CN103289998B - Molecular marker of pure white Hypsizygus marmoreus Finc-W-247, its acquisition method and application - Google Patents
Molecular marker of pure white Hypsizygus marmoreus Finc-W-247, its acquisition method and application Download PDFInfo
- Publication number
- CN103289998B CN103289998B CN201310030553.7A CN201310030553A CN103289998B CN 103289998 B CN103289998 B CN 103289998B CN 201310030553 A CN201310030553 A CN 201310030553A CN 103289998 B CN103289998 B CN 103289998B
- Authority
- CN
- China
- Prior art keywords
- finc
- pure white
- hypsizygus marmoreus
- molecule marker
- white hypsizygus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The invention relates to a molecular marker of a pure white Hypsizygus marmoreus Finc-W-247. Its specific PCR amplification primer pair sequences are 5'-GACGACGTTTGTGGGGTGA-3' and 5'-AGGGAGATCGACGTCCATATTG-3', and the size of its DNA fragment is 975bp. The invention also discloses an acquisition method and application of the molecular marker of the pure white Hypsizygus marmoreus Finc-W-247.
Description
[technical field]
The invention belongs to microbial technology field, be specifically related to the molecule marker of a kind of pure white Hypsizygus marmoreus Finc-W-247 and preparation method thereof and application.
[background technology]
Hypsizygus marmoreus (Latin title Hypsizygus marmoreus), is subordinate to Basidiomycotina, Hymenomycetes, Agaricales, Bai Mo section, beautiful gill fungus belongs to, and because it has unique crab delicate flavour, therefore is crab mushroom also known as it.Initial artificial culture started from Japan before and after 1978, and its delicious flavour, sense of food are tender and crisp, nutritious, and its taste is fresher than flat mushroom, and its meat is thicker than sliding mushroom, and its matter is more tough than mushroom, and mouthfeel is excellent, and its dry product also thick flavor overflows.Hypsizygus marmoreus contains abundant VITAMIN and 17 seed amino acids, and the beta-glucan extracted in sporophore has very high anti-tumor activity, is a kind of low in calories, low-fat protective foods.
Tradition edible fungus species is differentiated, especially for Hypsizygus marmoreus, its Main Basis is the mode of appearance, antagonistic effect, fruiting contrast etc. of sporophore.Mode of appearance is subject to the impact of planting environment and formula, causes the difficulty that mode of appearance is identified.Between the bacterial strain that sibship is nearer (such as, between some parent and filial generation), antagonism is not obvious, differentiates that bacterial classification also has difficulties by antagonistic effect.At least 4 months consuming time of fruiting simultaneous test, is unfavorable for the Identification and detection of bacterial classification.Along with molecular biological development, molecular labeling method is more and more widely for the discriminating of bacterial classification.SCAR (Sequence-characterized AmplifiedRegion) mark is a kind of very stable molecule marker, can be easy, quick, stable carry out strain identification, but not yet there is the SCAR molecule marker to pure white Hypsizygus marmoreus Finc-W-247 at present, with Rapid identification pure white Hypsizygus marmoreus Finc-W-247.
[summary of the invention]
The technical problem that the present invention solves overcomes the defect that prior art exists, and provides the molecule marker of a kind of pure white Hypsizygus marmoreus Finc-W-247 and preparation method thereof and application.
The present invention's a large amount of shaker test that adopted round pcr to carry out, wherein, random primer (sequence is: GTCCCGACGA) is adopted to obtain the specific DNA fragment of Hypsizygus marmoreus Finc-W-247 bacterial strain or its sporophore, molecular weight is 989bp, by this fragment cloning and sequencing, based on the DNA sequence dna of this fragment, design specific PCR amplification primer, its special primer to sequence is:
5'-GACGACGTTTGTGGGGTGA-3' and 5'-AGGGAGATCGACGTCCATATTG-3'.This primer pair carries out SCAR-PCR amplification to Hypsizygus marmoreus Finc-W-247 bacterial strain or its sporophore, can obtain the specific fragment that molecular size range is 975bp, is the molecule marker of pure white Hypsizygus marmoreus bacterial strain Finc-W-247; Wherein, the concrete sequence of the molecule marker of described Finc-W-247 is:
5'-gacgacgtttgtggggtgaacgatcccgaattgcaggatcccctcctccaatcacaatatgaaggcttgccatttctgccgtgagtcgacctgtttgggaaaaatcagaaagcgccactcatcttcatcgttcacctttcttttatagcggcaaatgttccatctacgggtggagcaccaagcagagcatcgtacctgggtggacgatgttctctaagtgggggaagcaaaacccaaatttgaatgtggggtatgtcgctgaggctattaatgtaaagcaatcctgacgctttccaggctcgcggttcagagcttgaaattcgttcgatcggggcgttatgtcaatcccagccgaattgcaccccttcatctctcaactcgagttgtttacggtagcgccgacaccaggcgccttcataccagtggaggctctgccatatgcgtctctaccatcttctccgcagagtctcttctcgtcaacggcagagagcagggtatggcgcaaaaacttctctccggcatatttcacagtcaagagtggcagcgcttcgaagctatgatgtgcttggcttttactcaccgccgattgaaagcgcagtacaacaatcatgctttggacttttgcacaaggcccagaccccaaggaaagtctcccgccctttgctatacgcttttttctttccgcggttgttcaaaagcagtggcttaacctgttctttccatagatgccaccagctcctccgtcggttccaagttcagcgctgccgacggaatgttcggggcggcgcccgccaaaggaaaagcggagtccagtcacgggcactcccctgttacaaacaagcctgtcctggattttgacgatgaaggtcacttcccctttcatgatctgcgtagaatcatactcatccatgttcgtttccagtacctgtctttgatgggcgtaacaccaccatcaatatggacgtcgatctccct-3'。
The present invention also discloses the preparation method of the molecule marker of a kind of pure white Hypsizygus marmoreus Finc-W-247, it is characterized in that comprising the steps:
1) " Finc-W-247 ", " H-W ", " G-W ", the mycelia of " GC-W " bacterial strain or sporophore is obtained;
2) extracting genome DNA;
3) RAPD method analysis obtain specific DNA fragment: adopt the analysis of RAPD method, obtain the specific DNA fragment of pure white Hypsizygus marmoreus Finc-W-247, the random primer sequence obtaining this fragment corresponding is: GTCCCGACGA;
4) special primer design: based on the specific DNA fragment sequence of above-mentioned acquisition, design specific PCR amplification primer, primer pair sequence is 5'-GACGACGTTTGTGGGGTGA-3' and 5'-AGGGAGATCGACGTCCATATTG-3';
5) pcr amplification of SCAR molecule marker: carry out SCAR-PCR amplification with the genome of specific PCR amplification primer pair pure white Hypsizygus marmoreus Finc-W-247, obtain the specific molecular marker of 975bp.
6) electrophoresis detection;
Wherein, the concrete sequence of the molecule marker of described Finc-W-247 is:
5'-gacgacgtttgtggggtgaacgatcccgaattgcaggatcccctcctccaatcacaatatgaaggcttgccatttctgccgtgagtcgacctgtttgggaaaaatcagaaagcgccactcatcttcatcgttcacctttcttttatagcggcaaatgttccatctacgggtggagcaccaagcagagcatcgtacctgggtggacgatgttctctaagtgggggaagcaaaacccaaatttgaatgtggggtatgtcgctgaggctattaatgtaaagcaatcctgacgctttccaggctcgcggttcagagcttgaaattcgttcgatcggggcgttatgtcaatcccagccgaattgcaccccttcatctctcaactcgagttgtttacggtagcgccgacaccaggcgccttcataccagtggaggctctgccatatgcgtctctaccatcttctccgcagagtctcttctcgtcaacggcagagagcagggtatggcgcaaaaacttctctccggcatatttcacagtcaagagtggcagcgcttcgaagctatgatgtgcttggcttttactcaccgccgattgaaagcgcagtacaacaatcatgctttggacttttgcacaaggcccagaccccaaggaaagtctcccgccctttgctatacgcttttttctttccgcggttgttcaaaagcagtggcttaacctgttctttccatagatgccaccagctcctccgtcggttccaagttcagcgctgccgacggaatgttcggggcggcgcccgccaaaggaaaagcggagtccagtcacgggcactcccctgttacaaacaagcctgtcctggattttgacgatgaaggtcacttcccctttcatgatctgcgtagaatcatactcatccatgttcgtttccagtacctgtctttgatgggcgtaacaccaccatcaatatggacgtcgatctccct-3'。
Described step 3) the pcr amplification reaction system of RAPD method is: cumulative volume 25 μ L: genomic templates 20-30ng/ μ L 1.0 μ L, random primer 0.5pmol/ μ L 1.0 μ L, 10mM dNTP mix 0.5 μ L, 10 × Taq damping fluid 2.5 μ L, 25mM MgCl
22.0 μ L, Taq enzyme 5U/ μ L 0.25 μ L, adds water to 25 μ L.PCR reaction conditions: denaturation 95 DEG C of 3min; 94 DEG C of 45s, 36 DEG C of 60s, 72 DEG C of 2min, 35 circulations; 72 DEG C extend 10min.Pure white Hypsizygus marmoreus Finc-W-247 bacterial strain or its sporophore specific DNA fragment size are 989bp.
Described step 5) in the pcr amplification of SCAR molecule marker, its system is: cumulative volume 25 μ L, template 20 ~ 30ng/ μ L 1 μ L, Hypsizygus marmoreus Finc-W-247 special primer is to each 0.5 μ L of 0.5pmol/ μ L, 10mM dNTP mix 0.5 μ L, 10 × Taq Buffer2.5 μ L, 25mM MgCl
22.0 μ L, Taq enzyme 5U/ μ L 0.25 μ L, adds water to 25 μ L.PCR reaction conditions: denaturation 95 DEG C of 3min; 94 DEG C of 30s, 62 DEG C of 30s, 72 DEG C of 1min, 35 circulations; 72 DEG C extend 5min.
The molecule marker that the present invention discloses again a kind of pure white Hypsizygus marmoreus Finc-W-247 is used for the Rapid identification of pure white Hypsizygus marmoreus Finc-W-247 bacterial strain and the application of detection; Be specially and adopt pure white Hypsizygus marmoreus Finc-W-247 bacterial strain special primer to carry out pcr amplification to pure white Hypsizygus marmoreus bacterial strain, according to the DNA fragmentation that can produce 975bp size, as the foundation of pure white Hypsizygus marmoreus Finc-W-247 bacterial strain being carried out to Identification and detection.
Morphologic detection, the antagonistic effect of above-mentioned detection method and routine are compared with authentication methods such as cultivation fruiting contrasts, have the advantage that detection time is short, accuracy is high.It can overcome morphologic detection, antagonistic effect poor accuracy, can overcome again the shortcoming that cultivation fruiting contrasts length consuming time.Present method is being applied to discovery in existing white Hypsizygus marmoreus bacterial strain detection, and it has the specificity of Finc-W-247 bacterial strain or its sporophore.
[accompanying drawing explanation]
Fig. 1 is the electrophoretogram of random primer S67 to the pcr amplification product of 4 pure white Hypsizygus marmoreus bacterial strains, and wherein 1 is H-W, and 2 is Finc-W-247, and 3 is G-W, and 4 be GC-W, M is 10kbp DNAladder.
Fig. 2 is the electrophoretogram of special primer to the pcr amplification product to 4 pure white Hypsizygus marmoreus bacterial strains, and wherein 1 is H-W, and 2 is Finc-W-247, and 3 is G-W, and 4 be GC-W, M is 10kbp DNAladder.
[embodiment]
Below in conjunction with specific embodiment, the present invention is described in further detail.
In the present embodiment, " H-W " is the pure white Hypsizygus marmoreus kind that Japanese Big Dipper Co., Ltd. seed selection in 2002 is released, and its entire body is snow-white, without bitter taste; " G-W " bacterial strain is a kind of Hypsizygus marmoreus bacterial strain commercially, and its former base is grey, and along with the g and D of sporophore bleaches gradually, collection period, stem was canescence, and cap is pure white; " GC-W " bacterial strain is the white beech mushroom bacterial strain that Japanese Ge Cheng is newly bred as.
A preparation method for the molecule marker of pure white Hypsizygus marmoreus Finc-W-247, comprises the steps:
1) strain culturing and aerial hyphae obtain
Finc-W-247 and H-W of cryopreservation, G-W and GC-W are inoculated on PDA substratum, and cultivate 20 days under the condition of temperature 22 DEG C, humidity 75%, scraping aerial hyphae ,-20 DEG C frozen.
2) extracting genome DNA
In the present embodiment, carry out SK1375 fungal genomic DNA extraction agent box specification sheets according to Sangon Biotech's (hereinafter referred to as " raw work ") and extract strain gene group, obtained DNA solution is placed in-20 DEG C of refrigerations, for subsequent use.
3) RAPD method is analyzed
16 random primers (see table 1) are selected to carry out RAPD analysis.PCR amplification system is: cumulative volume 25 μ L; Genomic templates 20-30ng/ μ L 1.0 μ L, random primer 0.5pmol/ μ L 1.0 μ L, 10mMdNTP mix 0.5 μ L, 10 × Taq damping fluid 2.5 μ L, 25mM MgCl
22.0 μ L, Taq enzyme 5U/ μ L0.25 μ L, adds water to 25 μ L.PCR reaction conditions: denaturation 95 DEG C of 3mim; 94 DEG C of 45s, 36 DEG C of 60s, 72 DEG C of 2min, 35 circulations; 72 DEG C extend 10min.
Table 1 random primer
Through screening, random primer S67 can increase and obtain DNA band specific to Finc-W-247 bacterial strain, refers to Fig. 1.As can be seen from Figure 1, the band of a frame position by Finc-W-247 peculiar, and H-W, G-W and GC-W place swimming lane correspondence position all to occur without this band.
The distinctive DNA band of a frame position Finc-W-247 in cutting drawing 1, reclaims DNA.Recovery method reclaims test kit explanation according to raw work UNIQ-10 pillar DNA glue.The DNA reclaimed adopts conventional sequence measurement, and the results are shown in sequence table, it is the DNA fragmentation of 989bp.
4) acquisition of special primer
According to the DNA fragmentation two ends base sequence of above-mentioned 989bp, design specific primer sequences, several base is respectively given up at described DNA fragmentation two ends, and the amplimer of final design is 5'-GACGACGTTTGTGGGGTGA-3' and 5'-AGGGAGATCGACGTCCATATTG-3' to sequence.Adopt the above-mentioned specific primer sequences of Primer premier 5.0 software design in the present embodiment.
5) pcr amplification of SCAR molecule marker
SCAR-PCR amplification is carried out with specific PCR amplification primer pair Finc-W-247 and H-W, G-W and GC-W, its amplification system is: cumulative volume 25 μ L: template 20 ~ 30ng/ μ L 1 μ L, Hypsizygus marmoreus Finc-W-247 special primer is to each 0.5 μ L of 0.5pmol/ μ L, 10mM dNTP mix 0.5 μ L, 10 × Taq Buffer2.5 μ L, 25mM MgCl
22.0 μ L, Taq enzyme 5U/ μ L 0.25 μ L, adds water to 25 μ L.PCR reaction conditions: denaturation 95 DEG C of 3min; 94 DEG C of 30s, 62 DEG C of 30s, 72 DEG C 1min35 circulation; 72 DEG C extend 5min.
6) electrophoresis detection
Get above-mentioned pcr amplification product 6 μ L, mix with 1 μ L sample loading buffer, point sample is on the sepharose of 1.5%, in 0.5 × tbe buffer liquid, electrophoresis under 5V/cm voltage, after electrophoresis terminates, dye with EB, carry out agarose gel electrophoresis, then take a picture on gel imaging instrument, its result refers to Fig. 2 electrophoretogram.
As can be seen from Figure 2, pure white Hypsizygus marmoreus new strains Finc-W-247 bacterial strain of the present invention is only had to have single-minded amplified band, and other three kinds existing pure white Hypsizygus marmoreus bacterial strain H-W, G-W and GC-W are all without amplified band, illustrate that 5'-GACGACGTTTGTGGGGTGA-3' and 5'-AGGGAGATCGACGTCCATATTG-3' is the SCAR molecule marker primer of Finc-W-247.The DNA fragmentation molecular weight amplified with this primer pair is 975bp, and the specific DNA fragment of described 975bp is the SCAR molecule marker of Hypsizygus marmoreus new strains Finc-W-247 of the present invention.
In the present embodiment, adopt mycelia to carry out the extraction of genomic dna, obviously, adopt sporophore can carry out the extraction of genomic dna too.The method extracted, for disclosed in prior art, is not repeating at this.
More than describe and be only embodiments of the invention, forgive and can understand, under the prerequisite not departing from the present invention's design, all should be included within technical conceive of the present invention simple modification of the present invention and replacement.
Claims (5)
1. a molecule marker of pure white Hypsizygus marmoreus Finc-W-247, is characterized in that: specific PCR amplimer to sequence be 5'-GACGACGTTTGTGGGGTGA-3' and
5'-AGGGAGATCGACGTCCATATTG-3', DNA fragmentation size is 975bp; Wherein, the concrete sequence of the molecule marker of described Finc-W-247 is:
5'-gacgacgtttgtggggtgaacgatcccgaattgcaggatcccctcctccaatcacaatatgaaggcttgccatttctgccgtgagtcgacctgtttgggaaaaatcagaaagcgccactcatcttcatcgttcacctttcttttatagcggcaaatgttccatctacgggtggagcaccaagcagagcatcgtacctgggtggacgatgttctctaagtgggggaagcaaaacccaaatttgaatgtggggtatgtcgctgaggctattaatgtaaagcaatcctgacgctttccaggctcgcggttcagagcttgaaattcgttcgatcggggcgttatgtcaatcccagccgaattgcaccccttcatctctcaactcgagttgtttacggtagcgccgacaccaggcgccttcataccagtggaggctctgccatatgcgtctctaccatcttctccgcagagtctcttctcgtcaacggcagagagcagggtatggcgcaaaaacttctctccggcatatttcacagtcaagagtggcagcgcttcgaagctatgatgtgcttggcttttactcaccgccgattgaaagcgcagtacaacaatcatgctttggacttttgcacaaggcccagaccccaaggaaagtctcccgccctttgctatacgcttttttctttccgcggttgttcaaaagcagtggcttaacctgttctttccatagatgccaccagctcctccgtcggttccaagttcagcgctgccgacggaatgttcggggcggcgcccgccaaaggaaaagcggagtccagtcacgggcactcccctgttacaaacaagcctgtcctggattttgacgatgaaggtcacttcccctttcatgatctgcgtagaatcatactcatccatgttcgtttccagtacctgtctttgatgggcgtaacaccaccatcaatatggacgtcgatctccct-3'。
2. a preparation method for the molecule marker of pure white Hypsizygus marmoreus Finc-W-247, is characterized in that comprising the steps:
1) " Finc-W-247 ", " H-W ", " G-W ", the mycelia of " GC-W " bacterial strain or sporophore is obtained;
2) extracting genome DNA;
3) RAPD method analysis obtain specific DNA fragment: adopt the analysis of RAPD method, obtain the specific DNA fragment of pure white Hypsizygus marmoreus Finc-W-247, the random primer sequence obtaining this fragment corresponding is: GTCCCGACGA;
4) special primer design: based on the specific DNA fragment sequence of above-mentioned acquisition, design specific PCR amplification primer, primer pair sequence is 5'-GACGACGTTTGTGGGGTGA-3' and 5'-AGGGAGATCGACGTCCATATTG-3';
5) pcr amplification of SCAR molecule marker: carry out SCAR-PCR amplification with the genome of specific PCR amplification primer pair pure white Hypsizygus marmoreus Finc-W-247, obtain the specific molecular marker of 975bp.
6) electrophoresis detection;
Wherein, the concrete sequence of the molecule marker of described Finc-W-247 is:
5'-gacgacgtttgtggggtgaacgatcccgaattgcaggatcccctcctccaatcacaatatgaaggcttgccatttctgccgtgagtcgacctgtttgggaaaaatcagaaagcgccactcatcttcatcgttcacctttcttttatagcggcaaatgttccatctacgggtggagcaccaagcagagcatcgtacctgggtggacgatgttctctaagtgggggaagcaaaacccaaatttgaatgtggggtatgtcgctgaggctattaatgtaaagcaatcctgacgctttccaggctcgcggttcagagcttgaaattcgttcgatcggggcgttatgtcaatcccagccgaattgcaccccttcatctctcaactcgagttgtttacggtagcgccgacaccaggcgccttcataccagtggaggctctgccatatgcgtctctaccatcttctccgcagagtctcttctcgtcaacggcagagagcagggtatggcgcaaaaacttctctccggcatatttcacagtcaagagtggcagcgcttcgaagctatgatgtgcttggcttttactcaccgccgattgaaagcgcagtacaacaatcatgctttggacttttgcacaaggcccagaccccaaggaaagtctcccgccctttgctatacgcttttttctttccgcggttgttcaaaagcagtggcttaacctgttctttccatagatgccaccagctcctccgtcggttccaagttcagcgctgccgacggaatgttcggggcggcgcccgccaaaggaaaagcggagtccagtcacgggcactcccctgttacaaacaagcctgtcctggattttgacgatgaaggtcacttcccctttcatgatctgcgtagaatcatactcatccatgttcgtttccagtacctgtctttgatgggcgtaacaccaccatcaatatggacgtcgatctccct-3'。
3. the preparation method of the molecule marker of a kind of pure white Hypsizygus marmoreus Finc-W-247 according to claim 2, it is characterized in that: described step 3) the pcr amplification reaction system of RAPD method is: cumulative volume 25 μ L: genomic templates 20-30ng/ μ L 1.0 μ L, random primer 0.5pmol/ μ L 1.0 μ L, 10mMdNTP mix 0.5 μ L, 10 × Taq damping fluid 2.5 μ L, 25mM MgCl
22.0 μ L, Taq enzyme 5U/ μ L0.25 μ L, adds water to 25 μ L; PCR reaction conditions: denaturation 95 DEG C of 3min; 94 DEG C of 45s, 36 DEG C of 60s, 72 DEG C of 2min, 35 circulations; 72 DEG C extend 10min; Pure white Hypsizygus marmoreus Finc-W-247 bacterial strain or its sporophore specific DNA fragment size are 989bp.
4. the preparation method of the molecule marker of a kind of pure white Hypsizygus marmoreus Finc-W-247 according to Claims 2 or 3, it is characterized in that: described step 5) in the pcr amplification of SCAR molecule marker, its system is: cumulative volume 25 μ L, template 20 ~ 30ng/ μ L 1 μ L, Finc-W-247 special primer is to each 0.5 μ L of 0.5pmol/ μ L, 10mM dNTP mix 0.5 μ L, 10 × Taq Buffer2.5 μ L, 25mMMgCl
22.0 μ L, Taq enzyme 5U/ μ L 0.25 μ L, adds water to 25 μ L; PCR reaction conditions: denaturation 95 DEG C of 3min; 94 DEG C of 30s, 62 DEG C of 30s, 72 DEG C of 1min, 35 circulations; 72 DEG C extend 5min.
5. the molecule marker of a kind of pure white Hypsizygus marmoreus Finc-W-247 bacterial strain according to claim 1 is applied to Rapid identification and the detection of pure white Hypsizygus marmoreus Finc-W-247 bacterial strain.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310030553.7A CN103289998B (en) | 2013-01-25 | 2013-01-25 | Molecular marker of pure white Hypsizygus marmoreus Finc-W-247, its acquisition method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310030553.7A CN103289998B (en) | 2013-01-25 | 2013-01-25 | Molecular marker of pure white Hypsizygus marmoreus Finc-W-247, its acquisition method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103289998A CN103289998A (en) | 2013-09-11 |
| CN103289998B true CN103289998B (en) | 2015-04-08 |
Family
ID=49091530
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310030553.7A Active CN103289998B (en) | 2013-01-25 | 2013-01-25 | Molecular marker of pure white Hypsizygus marmoreus Finc-W-247, its acquisition method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103289998B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106434382B (en) * | 2016-10-31 | 2018-12-21 | 上海丰科生物科技股份有限公司 | Pure white true pleurotus cornucopiae bacterial strain and its molecular labeling, specific primer to and application |
| CN106434381B (en) * | 2016-10-31 | 2018-12-21 | 上海丰科生物科技股份有限公司 | Pure white true pleurotus cornucopiae bacterial strain and its molecular labeling, specific primer to and application |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101684487A (en) * | 2008-09-24 | 2010-03-31 | 上海市农业科学院 | Method for identifying industrially cultivated strains of hypsizygus marmoreus by using SSR molecular marker |
-
2013
- 2013-01-25 CN CN201310030553.7A patent/CN103289998B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101684487A (en) * | 2008-09-24 | 2010-03-31 | 上海市农业科学院 | Method for identifying industrially cultivated strains of hypsizygus marmoreus by using SSR molecular marker |
Non-Patent Citations (2)
| Title |
|---|
| 基于特定引物PCR的DNA分子标记技术研究进展;黄龙花 等;《生物技术通报》;20111231(第2期);全部 * |
| 真姬菇子实体ITS序列和RAPD分析;李挺 等;《贵州农业科学》;20111231;第39卷;全部 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103289998A (en) | 2013-09-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Tian et al. | Phylogeny and taxonomy of the Inonotus linteus complex | |
| CN103289997B (en) | The molecule marker of pure white Hypsizygus marmoreus Finc-W-62 bacterial classification and preparation method thereof and application | |
| Paloi et al. | A new species of Russula (Russulales) from eastern Himalaya, India | |
| Jamali et al. | Hosts and distribution of desert truffles in Iran, based on morphological and molecular criteria | |
| CN103289996B (en) | Molecular marker of pure white Hypsizygus marmoreus Finc-W-90, its acquisition method and application | |
| Qasim et al. | Leucoagaricus lahorensis, a new species of L. sect. Rubrotincti | |
| CN103477993B (en) | Pure white new hypsizigus marmoreus bacterial strain | |
| CN103289998B (en) | Molecular marker of pure white Hypsizygus marmoreus Finc-W-247, its acquisition method and application | |
| CN106591145B (en) | A kind of small not whole coccus EF01 separated from radix tetrastigme root tuber and its application | |
| CN103503780B (en) | New pure white hypsizigus marmoreus strain | |
| CN103289999B (en) | Molecular marker of pure white Hypsizygus marmoreus Finc-W-62, its acquisition method and application | |
| CN101086015B (en) | Mushroom 45 bacteria molecular specific mark and its obtaining method and uses | |
| CN103503779B (en) | New pure white hypsizigus marmoreus strain | |
| CN107211727B (en) | A kind of method and application of wild reed mushroom artificial culture | |
| CN101086017B (en) | Mushroom 507 bacteria molecular specific mark and its obtaining method and uses | |
| Ayala-Vasquez et al. | Tricholoma colposii (Tricholomataceae, Basidiomycota), a new edible species of matsutake fungi from Eastern Mexico with economic and biocultural importance | |
| CN103320512B (en) | Volvaria volvacea V14 strain molecular specific detection markers and detection method | |
| CN101402995A (en) | Method for technical evaluation of hedgehog fungus bacterial Houwang with numerator mark | |
| CN101086019A (en) | Mushroom 'Shenxiang'93 bacteria molecular specific mark, and method and uses | |
| CN104313151A (en) | Primer pair and reagent box for identifying acremonium terricola mutagenic strain MKL18 | |
| CN101402994B (en) | Method for technical evaluation of hedgehog fungus Houjie bacterial with molecule labeling technology | |
| Yuan et al. | Dentipellis rhizomorpha sp. nov. supported by morphological and phylogenetic analyses | |
| CN101985657A (en) | Method for identifying hericium erinaceus strain king by utilizing molecule marker technology | |
| Qin et al. | Phellinopsis helwingiae (Hymenochaetales, Basidiomycota), a new species from China and a brief note on P. junipericola | |
| CN101086016B (en) | Lentinus tigrinus 0827 bacteria molecular specific mark and its obtaining method and uses |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |