shown good glyphosate tolerant, and this gene has been realized good expression in cotton, and tolerance concentration is 4 times of field spray concentration.
The rice transformation result is as follows:
The screening stage of paddy rice tissue cultured seedling:Recombinant vectors is transformed the plant paddy rice, carry out PCR Molecular Detection for extracting genomic dna the transgenic paddy rice seedling with primer 7-F and 7-R from T0, positive rate is more than 90% as a result.Get positive T0 for the transgenic paddy rice seedling, T1 is for seed for results.
Resistance screening for rice strain:
T1 sprays the glyphosate of 2.5mM, 5mM, 10mM and 20mM respectively when growing 3-4 sheet leaf for paddy rice.Obtain well-grown transgenosis T1 generation (the results are shown in accompanying drawing 6) after 7 days.Found that: the wild-type paddy rice is withered during 2.5mM, the transgenic paddy rice well-grown.When glyphosate concentration reaches 20mM, still have the plant of part strain system to have the resistance glyphosate ability, carry out PCR with primer 7-F and 7-R, further verify the positive of transgenic line at molecular level.The resistant rice seedling that the result shows survival is positive seedling all.From top result as can be seen: the paddy rice part strain system that changes the O-EPSP synthase gene has also shown good glyphosate tolerant, and this gene has been realized good expression in paddy rice, and tolerance concentration is 8 times of field spray concentration.
The maize transformation result is as follows:
T1 screens for transgenic corns:The Agrobacterium-mediated Transformation corn that the contains recombinant vectors parent of isozygotying, results T0 sprays the glyphosate of 2.5mM, 5mM, 10mM and 20mM for seed and sowing when it grows 4 leaves.After 7 days, not genetically modified maize seedling is withered, transgenic positive seedling growth conditions good (accompanying drawing 6).Found that: the wild-type corn is withered during 2.5mM, the transgenic corns well-grown.When glyphosate concentration reaches 20mM, still have the transgenic corns seedling well-grown of part strain system, show good resistance glyphosate ability.Obtaining the high-resistance corn strain altogether is 8 strains.
From top result as can be seen: the corn part strain system that changes the O-EPSP synthase gene has also shown good glyphosate tolerant, and this gene has been realized good expression in corn, and tolerance concentration is 8 times of field spray concentration.
Soybean transformation result is as follows:
The screening of soybean tissue cultured seedling: recombinant vectors transforms the food crop soybean, directly becomes seedling as selective agent at substratum with glyphosate.T1 does not screen for direct expansion is numerous, and it is that the individual plant receipts are planted that a seed becomes seedling to calculate a strain, and it is that glyphosate concentration is 2.5mM, 5mM, 10mM and 20mM that T2 directly screens resistant strain for the sprinkling glyphosate.
Found that: the wild-type soybean is withered during 2.5mM, genetically engineered soybean well-grown (accompanying drawing 7).When glyphosate concentration reached 20mM, the soybean plant strain that changes the O-EPSP synthase gene still showed good resistance glyphosate ability.Extract genomic dna and carry out the PCR Molecular Detection with primer 7-F and primer 7-R from the transgenic seedling blade, resistant plant is the transgenic positive seedling as a result.
From top result as can be seen: the soybean part strain system that changes the O-EPSP synthase gene has also shown good glyphosate tolerant, and this gene has been realized good expression in soybean, and tolerance concentration is 5 times of field spray concentration.
SEQUENCE LISTING
＜110〉Beijing Weiming Kaituo Crops Design Center Ltd
＜120〉a kind of epsp synthase gene and application thereof that derives from human pallid bacillus
<130>
<150> 201210220299.2
<151> 2012-06-28
<160> 16
<170> PatentIn version 3.3
<210> 1
<211> 1353
<212> DNA
＜213〉human pallid bacillus (Ochrobactrum anthropi)
<400> 1
atgtcccatt ccgcatgccc gaaacccgca accgcccgcc gctcggaggc tctggtcggc 60
gaaatccgta ttccgggcga caagtccatc tcgcaccgtt ccttcatgtt cgggggcctt 120
gcttcgggtg aaacccgcat caccggcctg ctggaaggcg aggacgtcat caataccggc 180
cgcgccatgc aggccatggg tgcgaaaatc cgcaaggatg gcgacgtctg gatcatcgat 240
ggcgttggaa acggctgcct gctggaaccg gaagcgccgc tcgacttcgg caatgcggga 300
accggcgccc gccttaccat gggtctggtc ggcacctatg acatgaagac ctcgtttatc 360
ggcgacgcct cgctgtcgaa gcgcccgatg ggccgcgtgc tgaacccgtt gcgcgaaatg 420
ggcgtacagg tggaagcagc cgatggcgac cgtatgccgc tgacgctgat cggccccagg 480
acagccaatc cgatcaccta tcgcgtgccg atggcatccg cgcaggtgaa atccgccgtg 540
ctgctcgccg gtctcaacac gccgggcgtc accaccgtcg tcgaaccggt catgacgcgc 600
gaccatacgg aaaagatgct acagggcttc ggcgccgacc tgacggttga aaccgacaag 660
gatggcgtgc gccatatccg catcgccgga cagggcaagc tggccggtca ggtgatcgac 720
gtgccgggcg acccctcctc gaccgctttc ccgctcgtcg ccgcccttct ggtcgaaggt 780
tcggacgtca ccattcgcaa cgtcctgatg aacccgaccc gcaccggcct cattctcaca 840
ttgcaggaaa tgggcgcgga tatcgaagtg ctcaacgaac gtctcgcggg cggcgaggat 900
gtcgccgacc tgcgcgtaag atcgtcggac ctcaagggcg tcacggttcc gccggaccgc 960
gcgccctcga tgatcgacga atatccggtg ctggccgtcg ccgcttcctt tgccgaaggc 1020
gagacgatca tggacggcct cgacgaattg cgcgtgaagg aatcggatcg tctggccgca 1080
gtcgcgcgcg gtctcgaagc caatggcgtc gattgcaccg aaggcgagat gtcgctgacg 1140
gtgcgcggtc gtccgggcgg caagggcttg ggcggcggca cggtcgcaac ccacctcgac 1200
caccgcatcg ccatgagctt cctcgtcatg gggctggcct ccgaaaaacc tgtcacggtc 1260
gacgacagca acatgatcgc cacctcgttc cccgaattca tgaccatgat gccggatctg 1320
ggcgcgaaaa tcgaaccggg cgcagcagaa tga 1353
<210> 2
<211> 450
<212> PRT
＜213〉human pallid bacillus (Ochrobactrum anthropi)
<400> 2
Met Ser His Ser Ala Cys Pro Lys Pro Ala Thr Ala Arg Arg Ser Glu
1 5 10 15
Ala Leu Val Gly Glu Ile Arg Ile Pro Gly Asp Lys Ser Ile Ser His
20 25 30
Arg Ser Phe Met Phe Gly Gly Leu Ala Ser Gly Glu Thr Arg Ile Thr
35 40 45
Gly Leu Leu Glu Gly Glu Asp Val Ile Asn Thr Gly Arg Ala Met Gln
50 55 60
Ala Met Gly Ala Lys Ile Arg Lys Asp Gly Asp Val Trp Ile Ile Asp
65 70 75 80
Gly Val Gly Asn Gly Cys Leu Leu Glu Pro Glu Ala Pro Leu Asp Phe
85 90 95
Gly Asn Ala Gly Thr Gly Ala Arg Leu Thr Met Gly Leu Val Gly Thr
100 105 110
Tyr Asp Met Lys Thr Ser Phe Ile Gly Asp Ala Ser Leu Ser Lys Arg
115 120 125
Pro Met Gly Arg Val Leu Asn Pro Leu Arg Glu Met Gly Val Gln Val
130 135 140
Glu Ala Ala Asp Gly Asp Arg Met Pro Leu Thr Leu Ile Gly Pro Arg
145 150 155 160
Thr Ala Asn Pro Ile Thr Tyr Arg Val Pro Met Ala Ser Ala Gln Val
165 170 175
Lys Ser Ala Val Leu Leu Ala Gly Leu Asn Thr Pro Gly Val Thr Thr
180 185 190
Val Val Glu Pro Val Met Thr Arg Asp His Thr Glu Lys Met Leu Gln
195 200 205
Gly Phe Gly Ala Asp Leu Thr Val Glu Thr Asp Lys Asp Gly Val Arg
210 215 220
His Ile Arg Ile Ala Gly Gln Gly Lys Leu Ala Gly Gln Val Ile Asp
225 230 235 240
Val Pro Gly Asp Pro Ser Ser Thr Ala Phe Pro Leu Val Ala Ala Leu
245 250 255
Leu Val Glu Gly Ser Asp Val Thr Ile Arg Asn Val Leu Met Asn Pro
260 265 270
Thr Arg Thr Gly Leu Ile Leu Thr Leu Gln Glu Met Gly Ala Asp Ile
275 280 285
Glu Val Leu Asn Glu Arg Leu Ala Gly Gly Glu Asp Val Ala Asp Leu
290 295 300
Arg Val Arg Ser Ser Asp Leu Lys Gly Val Thr Val Pro Pro Asp Arg
305 310 315 320
Ala Pro Ser Met Ile Asp Glu Tyr Pro Val Leu Ala Val Ala Ala Ser
325 330 335
Phe Ala Glu Gly Glu Thr Ile Met Asp Gly Leu Asp Glu Leu Arg Val
340 345 350
Lys Glu Ser Asp Arg Leu Ala Ala Val Ala Arg Gly Leu Glu Ala Asn
355 360 365
Gly Val Asp Cys Thr Glu Gly Glu Met Ser Leu Thr Val Arg Gly Arg
370 375 380
Pro Gly Gly Lys Gly Leu Gly Gly Gly Thr Val Ala Thr His Leu Asp
385 390 395 400
His Arg Ile Ala Met Ser Phe Leu Val Met Gly Leu Ala Ser Glu Lys
405 410 415
Pro Val Thr Val Asp Asp Ser Asn Met Ile Ala Thr Ser Phe Pro Glu
420 425 430
Phe Met Thr Met Met Pro Asp Leu Gly Ala Lys Ile Glu Pro Gly Ala
435 440 445
Ala Glu
450
<210> 3
<211> 24
<212> DNA
＜213〉artificial sequence
<400> 3
atgcaggcca tgggtgccag gatt 24
<210> 4
<211> 24
<212> DNA
＜213〉artificial sequence
<400> 4
gcgatgcggt ggtcgaggtg ggtt 24
<210> 5
<211> 29
<212> DNA
＜213〉artificial sequence
<400> 5
cgggatccat gtcccattcc gcatgcccg 29
<210> 6
<211> 35
<212> DNA
＜213〉artificial sequence
<400> 6
ccgctcgagc gacattctgc accgctttcg gcaat 35
<210> 7
<211> 22
<212> DNA
＜213〉artificial sequence
<400> 7
gatgcctcgc tttccaagcg cc 22
<210> 8
<211> 23
<212> DNA
＜213〉artificial sequence
<400> 8
gccagacgat ccgattcctt gac 23
<210> 9
<211> 23
<212> DNA
＜213〉artificial sequence
<400> 9
cgtgttgaga ccggcgagca gca 23
<210> 10
<211> 23
<212> DNA
＜213〉artificial sequence
<400> 10
gacccctcct cgaccgcttt ccc 23
<210> 11
<211> 23
<212> DNA
＜213〉artificial sequence
<400> 11
gtgatcggat tggctgtcct ggg 23
<210> 12
<211> 23
<212> DNA
＜213〉artificial sequence
<400> 12
gtaagatcgt cggacctcaa ggg 23
<210> 13
<211> 28
<212> DNA
＜213〉artificial sequence
<400> 13
cggatccatg tcccattccg catgcccg 28
<210> 14
<211> 30
<212> DNA
＜213〉artificial sequence
<400> 14
gctcgagcga cattctgctg cgcccggttc 30
<210> 15
<211> 24
<212> DNA
＜213〉artificial sequence
<400> 15
acatgtatgt cccattccgc atgc 24
<210> 16
<211> 23
<212> DNA
＜213〉artificial sequence
<400> 16
cccgggtcat tctgctgcgc ccg 23
Claims (13)
1. make plant have the gene of glyphosate resistance, it is characterized in that, the nucleotide sequence of described gene is shown in SEQ ID NO:1.
2. the described gene of claim 1 is characterized in that, the aminoacid sequence of its encoded protein matter is shown in SEQ ID No:2.
3. make plant have the protein of glyphosate resistance, be characterised in that, the aminoacid sequence of described protein is shown in SEQ ID No:2.
4. expression cassette, carrier or cell, it comprises the described gene of claim 1-2.
5. plant, it comprises the described gene of claim 1-2, and perhaps it expresses the described protein of claim 3.
6. the described gene of claim 1-2, the described protein of claim 3, the described expression cassette of claim 4, carrier or cell are in the application that strengthens on the plant glyphosate resistance.
7. the described application of claim 6 is characterized in that, with glyphosate resistance gene transfered plant tissue, cell or organ, obtains the plant that glyphosate resistance strengthens.
8. acquisition has the method for the plant of glyphosate resistance, and it comprises the steps:
(1) make plant comprise the described gene of claim 1-2; And/or,
(2) make the described protein of expression of plants claim 3.
9. method according to claim 8, step such as it comprises transgenosis, hybridizes, backcrosses, selfing or vegetative propagation.
10. identify the method for the plant that the described plant of claim 5 or claim 8 or 9 described methods obtain, it comprises the steps:
(1) measures the gene whether described plant comprises first aspect present invention; And/or,
(2) measure the protein whether described plant expresses second aspect present invention.
11. the described method of claim 10, it is characterized in that, from described transgenic plant or its offspring, seed, carry out the amplification of the nucleotide sequence shown in SEQ ID NO:1, the sequence that amplifies is carried out sequential analysis and compared with the gene order shown in the claim 1.
12. each is described according to claim 1-11, it is characterized in that: described plant comprises monocotyledons or dicotyledons.
13. plant according to claim 12 is characterized in that, described monocotyledons is paddy rice, corn, wheat, and described dicotyledons is Arabidopis thaliana, tobacco, cotton, soybean, rape etc.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310233524.0A CN103290036B (en) | 2012-06-28 | 2013-06-13 | 5-enolpyruvyl-shikimate-3-phosphate (EPSP) synthase gene from ochrobactrum anthropi and application thereof |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210220299.2 | 2012-06-28 | ||
| CN201210220299 | 2012-06-28 | ||
| CN201310233524.0A CN103290036B (en) | 2012-06-28 | 2013-06-13 | 5-enolpyruvyl-shikimate-3-phosphate (EPSP) synthase gene from ochrobactrum anthropi and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103290036A true CN103290036A (en) | 2013-09-11 |
| CN103290036B CN103290036B (en) | 2014-11-05 |
Family
ID=49091566
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310233524.0A Active CN103290036B (en) | 2012-06-28 | 2013-06-13 | 5-enolpyruvyl-shikimate-3-phosphate (EPSP) synthase gene from ochrobactrum anthropi and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103290036B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111560326A (en) * | 2020-04-08 | 2020-08-21 | 华南农业大学 | Ochrobactrum intermedium26B and application thereof |
| CN114717159A (en) * | 2022-05-10 | 2022-07-08 | 华南农业大学 | Human ochrobactrum anthropi for efficiently degrading glyphosate and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5627061A (en) * | 1990-08-31 | 1997-05-06 | Monsanto Company | Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases |
| CN101479387A (en) * | 2006-06-27 | 2009-07-08 | 阿则耐克斯公司 | Grg33, grg35, grg36, grg37, grg38, grg39, and grg50: novel epsp synthase genes conferring herbicide resistance |
| CN101831443A (en) * | 2010-03-25 | 2010-09-15 | 中国农业科学院生物技术研究所 | Gene for encoding 5-enolpyrul-shikimate-3-phosphate synthase and application thereof |
| CN102108363A (en) * | 2009-12-24 | 2011-06-29 | 上海市农业科学院 | EPSP synthase gene derived from ochrobactrum anthropi and application thereof |
-
2013
- 2013-06-13 CN CN201310233524.0A patent/CN103290036B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5627061A (en) * | 1990-08-31 | 1997-05-06 | Monsanto Company | Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases |
| CN101479387A (en) * | 2006-06-27 | 2009-07-08 | 阿则耐克斯公司 | Grg33, grg35, grg36, grg37, grg38, grg39, and grg50: novel epsp synthase genes conferring herbicide resistance |
| CN102108363A (en) * | 2009-12-24 | 2011-06-29 | 上海市农业科学院 | EPSP synthase gene derived from ochrobactrum anthropi and application thereof |
| CN101831443A (en) * | 2010-03-25 | 2010-09-15 | 中国农业科学院生物技术研究所 | Gene for encoding 5-enolpyrul-shikimate-3-phosphate synthase and application thereof |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111560326A (en) * | 2020-04-08 | 2020-08-21 | 华南农业大学 | Ochrobactrum intermedium26B and application thereof |
| CN111560326B (en) * | 2020-04-08 | 2022-04-29 | 华南农业大学 | Ochrobactrum intermedium26B and application thereof |
| CN114717159A (en) * | 2022-05-10 | 2022-07-08 | 华南农业大学 | Human ochrobactrum anthropi for efficiently degrading glyphosate and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103290036B (en) | 2014-11-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106086010B (en) | For detecting the nucleic acid sequence and its detection method of herbicide-tolerant soybean plant DBN9008 | |
| CN109868273B (en) | Nucleic acid sequence for detecting corn plant DBN9501 and detection method thereof | |
| KR101899619B1 (en) | Methods of weed control involving aad-1 plants, and re-plant and/or pre-emergence herbicide applications | |
| CN106086011B (en) | For detecting the nucleic acid sequence and its detection method of herbicide-tolerant soybean plant DBN9004 | |
| CN102316720A (en) | Corn event 5307 | |
| KR20080050548A (en) | Soybean event mon89788 and methods for detection thereof | |
| CN111247255B (en) | Nucleic acid sequence for detecting soybean plant DBN8007 and detection method thereof | |
| CN104878094B (en) | For detecting the nucleic acid sequence and its detection method of herbicide tolerant corn plant DBN9888 | |
| CN111406117B (en) | Nucleic acid sequence for detecting soybean plant DBN8002 and detection method thereof | |
| CN103718895A (en) | Method for controlling injurious insects | |
| CN104878096B (en) | For detecting the nucleic acid sequence and its detection method of herbicide tolerant corn plant DBN9868 | |
| CN109971880A (en) | For detecting the nucleic acid sequence and its detection method of corn plant DBN9508 | |
| WO2023155193A1 (en) | Nucleic acid sequence for detecting glycine max plant dbn8205 and detection method therefor | |
| CN102936591A (en) | Acetolactic acid synthetase mutants and application thereof | |
| CN103266118B (en) | Cabbage type rape anti-sulfonylurea herbicide gene and application thereof | |
| CN103290036B (en) | 5-enolpyruvyl-shikimate-3-phosphate (EPSP) synthase gene from ochrobactrum anthropi and application thereof | |
| CN106119245B (en) | For detecting the nucleic acid sequence and its detection method of herbicide-tolerant soybean plant DBN9001 | |
| CN108291236B (en) | Plant EPSP synthases and methods of use | |
| WO2017128301A1 (en) | Glyphosate-tolerant epsps gene screening method and use thereof | |
| CN116732215A (en) | Nucleic acid sequence for detecting corn plant DBN9229 and detection method thereof | |
| CN103695446B (en) | A kind of epsp synthase gene deriving from pseudomonas putida and application thereof | |
| CN116219063A (en) | Nucleic acid sequence for detecting corn plant DBN9235 and detection method thereof | |
| CN111560055B (en) | Application of rice gene OsLAT3 in regulation of absorption and accumulation of diquat | |
| CN104878090B (en) | For detecting the nucleic acid sequence and its detection method of herbicide tolerant corn plant DBN9877 | |
| WO2018183050A2 (en) | Improved plant epsp synthases and methods of use |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| PP01 | Preservation of patent right | ||
| PP01 | Preservation of patent right |
Effective date of registration: 20230815 Granted publication date: 20141105 |