CN101086016B

CN101086016B - Lentinus tigrinus 0827 bacteria molecular specific mark and its obtaining method and uses

Info

Publication number: CN101086016B
Application number: CN2007100403214A
Authority: CN
Inventors: 谭琦; 陈明杰; 尚晓冬; 宋春艳; 秦莲花; 潘迎捷
Original assignee: Edible Mushroom Research Institute Shanghai Academy Of Agricultural Sciences
Current assignee: Edible Mushroom Research Institute Shanghai Academy Of Agricultural Sciences
Priority date: 2007-04-29
Filing date: 2007-04-29
Publication date: 2010-08-25
Anticipated expiration: 2027-04-29
Also published as: CN101086016A

Abstract

The invention relates to a molecular special mark for Lentinus tigrinus 0827 bacterial and the preparation method and application. The section of molecular marked DNA of Lentinus tigrinus 0827 bacterial is 650 bp, the specific PCR augmentation primer squence is 5'AGCCTTGTTAGCCTCTG3'and 5'CCTTCTACTCCCCCTCCACA3'. The method comprises following steps: culturing bacterial filament and extracting genetic DNA; getting specific DNA section of Lentinus tigrinus 0827 bacterial; getting specific PCR augmentation primer; SCAR- PCR augmentation; and ionophresis detection. The molecular mark can be used for simple, fast and accurate determination and detection for Lentinus tigrinus 0827 bacterial.

Description

A kind of molecular specific mark of Lentinus tigrinus 0827 bacterial classification and preparation method and application

Technical field

The invention belongs to biological technical field, be specifically related to a kind of molecular specific mark and preparation method and application of Lentinus tigrinus 0827 bacterial classification.

Background technology

China's mushroom production is from 1.95 ten thousand tons of 2,420,000 tons of developing 2005 rapidly of nineteen eighty-three, account for more than 70% of global mushroom ultimate production, rewritten the ranking list of world's edible mushrooms output, and constantly dwindle and the Twospore Mushroom poor distance of ranking first, scholarly forecast is arranged, because the fast development of Chinese mushroom industry, it will become the highest edible mushrooms of world wide production in nearly 10 years.China's mushroom is with its alarming development speed, and fine quality and cheap cost are that world mushroom industry personage attractes attention the fashionable world of Chinese mushroom.

The contribution rate of good quality strain in mushroom per unit area yield and quality is very important, and this has determined the critical role of mushroom strain in the mushroom industry.China had signed " international new variety of plant protection method " in 1999; this not only requires us to respect other national kind intellecture property; also to strengthen simultaneously protecting the kind intellecture property of our country oneself; really protect the kind property right of China in order to set up edible mushrooms new variety resignation system; must at first set up sophisticated cultivar identification technology, for the new variety registration lays the foundation.Especially Japan on April 1st, 2004 came into effect " seedling method amendment ", to the export mixes of China edible mushrooms especially mushroom great threat.With regard to domestic, the phenomenon of cultivating champignon bacterial classification " different name of the same race, xenogenesis is of the same name " has brought great loss not only for the mushroom farming, has influenced their cultivation enthusiasm, has also greatly influenced the fast development of Chinese mushroom; And, more and more higher along with the appearance of large-scale factory culture mode to the requirement of cultivating champignon bacterial strain quality, need more easy, the identification of strains technology fast and accurately of development, with guarantee every batch with kind all accurate.

Along with the foundation of the fast development of Protocols in Molecular Biology, particularly molecule marker and genetic marker technology with ripe, easy for developing, the identification of strains technology provides effective means fast and accurately.SCAR (Sequence CharacterizedAmplified Region) mark is a kind of very stable molecule marker, on using, have rapid, easy, characteristics cheaply, the present invention has set up the SCAR molecule marker of Lentinus tigrinus 0827 bacterial classification, can carry out Rapid identification to Lentinus tigrinus 0827 bacterial classification.

Summary of the invention

The objective of the invention is for can to Lentinus tigrinus 0827 bacterial classification carry out easy, identify fast and accurately and detect, a kind of molecular specific mark of Lentinus tigrinus 0827 bacterial classification is provided, the preparation method of the molecule marker of this Lentinus tigrinus 0827 bacterial classification is provided simultaneously.

The molecular specific mark of a kind of Lentinus tigrinus 0827 bacterial classification of the present invention: be the specific fragment of 650bp size, its specific PCR amplimer to sequence is: 5 ' AGCCTTGTTAGCCTCTG3 ' and 5 ' CCTTCTACTCCCCCTCCACA3 '.

A kind of preparation method of molecular specific mark of Lentinus tigrinus 0827 bacterial classification comprises the following steps:

(1) extraction of mycelium culture and genomic dna;

(2) the pulsating acquisition of the specific DNA of Lentinus tigrinus 0827: adopt round pcr, through a large amount of shaker tests, adopting simple repeated sequence is the specific DNA segment that primer has obtained Lentinus tigrinus 0827, with this fragment cloning order-checking;

(3) acquisition of specific PCR amplimer: based on the dna sequence dna that obtains, design specific PCR amplimer, the right sequence of primer is as follows: 5 ' AGCCTTGTTAGCCTCTG3 ' and 5 ' CCTTCTACTCCCCCTCCACA3 ';

(4) increase to Lentinus tigrinus 0827 bacterial strain being carried out SCAR-PCR with the specific PCR amplimer;

(5) specific fragment (Fig. 1) of the visible 650bp size of electrophoresis detection.And other mushroom strain there is no the specificity segment.

The molecular specific mark of a kind of Lentinus tigrinus 0827 bacterial classification of the present invention is applied in the Rapid identification and detection of Lentinus tigrinus 0827 bacterial classification.

The present invention carries out pcr amplification according to this a pair of special primer, with the 650bpDNA fragment as the foundation that Lentinus tigrinus 0827 bacterial strain is identified and detected.

Detection method of the present invention is compared with conventional morphologic detection, antagonistic effect, fruiting experiment, has weak point detection time, advantage of high accuracy.This detection required time only needs 2-3 days, and conventional antagonistic effect required time needs two time-of-weeks at least, and fruiting experiment then needs at least 3 months time; This method is produced the specificity that has Lentinus tigrinus 0827 bacterial strain in the bacterial strain at 164 mushrooms of collected China.

Description of drawings

Fig. 1 Lentinus tigrinus 0827 bacterial strain special primer for checking carries out the SCAR-PCR amplification to Xianggu mushroom strain

Among the figure 1: leopard 0820; 2: leopard 0821; 3: tiger fur 0826; 4: tiger fur 0827; 5: Shen 10; 6:26; 7: wild 43; 8: wild 47; 9: wild 50; 10:9015; 11:7402; 12: Su Xiang 13: Wu Xiang; The negative contrast of NC, arrow are depicted as Lentinus tigrinus 0827 bacterial strain and amplify the special DNA band that molecular weight is about 650bp.

Embodiment

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after the content of having read the present invention's instruction, these equivalent form of values fall within the application's appended claims institute restricted portion equally.

Embodiment 1

(1) extraction of mycelium culture and genomic dna: Lentinus tigrinus 0827 bacterial strain of cryopreservation is transferred on the PDA inclined-plane, cultivates activation for 25 ℃.Receive after two weeks in the 100mL PD liquid nutrient medium, 25 ℃ of two weeks of 100r/min shaking culture, collect mycelia, it is frozen to put into-20 ℃ of refrigerators.Extract genomic dna with improved CTAB method, DNA is diluted to 20ng/ μ L, and-20 ℃ of refrigerator storages are standby.

(2) the pulsating acquisition of specific DNA of Lentinus tigrinus 0827 bacterial strain: adopt round pcr, through a large amount of shaker tests, adopting simple repeated sequence is the specific DNA segment that primer has obtained Lentinus tigrinus 0827 bacterial strain, with this fragment cloning order-checking.

(3) specific PCR amplimer: based on the dna sequence dna that obtains, design specific PCR amplimer, the right sequence of primer is as follows: 5 ' AGCCTTGTTAGCCTCTG3 ' and 5 ' CCTTCTACTCCCCCTCCACA3 '.

(4) pcr amplification of SCAR molecule marker: the amplification system cumulative volume is: 25 μ L, 10 * PCR buffer, 2.5 μ L, 25mmol/L MgCL ₂2 μ L, 10mmol/L dNTP 0.25L, 2.5U/ μ L Taq DNA enzyme 0.5 μ L, 10 μ mol/L Lentinus tigrinus, 0827 bacterial strain detect primer special to each 1 μ L, template DNA 1 μ L (concentration 1ng～10ng/ μ L), ddH ₂O18.6 μ L.PCR reaction conditions: 94 ℃ of 1min; 94 ℃ of 15second, 65 ℃ of 15second, 72 ℃ of 1min, 30 circulations; 72 ℃ of 5min.

In order to get rid of the false negative situation of other bacterial classification, in the SCAR-PCR reaction system, add ITS (InternalTranscribed Spacer) universal primer to (ITS1, ITS4), verify the integrity of all template DNAs.

(5) electrophoresis detection: get above-mentioned pcr amplification product 8 μ L, with 1 μ L sample loading buffer mixing, point sample is on 1.5% fine jade vinegar sugar gel, in 0.5 * tbe buffer liquid, electrophoresis under the 5V/cm voltage is after electrophoresis finishes, with EB dyeing, on the gel imaging instrument, take a picture then.

Embodiment 2

To 114 (for produce with kind) individual collection from mushroom production in all parts of the country with bacterial classification and minority wild species totally 164 bacterial strains carry out SCAR and increase.Have only Lentinus tigrinus 0827 bacterial strain that single-minded amplified band is arranged in 1164 bacterial classifications.

Claims

1. the molecular specific mark of Lentinus tigrinus 0827 bacterial classification, it is characterized in that: adopt the specific PCR amplimer that 5 ' AGCCTTGTTAGCCTCTG3 ' and 5 ' CCTTCTACTCCCCCTCCACA3 ' are increased, obtain size and be described molecular specific mark for the dna segment of 650bp.

2. the molecular specific mark of a kind of Lentinus tigrinus 0827 bacterial classification according to claim 1 is in the Rapid identification of Lentinus tigrinus 0827 bacterial classification and the application in the detection.