CN103255153B - Date tree 2-cysteine oxidordeuctase gene - Google Patents

Abstract

The invention relates to the field of genetic engineering technologies, and in particular relates to a date tree 2-cysteine oxidordeuctase gene. A nucleotide sequence of the date tree 2-cysteine oxidordeuctase gene is shown by SEQIDNO: 1. Compared with the prior art, the date tree 2-cysteine oxidordeuctase gene Zj2-CP is separated from a data tree for the first time, and the gene taken as a target gene is transferred into a plant, so that the stress resistance of the plant is improved, and the gene has an important practical significance in plant breed improvement and has an important significance in advanced study of a resistance mechanism of plants with excellent resistance, is beneficial to confirming the molecular structure, expression, function and regulation of adversity related genes, and provides certain experimental data and lays a theoretical foundation for improving the stress resistance of the plants through full use of the genes with excellent resistance.

Description

Jujube tree 2-halfcystine oxidoreductase gene

Technical field

The present invention relates to gene engineering technology field, specifically a kind of jujube tree 2-halfcystine oxidoreductase gene.

Background technology

Plant-growth is suffering various abiotic stress often at the Nature, along with this abiotic stress of sharply variation of world environments is more and more serious.Antioxidase is system of defense important in plant abiotic stress, and they can be removed active oxygen by the method for degraded and resist the oxidative damage that abiotic stress induction produces, thereby reduce the injury that plant is caused.But it is still very limited that we resist the understanding of oxidasic function and structural performance, also needs a large amount of work.Therefore, the gene with anti-oxidant function in cloning and identification plant, Effect of Anti is against molecular structure, expression, function and the regulation and control of mechanism and adverse circumstance genes involved, can be to make full use of the resistance that these good resistant genes improve plants certain experimental data and based theoretical is provided.

Summary of the invention

The present invention aims to provide a kind of gene with anti-oxidant function---and jujube tree 2-halfcystine oxidoreductase gene, it can be used as goal gene and imports plant, improves stress resistance of plant, carries out plant species improvement.

The present invention is achieved by the following technical solutions: a kind of jujube tree 2-halfcystine oxidoreductase gene, the nucleotide sequence of this gene is the sequence as shown in SEQ ID NO:1.

An amino acid for jujube tree 2-halfcystine oxidoreductase gene coding, this amino acid whose sequence is the sequence as shown in SEQ ID NO:2.

A protein for jujube tree 2-halfcystine oxidoreductase gene coding, the aminoacid sequence of this protein is the sequence as shown in SEQ ID NO:2.

The application of a kind of jujube tree 2-halfcystine oxidoreductase gene in improving plant drought resistance, salt tolerance.

The present invention from the tall bottle with spout jujube that built ( ziziphus jujubamill hupingzao) in fruitful branch (being that jujube hangs) cDNA library, screen the complete sequence of jujube tree 2-halfcystine oxidoreductase gene, by its called after Zj2-CP( ziziphus jujube 2- cys peroxiredoxin) .Bioinformatic analysis shows that the cDNA sequence total length of Zj2-CP gene is 834bp, 277 amino acid of encoding, and molecular weight is 30.65KD, theoretical iso-electric point is that 8.95, CG content is 45.68%, and unstability index is 41.56, liposoluble index is 87.29, and hydrophobicity mean value is-0.12.By analysis, show that the albumen of this genes encoding is the outer non-secretory albumen of film, the homology of the albumen of this genes encoding and known species 2-halfcystine oxidoreductase gene proteins encoded is 82%-99%.

According to the sequence of the cDNA coding of jujube tree 2-halfcystine oxidoreductase gene, design is with the Auele Specific Primer of restriction endonuclease sma I and Sal I restriction enzyme site, and the sequence of the upstream primer W2 of Zj2-CP gene is: 5'-ATA gTCGACaATGGCTTGCTCTG-3', contains Sal I restriction enzyme site; The sequence of the downstream primer W3 of Zj2-CP gene is: 5'-AT cCCGGGtTATTGCTGCAAAG-3', contains Sma I restriction enzyme site.The primer of design is synthetic by Shanghai biotechnology Services Co., Ltd.

After restriction endonuclease sma I and Sal I modification, be connected on plant expression vector PEZR (K)-LNY, through heat shock method, connection product is transformed in competent escherichia coli cell, through kalamycin resistance screening, obtain positive bacterium colony, with the positive bacterium colony plasmid of alkaline lysis method of extracting, through enzyme, cut, order-checking shows that plant expression vector PEZR (K)-LNY-Zj2-CP successfully constructs.

By freeze-thaw method, recombinant plasmid PEZR (the K)-LNY-Zj2-CP successfully constructing is proceeded in the competent cell of Agrobacterium LBA4404, through kalamycin resistance screening, obtain positive bacterium colony, through receiving containing card, LB plate screening transformant, the PCR of mycin identifies, enzyme is cut evaluations, order-checking proves that engineering bacteria PEZR (K)-LNY-Zj2-CP successfully constructs.Agriculture bacillus mediated Zj2-CP gene transformation Arabidopis thaliana, through kalamycin resistance screening, obtain the transgenic arabidopsis plant that contains goal gene, by laser co-focusing observation analysis, show that jujube tree 2-halfcystine oxidoreductase gene, at the different tissues position of transgenic arabidopsis, all has expression in various degree in root, stem, leaf.

By turning the seed of Zj2-CP gene Arabidopis thaliana homozygous lines and wild-type Arabidopis thaliana seed, all sow and adding on the 1/2MS substratum of different concns NaCl, to turning the seed of Zj2-CP gene Arabidopis thaliana homozygous lines, carry out Evaluation of Salt Tolerance, observe its upgrowth situation, find to turn Zj2-CP gene Arabidopis thaliana plant under salt stress is processed growing way and root system significantly better than wild-type Arabidopis thaliana plant.To turn Zj2-CP gene Arabidopis thaliana plant and wild-type (WT) Arabidopis thaliana plant carries out salt tolerant, drought-enduring Stress treatment, find to turn Zj2-CP gene Arabidopis thaliana plant salt tolerant, drought tolerance obviously improves.

The present invention is for the further impact of research adverse circumstance factor on Zj2-CP genetic expression, to turning Zj2-CP gene Arabidopis thaliana plant and wild-type plant, carry out extracting its RNA after drought stress and salt stress, by real-time fluorescence quantitative PCR, show, turn Zj2-CP gene strain after Drought and salt is coerced, in its body, the expression amount of Zj2-CP gene is higher than the expression amount of wild-type plant.Simultaneously, to turning after physiological property POD, the CAT of Zj2-CP gene Arabidopis thaliana plant and wild-type plant measures, show, turn in Zj2-CP gene Arabidopis thaliana corresponding enzymic activity all higher than the enzymic activity in wild-type Arabidopis thaliana, visible Zj2-CP gene has improved drought resistance and the salt tolerance of plant.

Compared with prior art, the present invention isolates jujube tree 2-halfcystine oxidoreductase gene (Zj2-CP) first from jujube tree, this gene imports plant as goal gene, improve stress resistance of plant, for plant species improvement, have important practical significance, for the further investigation with the degeneration-resistant mechanism of good resistance plant, contribute to molecular structure, expression, function and the regulation and control of clear and definite adverse circumstance genes involved, for further making full use of the resistance that these good resistant genes improve plant, provide certain experimental data and based theoretical.

Accompanying drawing explanation

Fig. 1 is for carrying out the gene tertiary structure schematic diagram that predicts the outcome by Swiss Model program.

Fig. 2 is PCR goal gene product collection of illustrative plates.

Fig. 3 is the restriction enzyme mapping of PEZR (K)-LNY and goal gene.

Fig. 4 identifies collection of illustrative plates for connecting the PCR of product.

Fig. 5 is that the enzyme of recombinant plasmid is cut evaluation collection of illustrative plates.

Fig. 6 is that the PCR of engineering bacteria PEZR (K)-LNY-Zj2-CP identifies figure.

Fig. 7 is that the enzyme of engineering bacteria PEZR (K)-LNY-Zj2-CP is cut evaluation collection of illustrative plates.

Fig. 8 is the RNA gel imaging analysis collection of illustrative plates of transgenic arabidopsis and wild-type Arabidopis thaliana.

Fig. 9 is the expression amount result schematic diagram of Zj2-CP gene in transgenic arabidopsis strain.

Figure 10 is the expression amount result schematic diagram of Zj2-CP gene in wild-type Arabidopis thaliana strain.

Figure 11 is the expression amount result schematic diagram of POD activity in transgenic arabidopsis strain.

Figure 12 is the expression amount result schematic diagram of POD activity in wild-type Arabidopis thaliana strain.

Figure 13 is the expression amount result schematic diagram of CAT activity in transgenic arabidopsis strain.

Figure 14 is the expression amount result schematic diagram of CAT activity in wild-type Arabidopis thaliana strain.

Figure 15 is the determination of activity schematic diagram of POD in jujube seedling drought stress posterior lobe.

Figure 16 is the determination of activity schematic diagram of POD in stem after jujube seedling drought stress.

Figure 17 is the determination of activity schematic diagram of POD in root after jujube seedling drought stress.

Figure 18 is the determination of activity schematic diagram of CAT in stem after jujube seedling drought stress.

Figure 19 is the determination of activity schematic diagram of CAT in root after jujube seedling drought stress.

Figure 20 is the determination of activity schematic diagram of CAT in jujube seedling drought stress posterior lobe.

Figure 21 is the determination of activity schematic diagram of POD in jujube seedling salt stress posterior lobe.

Figure 22 is the determination of activity schematic diagram of POD in stem after jujube seedling salt stress.

Figure 23 is the determination of activity schematic diagram of POD in root after jujube seedling salt stress.

Figure 24 is the determination of activity schematic diagram of CAT in jujube seedling salt stress posterior lobe.

Figure 25 is the determination of activity schematic diagram of CAT in stem after jujube seedling salt stress.

Figure 26 is the determination of activity schematic diagram of CAT in root after jujube seedling salt stress.

Figure 27 is that transgenic arabidopsis strain and wild-type Arabidopis thaliana are subject to the morphological observation schematic diagram after salt stress.

Figure 28 is that transgenic arabidopsis strain and wild-type Arabidopis thaliana are subject to the morphological observation schematic diagram after drought stress.

Figure 29 is the quantitative fluorescence analysis result schematic diagram of Zj2-CP gene after jujube seedling drought stress.

Figure 30 is the quantitative fluorescence analysis result schematic diagram of Zj2-CP gene after jujube seedling salt stress.

Figure 31 is the cytological observation collection of illustrative plates of transgenic arabidopsis Plant Leaf.

Figure 32 is the cytological observation collection of illustrative plates of transgenic arabidopsis plants stems.

Figure 33 is the cytological observation collection of illustrative plates of transgenic arabidopsis plant root.

Figure 34 is the enlarged view of Figure 33.

Embodiment

the bioinformatic analysis of embodiment 1 jujube tree 2-halfcystine oxidoreductase gene Zj2-CP

The present invention from build tall bottle with spout jujube ( ziziphus jujubamill hupingzao) in fruitful branch cDNA library, screen the complete sequence of jujube tree 2-halfcystine oxidoreductase gene Zj2-CP.

1.1 analytical procedure

The sequence obtaining, by search ncbi database, is carried out to the similarity analysis of amino acid and Nucleotide; With DNASTAR, translate relative molecular weight and the theoretical iso-electric point of nucleotide sequence, calculating protein; In NCBI Blast X, carry out the homology analysis of sequence; With TMHMM2.0(http: //www.cbs.dtu.dk/services/TMHMM-2.0/) carry out the cross-film analysis of protein sequence; Signal peptide with SignalP3. 0Server analysis of amino acid sequence; With ProtScale Server, carry out sequence hydrophobicity/hydrophilic prediction; With DNAMAN software, jujube tree 2-halfcystine oxydo-reductase (is called for short zj2-CP) albumen of genes encoding carries out the prediction of secondary structure; By Swiss Model program (http://au.expasy.org/tools/), carry out the tertiary structure prediction of goal gene.

The homology analysis of 1.2 Zj2-CP genes

By carrying out sequence homology analysis at NCBI Blast X, show, in the albumen of this sequence encoding and known species, 2-halfcystine oxydo-reductase has high similarity, with the homology of willow 2-halfcystine oxydo-reductase be 82%, with the homology of tobacco be 87%, with the homology of cowpea be 90%, with the homology of pea be 99%, therefore by the albumen called after jujube tree 2-halfcystine oxydo-reductase of this genes encoding.

The aminoacid sequence cross-film of 1.3 Zj2-CP genes is analyzed

the cross-film district that carries out protein sequence with TMHMM2.0 analyzes (http://www.cbs.dtu.dk/services/TMHMM-2.0/), and result shows that cross-film region is that the albumen of 0, Zj2-CP genes encoding is the outer albumen of a film, does not have cross-film structure.

The protein signal peptide prediction of 1.4 Zj2-CP genes

with the signal peptide of SignalP3. 0Server analysis of amino acid sequence, result shows that the albumen of Zj2-CP genes encoding does not have signal peptide, is non-secreted protein.

The hydrophobicity of 1.5 Zj2-CP genes

The aminoacid sequence of jujube tree 2-halfcystine oxidoreductase gene coding is submitted to ProtScale Server and carries out the prediction of hydrophobicity/wetting ability, the less wetting ability of negative value is stronger, stronger on the occasion of larger hydrophobicity, is amphoteric amino acids between-0.5 to+0.5, and the protein of this genes encoding is hydrophobic proteins.

The tertiary structure prediction of 1.6 Zj2-CP genes

By Swiss Model program (http://au.expasy.org/tools/), carry out the tertiary structure prediction of jujube tree 2-halfcystine oxidoreductase gene, infer the three-dimensional structure of goal gene proteins encoded as shown in Figure 1.

Bioinformatic analysis shows: the sequence total length of jujube tree 2-halfcystine oxidoreductase gene Zj2-CP is 834bp, 277 amino acid of encoding, molecular weight is 30.65KD, theoretical iso-electric point is 8.95, CG content is 45.68%, unstability index is 41.56, and liposoluble index is 87.29, and hydrophobicity mean value is-0.12.By analysis, show that the albumen of this genes encoding is the outer non-secretory albumen of film, the homology of the albumen of this genes encoding and known species 2-halfcystine oxidoreductase gene proteins encoded is 82%-99%.

embodiment 2 the structure of jujube tree Zj2-CP Expressed in Transgenic Plant carrier

2.1 materials, reagent and instrument

2.1.1 material

Intestinal bacteria competence DH5a, recombinant plasmid pSPORT-Zj2-CP, plant expression vector PEZR (K)-LNY etc. preserve by contriver research department.

2.1.2 reagent and substratum

10xPCR buffer, dNTP Mixture, Taq enzyme, restriction endonuclease sma I, Sal I etc. are purchased from Taiyuan far and near commerce and trade company limited, TaKaRa DNA Fragment Purification Kit Ver.2.0 purification kit etc. and are purchased from Dalian precious biotechnology company limited.

LB substratum: it is 1.5% agar powder that peptone 10g/L, yeast extract 5g/L, sodium-chlor 10g/L(solid medium add final concentration)

2.1.3 instrument

Spectrophotometer (eppendorf BioPhotometer), electronic balance (Sarorius BS200s-WE1), water isolation type constant incubator (Shanghai City leap medicine equipment one PYX-DHS of factory), JY-DF series electrophoresis chamber (Jun Yi east, Beijing electrophoresis equipment company limited), high speed tabletop refrigerated centrifuge (Beck man J-25), pcr amplification instrument (Eppendorf AG), high speed freezing centrifuge (Thero HP-62), vacuum drying oven (HETO VR-1), high-pressure sterilizing pot (TOMY SS-325), water-bath constant temperature oscillator (SHZ-82A of Guo Hua enterprise), DYY-6B type electrophoresis apparatus (Beijing Liuyi Instrument Factory), Bechtop (the rich Vs-840-2 of Medical Equipment Plant of upper Hisoon), electric-heated thermostatic water bath (Tianjing Huabei Laboratory Apparatus Co., Ltd.)

2.2 experimental technique

2.2.1 escherichia coli DH5a competence is made

With reference to fine works molecular biology experiment guide CaCl ₂legal system is for bacillus coli DH 5 alpha competent cell.

2.2.2 plasmid extraction method

With reference to fine works molecular biology experiment guide, use alkaline lysis method of extracting plasmid.

2.2.3 PCR design of primers and synthetic

According to the sequence of the cDNA coding of jujube tree 2-halfcystine oxidoreductase gene, design is with the Auele Specific Primer of restriction endonuclease sma I and Sal I restriction enzyme site, and the sequence of the upstream primer W2 of Zj2-CP gene is: 5'-ATA gTCGACaATGGCTTGCTCTG-3', contains Sal I restriction enzyme site; The sequence of the downstream primer W3 of Zj2-CP gene is: 5'-AT cCCGGGtTATTGCTGCAAAG-3', contains Sma I restriction enzyme site.The primer of design is synthetic by Shanghai biotechnology Services Co., Ltd.

2.2.3 the setting of PCR primer thermograde

Utilize grads PCR technology that 6 different annealing temperatures are set, wherein core temperature is 56 ℃, using recombinant plasmid pSPORT1-2-CP as template, with Auele Specific Primer W2, W3, carries out pcr amplification, and finding out best annealing temperature is 54 ℃.Pcr amplification system 20 μ l:10 * PCR buffer 2 μ l, dNTP 0.2 μ l, each 0.5 μ l(primer final concentration of upstream and downstream primer is 20pmol/L), rTaq polysaccharase 0.2 μ l, template 1 μ l, S.D.W15.6 μ l.Amplification condition is: 95 ℃ of denaturation 5 min, and 94 ℃ of sex change 1 min, 56 ℃ of annealing 1 min, 72 ℃ are extended 2 min, totally 25 circulations, last 72 ℃ are extended 5 min.

2.2.4 the preparation of carrier PEZR (K)-LNY, pSPORT1-Zj2-CP

The DH5a bacterium liquid that contains PEZR (K)-LNY, pSPORT1-Zj2-CP plasmid is connect to bacterium and in the LB of 2mL liquid nutrient medium, contain in 1 μ l kantlex (100 mg/mL), 37 ℃ of incubated overnight.With splitting alkaline process, extract plasmid, plasmid is dissolved in 20 μ l TE ,-20 ℃ save backup.

2.2.5 the enzyme of goal gene Zj2-CP and carrier PEZR (K)-LNY is cut

Using cloning vector pSPORT1-Zj2-CP as template, with Auele Specific Primer, carry out pcr amplification and obtain the jujube tree 2-halfcystine oxidoreductase gene that contains complete open reading frame.The PCR product obtaining with alcohol precipitation, is dissolved in throw out in 20 μ l TE-20 ℃ of preservations.

The reaction system of pcr amplification goal gene: 10 * PCR buffer, 5 μ l(are containing Mg ion), dNTP 1 μ l, each 2 μ l(20pmol/L of upstream and downstream primer), rTaq polysaccharase 0.5 μ l, template DNA 1 μ l, sterilizing ultrapure water 38.5 μ l, cumulative volume 50 μ l.Amplification condition is: 95 ℃ of denaturation 5 min, and 94 ℃ of sex change 1 min, 54 ℃ of annealing 1 min, 72 ℃ are extended 2 min, totally 40 circulations, last 72 ℃ are extended 5 min.

With Sal I, Sma I restriction enzyme respectively enzyme cut PCR product and carrier PEZR (the K)-LNY of 2-halfcystine oxidoreductase gene, the reaction system that enzyme is cut is 50 μ l, both add accordingly 10 * Tbuffer, 5 μ l when enzyme is cut, 0.1%BSA 5 μ l, Sal I 2 μ l, Sma I 2 μ l, different is that the former adds PCR product 10 μ l, the latter adds carrier PEZR (K)-LNY plasmid 1 μ l, adds S.D.W to 50 μ l.37 ℃ of enzymes are cut and are spent the night.Whether enzyme goes 2 μ l enzymes to cut product after cutting, by agarose gel electrophoresis analysis and expection clip size, meet.

2.2.6 enzyme is cut product purification and is connected

With purification kit DNA Fragment Purification, the double digestion product of goal gene 2-halfcystine oxydo-reductase and carrier PEZR (K)-LNY is carried out to purifying.

Purified product is connected with T4 DNA ligase, ligation system is 10 μ l: it is that the mole ratio of 5 μ l(goal gene DNA fragmentations and vector plasmid is 3:1 that the DNA fragmentation mixed population of vector plasmid and goal gene amasss), DNA ligase 5 μ l, fully mix, and 16 ℃ of connections are spent the night.

2.2.7 connect the conversion of product

The competent escherichia coli cell that is taken at-70 ℃ of preservations adds connection product in competent cell and mixes gently after being put in and melting on ice, places on ice 30 minutes, adds in the water-bath of 42 ℃ 90 seconds, puts into rapidly cooled on ice 5 minutes.Add 400 LB liquid mediums, 37 ℃ are shaken 40 min and make bacteria resuscitation (rotating speed is lower than 225 turn/min).Go afterwards 50 μ l to containing on kantlex LB flat board, smoothen, be inverted 37 ℃ of standing overnight incubation.

2.2.8 the evaluation of converted product

In bacterium colony to the 50 μ LS.D.W growing on picking LB flat board, boiling water cracking 5 minutes.Get 1 μ l and identify as pcr template, reaction system and program are with reference to 2.2.5, and by being accredited as, positive bacterium colony is streak culture.

To be accredited as its plasmid of alkaline lysis method of extracting for positive bacterium colony, and use BamH I and Hind III digested plasmid through row positive identification.Endonuclease reaction system is 10 μ l:10 * Kbuffer 1 μ l, and BamH I and Hind III be 0.5 μ l respectively, plasmid 1 μ l, S.D.W 7 μ l.More than 37 ℃ of placement 2h.

Enzyme is cut to product and carry out gel electrophoresis analysis, whether check clip size is consistent with expected results.Positive strain Song Yu Hua Da company is checked order.

2.3 results and analysis

2.3.1 the cDNA of jujube tree Zj2-CP amplification

As shown in Figure 2, using recombinant plasmid pSPORT1-Zj2-CP as template, the specificity W2 of design and W3 are that primer carries out pcr amplification, and through agarose gel electrophoresis, analysis shows the band that has to be about 834bp, and this band is consistent with expected results as seen.

2.3.2 the enzyme of goal gene fragment and carrier segments is cut

With Sma I and Sal I enzyme, cut after the PCR product and carrier PEZR (K)-LNY plasmid of goal gene fragment, use agarose gel electrophoresis analysis, as shown in Figure 3, PCR product size is 834bp to result, the about 11.7Kb of carrier PEZR (K)-LNY fragment is visible identical with expected results.

2.3.3 connect the evaluation of product

By single bacterium colony of growing on the LB flat board that contains kantlex immediately 24 of pickings carry out PCR evaluation, after gel electrophoresis, as shown in Figure 4, in 24 single bacterium colonies, have the band of 14 bacterium colonies to be about 834bp, conform to expected results.Explanation contains object fragment in transforming bacterial strain.

2.3.4 the evaluation of recombinant plasmid

14 single bacterium colonies of above-mentioned test positive bacterium colony are again streak culture, extract its plasmid, plasmid is used after BamH I and Hind III endonuclease reaction, with agarose gel electrophoresis, analyze, as shown in Figure 5, in 14 plasmid enzyme restriction bands, all find that there is two bands, tentatively infer the success of jujube tree 2-halfcystine oxidoreductase gene plant expression vector construction.14 positive strains are chosen to two bacterial strains at random and send to Hua Da gene sequencing, sequencing result shows, plant expression vector construction success.

the agriculture bacillus mediated jujube tree Zj2-CP of embodiment 3 gene transformation Arabidopis thaliana

3.1 materials, reagent and instrument

3.1.1 material

Wild-type Arabidopis thaliana ( arabidopsis thalianacolumbia), agrobacterium tumefaciens ( agrobacterium tumefaciens) LBA4404, by contriver research department, preserve.Plant expression vector PEZR (the K)-LNY-Zj2-CP having successfully constructed.

3.1.2 reagent and plant and instrument

Kantlex (Kanamycin, Kan) is purchased from Shanghai Sheng Gong biotechnology Services Co., Ltd; Artificial climate incubator (SANYO, MLR-350); In YEB, 1/2 MS substratum, agents useful for same is all purchased from the huge chemical industry in Tianjin; Culture medium is purchased from garden crop institute of Shanxi Shanxi Academy of Agricultural Sciences.

3.1.3 culture medium prescription

YEB substratum:

Peptone 5g/L, yeast extract 1 g/L, sucrose 5g/L, magnesium sulfate 0.5g/L.(it is 1.5% agar powder that solid medium need add final concentration).

1/2MS substratum:

Macroelement 25ml/L, micro-5ml/L, organic element 500 μ l, molysite 5ml/L, sucrose 30g/L, agar powder 6g/L.

3.2 experimental technique

3.2.1 the cultivation of Arabidopis thaliana

95% alcohol immersion 1min for Arabidopis thaliana seed, the centrifugal 1min of 5000rpm; Proceed in 2.65% clorox the sterilizing 5min that turns upside down, the centrifugal 2min of 5000rpm; Sterilizing washing three times.Then seed is suspended in 0.1% agar powder colloidal sol.Be sowed on 1/2MS solid medium sealing.After 4 ℃ of vernalization 2d, at 22 ℃, under 16 h/8 h photoperiod conditions, normally cultivate.When Arabidopis thaliana grows 2 true leaves, be transplanted in nutraceutical matrix and continue to cultivate.

3.2.2 structure and the screening of engineering bacteria PEZR (K)-LNY-Zj2-CP-L

By freeze-thaw method, recombinant plasmid PEZR (the K)-LNY-Zj2-CP successfully constructing is proceeded to Agrobacterium LBA4404, on the LB flat board that painting contains kantlex, 28 ℃ of cultivations two days later, select several positive bacterium colonies, respectively get in 1/2nd bacterium colony to 50 μ LS.D.W, boiling water bath cracking 5min, get 1 μ l and carry out PCR evaluation as template, PCR reaction system is 15 μ l:10 * PCR buffer 1.5 μ l, dNTPmix 0.2 μ l, W2 0.5 μ l, W30.5 μ l, rTaq enzyme 0.2 μ l, S.D.W 11.1 μ l; Response procedures: 95 ℃ of 5min, 94 ℃ of 1min, 54 ℃ of 1min, 72 ℃ of 2min, 72 ℃ of 5min, 25 circulations.The plasmid DNA of extracting positive bacterium colony is carried out enzyme and is cut and detect recombinant plasmid and whether proceed to Agrobacterium.Positive bacterium colony is sent to Hua Da gene sequencing, the positive engineering bacteria identifying is again rule and preserved portion, standby.

3.2.3 agrobacterium mediation converted Arabidopis thaliana

The correct Agrobacterium positive strain of order-checking proof sequence is inoculated into (containing final concentration, being the kantlex of 50 μ g/mL) on 10mLYEB liquid nutrient medium, 28 ℃, the cultivation of 190r/min shaken overnight, the centrifugal 5min of 6000 rpm collects thalline, with 5% sucrose solution suspension thalline, adjusts OD ₆₀₀value adds slime mould agent (final concentration is 0.05%) while being 0.8-1.0, for contaminating Arabidopis thaliana plant.

During Arabidopis thaliana Plantlet formation bud, can be used to Agrobacterium-mediated Transformation.The bud of Arabidopis thaliana plant is partly immersed to conversion medium, the plant of contaminating is put in vinyl disc, with film, cover, place after 12h dark place, normally cultivates Arabidopis thaliana plant.When the angle of Arabidopis thaliana, fruit is withered and yellow, during wish cracking, and results T ₀seed.

3.2.4 the screening of transgenic arabidopsis

By T ₀for being seeded in 1/2MS(after transgenic seed sterilization, containing final concentration, being that microbiotic of card of 50 μ g/mL) flat board is upper screens, and the transfer-gen plant filtering out minute strain is gathered in the crops to seed, is T ₁generation.Equally, by T ₁for seed resistance screening, minute strain results T ₂for seed.By T ₂while there is not separation phenomenon (complete is green seedling) for sowing after seed disinfection in screening culture medium, illustrate that strain is now pure and mild strain.

3.2.5 the cellular localization analysis of transgenic arabidopsis

Laser confocal scanning microscope is state-of-the-art biological analysis instrument in the world at present, and it is to make scanning light source with laser, from point, row, face fast scan imaging.The pure and mild plant of transgenic arabidopsis is carried out to the cellular form that Fluirescence observation is analyzed its different tissues position by laser confocal microscope.

3.3 results and analysis

3.3.1 the structure of Agrobacterium engineering strain

Plant expression vector PEZR (the K)-LNY-Zj2-CP successfully constructing is proceeded in Agrobacterium LBA4404, select well-grown positive bacteria and drop into performing PCR evaluation, result has 5 bacterium colonies to produce a specific band (as shown in Figure 6) that is about 834bp in 12 positive bacterium colonies, random two positive bacterium colonies of picking extract its plasmid, with BamH I and Hind III, carry out enzyme and cut detection (as shown in Figure 7), in electrophoretogram, show two bands, consistent with expected results.Two bacterial strain sequencing results show, recombination sequence is identical with former cloned sequence, illustrate that the Agrobacterium engineering bacteria containing PEZR (K)-LNY-Zj2-CP successfully constructs.

3.3.2 the screening of transfer-gen plant

By T ₀for planting seed, in resistant panel, screen, transfer-gen plant can normal growth, and not genetically modified plant engenders Albino Seedling, finally dead.Through that resistance screening of card, obtain altogether 24 transgenic lines, the upgrowth situation of its transgenic line is as shown in the table.

As shown above, 24 transgenic lines have 4 strains and do not set seeds, and by other 20 strains, divide strain results seed, are designated as T ₁for seed.In like manner by the T of results ₁after getting approximately 100 sterilizations for seed, be seeded on the 1/2MS solid medium that contains that resistance of card, observe its growing state, from following table, can find out: 3,9,17,20,21 5 strains of transgenic line, the ratio of green seedling and Albino Seedling is not equal to or approximates 3:1, visible transgenic arabidopsis strain is multiple copied transgenosis, in the ratio of other 15 transgenic line medium green seedlings and Albino Seedling all close to 3:1, illustrate that these 15 transgenic lines, for single copy transgenic line, can be used for again screening the transgenic line isozygotying.

15 strains that green seedling and Albino Seedling ratio are met to 3:1 respectively 15 of the green seedlings of picking robust growth are transplanted in matrix, treat seed maturity time-division strain results seed, are designated as T ₂generation.By T ₂for planting after seed disinfection on the solid medium that contains that resistance of card, observe its upgrowth situation, be the homozygous lines that is of green seedling entirely, by entirely, for the strain of green seedling is respectively moved 3 in matrix, results seed, is T ₃in generation, seed is now the seed of homozygous plants.By blocking that screening, obtain altogether 15 homozygous lines in the present embodiment.

3.3.3 the cellular localization of transfer-gen plant

Gather respectively root, stem, the leaf of transgenic arabidopsis, by confocal laser scanning microscope analysis, show: Zj2-CP gene all has expressed in transgenic arabidopsis different tissues, the a large amount of expression of goal gene on cytolemma in transgenic arabidopsis blade and the cytolemma of Stomacal guard cell, tenuigenin and nucleus, as shown in figure 31; Goal gene is great expression on the cytolemma of transgenic arabidopsis stem and guard cell's cytolemma, nucleus, shown in figure 32; In the cytolemma of transgenic arabidopsis root and nucleus, express, see Figure 33 to Figure 34.

the Stress treatment of embodiment 4 transgenic arabidopsis

The salt stress of 4.1 transgenic arabidopsis seeds is processed

4.1.1 experiment material and method

4.1.1.1 material

Filter out seed, the wild-type Arabidopis thaliana seed of transgenic arabidopsis homozygous lines.

4.1.1.2 method

By 100 consistent seeds of granular size of the homozygous lines filtering out and wild Arabidopis thaliana difference picking, be seeded in the culture dish of 1/2MS substratum, the NaCl concentration containing in substratum is respectively 0mM/L, 50 mM/L, 100 mM/L, 200 mM/L, 300 mM/L, 400 mM/L, be put in afterwards in artificial climate incubator and normally cultivate, at the 13rd day, 23 days, 33 days, it is recorded and is observed respectively.

4.1.2 results and analysis

Transgenic arabidopsis and wild-type Arabidopis thaliana seed are carried out, after the NaCl Stress treatment of different concns, at different time, it being recorded and being observed, and result is as following table:

Transgenic arabidopsis is at 50 mM/L as can be seen from the above table, 100 mM/L, under the stress conditions of 200 mM/L different N aCl concentration, its upgrowth situation is apparently higher than the upgrowth situation of wild-type Arabidopis thaliana, under 0 mM/L condition, the upgrowth situation of transgenic arabidopsis and wild-type Arabidopis thaliana is substantially similar, at high salt concentration 300 mM/L, under 400 mM/L conditions, transgenic arabidopsis and wild-type Arabidopis thaliana all do not germinate, visible transgenic arabidopsis can improve the salt tolerance of Arabidopis thaliana, but not unconfined raising, under suitable salt concentration conditions, can improve the salt resistance of plant.

The Stress treatment of 4.2 transgenic arabidopsis plant

4.2.1 experiment material and method

4.2.1.1 material

Transgenic arabidopsis seed, wild-type Arabidopis thaliana seed isozygoty.

4.2.1.2 method

To after the seed disinfection of transgenic arabidopsis and wild-type Arabidopis thaliana, be seeded on 1/2MS solid medium, under 4 ℃ of conditions, two days later, in artificial climate incubator, normal cultivation after 3 weeks, moves in matrix in vernalization.Normal cultivation about one month in incubator, during every three or four days, water suitable water, picking robust growth, consistent seedling carry out drought stress.

The above-mentioned root water of picking out Arabidopis thaliana is rinsed well, put into respectively that to contain NaCl(final concentration be 300mM/L) and the whole osmotic potential concentration of PEG-6000(be 1.2 MPa) nutritive medium, after cultivating respectively 1h, 3h, 5h, 7h, take out, with filter paper, the liquid-absorbent on its leaf is clean, then get its leaf, put into rapidly liquid nitrogen freezing ,-80 ℃ of preservations.Separately get do not pass through Stress treatment Arabidopis thaliana as blank.

4.2.2 results and analysis

After supersalt and drought stress, from its growth conditions observation, during the Stress treatment of process different time, there is not obvious variation in transgenic arabidopsis; Wild-type Arabidopis thaliana upgrowth situation of its upgrowth situation and transgenic arabidopsis after the salt of different time and drought stress does not have larger difference yet, the phenomenon but here the leaf of finding wild-type Arabidopis thaliana when PEG-6000 with 1.2 MPa coerces 7h in getting the process of its leaf has occurred withering, the upgrowth situation of transgenic arabidopsis is compared and will be got well with wild Arabidopis thaliana as seen.

embodiment 5 expression of jujube tree Zj2-CP gene in Arabidopis thaliana body

5.1 materials and methods

5.1.1 material

5.1.1.1 vegetable material, reagent and instrument

The vegetable material of the transgenic arabidopsis of process Drought and salt Stress treatment in vegetable material: embodiment 4.

Instrument: high speed tabletop centrifuge (MICROMAX RF), quantitative real time PCR Instrument (7300 Real Time PCR System).

Reagent: the related reagent of 1/2MS substratum is all purchased from Shanghai Sheng Gong biotechnology company limited, related reagent in the RNA leaching process such as 2 * CTAB, saturated phenol, chloroform, primary isoamyl alcohol is all purchased from Shanghai Sheng Gong biotechnology company limited, reverse transcription test kit (PrimeScript rT Master Mix Perfect Real Time), PCR kit for fluorescence quantitative (SYBR premix Ex Taq ^tMiI) be all purchased from precious biotechnology (Dalian) company limited.

5.1.2 method

5.1.2.1 the extracting method of RNA

Vegetable material adopts CTAB method to extract RNA.

5.1.2.2 RNA quality examination

Whether the RNA that vegetable material is extracted utilizes protein nucleic acid spectrophotometer to detect purity and concentration, detect RNA degrade with denaturing formaldehyde electrophoretic method.

1. the detection of RNA purity and concentration

Get 1 μ l RNA and be added in 49 μ l deionized waters, utilize protein nucleic acid spectrophotometer to detect purity and the concentration of RNA, and pass through 1% agarose gel electrophoresis testing goal fragment.

2. denaturing formaldehyde gel electrophoresis

The preparation (matching while using) of RNA sex change Buffer: 20 * MOPS, 5 μ l, deionized formamide 50 μ l, formaldehyde 16 μ l, glycerine pigment 16 μ l; The volume ratio of sex change Buffer and RNA sample is 3:1, after mixing at 65 ℃ of water-bath 10min, be placed on ice 5 minutes cooling; Point sample, electrophoresis, EB dyeing 40min on shaking table, deionization washing three times, each 15min, uv photography detects.

The preparation of RNA denaturing formaldehyde glue: adding water to cumulative volume after water 44mL, the 20 * MOPS 3.0mL processing through DEPC, agarose 0.6g heating for dissolving is 60ml again, adds formaldehyde 3.0mL when solution is cold.

3. the reverse transcription of RNA

By reverse transcription test kit PrimeScript for the RNA being up to the standards rT Master Mix carries out reverse transcription, and reverse transcription system is 20 μ l:5 * Prime Script buffer 4 μ l, RNA sample 2 μ l, S.D.W 14 μ l.

Reverse transcription reaction program is: 37 ℃ of 15min, 85 ℃ of 5s.By reverse transcription product dilution, be the most always the concentration of 100ng/ μ l

4. the design of primer is with synthetic

Determine Arabidopis thaliana aCTINas reference gene, to jujube tree 2-halfcystine peroxidase gene, the expression amount in transgenic arabidopsis body detects gene (At3g18780), by NCBI, obtains aCTINgene complete sequence.And reference gene and goal gene being set respectively for the Auele Specific Primer of quantitative fluorescent PCR according to gene high conservative region, the upstream primer sequence of reference gene is R-NNJ ₁: 5 '-acctcatgaagatccttacag-3 ', downstream primer sequence is R-NNJ ₂: 5 '-gatggaagagctggtctttg-3 '.The upstream primer ZCG1 sequence of goal gene jujube tree 2-halfcystine peroxidase gene is: 5 '-TGCTTTCAGCGATCGCTATG-3 ';

Downstream primer ZCG2 sequence is: 5 '-AGTGCAATTCCCTGATCAG-3 '.

5. real time fluorescent quantitative

The product of getting the diluted cDNA of 1 μ l carries out relative quantitative assay as the template of real-time fluorescence quantitative PCR on PCR instrument.The reaction system of real time fluorescent quantitative is 20 μ l:cDNA 1 μ l, Rox 0.4 μ l, each primer 0.4 μ l(primer final concentration of upstream and downstream is 20pmol/ μ l), rTaq 10 μ l, S.D.W 17.8 μ l, each sample is done 3 repetitions.Response procedures is 95 ℃ of 30s, 95 ℃ of 5s, 60 ℃ of 31s, totally 40 circulations.Arrange experimental result, by formula X=2 ^{-Δ Δ Ct}carry out the relative quantitative assay of goal gene.

5.2 results and analysis

5.2.1RNA concentration and purity test

In table, CK is Normal group (not making any Stress treatment), Drought and salt is coerced rear transgenic arabidopsis and wild-type Arabidopis thaliana after the processing through different time as can be seen from the above table, adopt CTAB method to extract the RNA of vegetable material, with protein nucleic acid instrument, detect its concentration and purity, 260/280 ratio all meets result, concentration and the purity of RNA that each strain is carried all meet with potential result, therefore can be used for next step experiment.

Extracted RNA is carried out to denaturing formaldehyde gel electrophoresis, by gel imaging analysis (see figure 8), show that carried RNA is completely qualified, can be used for reverse transcription, carry out real time fluorescent quantitative.

5.2.2 fluorescent quantitation detected result

From Fig. 9, Figure 10, can find out, under drought stress condition in transgenic arabidopsis strain the expression amount of goal gene Zj2-CP along with the increase of time shows the trend that first raises and reduce afterwards, when 5h, reach maximum value, wild-type Arabidopis thaliana plant presents the variation tendency that first raises and reduce afterwards under drought stress condition, reaches maximum value when arid is processed 2h.

Under salt stress, in transgenic arabidopsis strain, the expression amount of goal gene Zj2-CP first reduces along with the prolongation of time presents the trend raising afterwards, reaches Schwellenwert when processing 5h; In wild-type Arabidopis thaliana strain, along with the expression amount of the increase jujube tree 2-halfcystine peroxidase gene of time presents first, raise, when 3h processes, its expression amount reaches maximum value, afterwards the variation tendency of reduction gradually.

Wild-type Arabidopis thaliana and transgenic arabidopsis are after Drought and salt is coerced, increase along with the time, in its body, the expression amount of Zj2-CP is all higher than the expression amount of goal gene in other group (not coerced by Drought and salt), the expression of visible promotion goal gene that can be in various degree under arid and stress conditions, also can find out simultaneously, the expression amount of transgenic arabidopsis Zj2-CP under Drought and salt stress conditions all higher than wild-type Arabidopis thaliana in the expression amount of goal gene, drought resistance and the salt tolerance of the raising plant that visible jujube tree 2-halfcystine peroxidase gene energy is suitable.

embodiment 6 PEG arids and NaCl coerce the impact on transgenic arabidopsis physiological property

6.1 material

6.1.1 instrument and reagent

High speed tabletop centrifuge, electronic balance, ultraviolet spectrophotometer, mortar.

SODIUM PHOSPHATE, MONOBASIC, Sodium phosphate dibasic, methyl catechol, hydrogen peroxide, thiobarbituricacidα-(TBA), PEG-6000, NaCl etc.

6.1.2 material is prepared and is processed

The seed of 3 strains of the random picking of the transgenic arabidopsis isozygotying and wild-type Arabidopis thaliana is used respectively to 95% alcohol immersion 1min, the centrifugal 1min of 5000rpm; Proceed in 2.65% clorox, turn upside down and wash sterilizing 5min, the centrifugal 2min of 5000rpm; Sterilizing washing three times.Then seed is suspended in 0.1% agar powder colloidal sol.Be sowed at respectively on 1/2MS solid medium sealing.After 4 ℃ of vernalization 2d, at 22 ℃, under 16 h/8 h photoperiod conditions, normally cultivate.When Arabidopis thaliana grows 2 true leaves, be transplanted in nutraceutical matrix and continue to cultivate.Suitable giving and its nutrient during this time, after about about 20 days, select the consistent plant of growth to be shifted out matrix, with distilled water, its root is rinsed well, be placed in respectively 1/2MS nutrient solution, PEG(osmotic potential concentration is 1.2MPa), NaCl(concentration is 300mM/L) 1/2MS nutrient solution, the treatment time is respectively 1h, 3h, 5h, 7h, gets its leaf, put into rapidly liquid nitrogen freezing after, in-80 ℃ of refrigerators, preserve.

6.2 method

6.2.1 the extraction of crude enzyme liquid

Get the material of above-mentioned processing, accurately take 0.2g in meeting cold mortar, add liquid nitrogen grinding powdered, proceed in centrifuge tube, adding 1.8ml concentration is that 50mmol/LPH value is 7.8 phosphoric acid buffer, under 4 ℃, 12000r in centrifugal 20min, get supernatant liquor, for the mensuration of enzymic activity.

6.2.2 the mensuration of enzymic activity and method

The mensuration guaiacol method that peroxidase (POD) is active; The mensuration hydrogen peroxide method that catalase (CAT) is active; Dullness under mensuration 532,600,450nm wavelength.

6.3 results and analysis

6.3.1 the active mensuration of transgenic arabidopsis peroxidase (POD)

By Figure 11, Figure 12, can be found out, antioxidant enzyme gene expression in various degree can promote transgenic arabidopsis under drought stress condition in, increase along with the time, in transgenic arabidopsis, Peroxidase activity all presents first increases the trend reducing afterwards, and when processing 5h, enzymic activity has reached maximum value.Wild-type strain is to present gradually the trend increasing, and after the arid of corresponding time is processed the expression amount of wild-type plant POD activity all higher than the expression amount of transgenic line.

Under condition of salt stress in transgenic line the expression amount of POD activity all with drought stress condition under the expression amount of POD activity present corresponding trend, be all that enzymic activity has reached maximum value when 5h, reduce gradually afterwards.Wild-type strain is presenting the trend that first raises and reduce afterwards after salt stress, reached maximum value, but the expression amount of its POD activity is all higher than transgenic line when processing 5h.

Transgenic arabidopsis is after the processing of PEG arid and NaCl salt stress, and Peroxidase activity totally all presents the trend of rising; Wild-type plant is reduction trend after its POD activity after Drought and salt is coerced presents respectively rising gradually and first raises.After processing through corresponding time, the expression of wild-type plant POD activity is all higher than the expression of transgenic line POD activity, the resistance of plant that can draw thus increase that transgenic arabidopsis is suitable.

6.3.2 the active mensuration of catalase (CAT) in transgenic arabidopsis

By Figure 13, Figure 14, can be found out, under salt condition, the catalase activity of transgenic arabidopsis is along with the prolongation of time shows the trend that first raises and reduce afterwards, and under drought stress, its CAT activity presents the trend raising gradually; Wild-type plant all presents the trend that first raises and reduce afterwards under Drought and salt stress conditions, reaches maximum value when processing 5h.

Transgenic arabidopsis and wild-type plant its catalatic content after drought stress and salt stress all in all lower than control group in catalatic content, so Drought and salt is coerced the expression of inhibition catalase activity that can be suitable.Simultaneously from the content of learning transgenic line CAT activity in its body after Drought and salt is coerced figure all lower than wild-type plant, drought resistance and the salt tolerance of the raising plant that visible transgenic line can be suitable.

6.4 embodiment brief summaries

In an embodiment by transgenic arabidopsis and wild-type Arabidopis thaliana plant being carried out after Drought and salt coerces, get its plant it is carried out to some physiological property POD, CAT, after mensuration, show, in wild-type Arabidopis thaliana, corresponding enzymic activity is all higher than the enzymic activity in transgenic arabidopsis, visible transgenic arabidopsis has improved drought resistance and the salt tolerance of plant, and visible goal gene jujube tree 2-halfcystine oxidoreductase gene is improved the function of plant drought resistance and salt tolerance.

embodiment 7 PEG arids and NaCl coerce the impact on jujube seedling physiological property

7.1 materials and methods

7.1.1 material

7.1.1.1 instrument and reagent

Instrument: refrigerated centrifuge, electronic balance, ultraviolet-visible pectrophotometer, high speed tabletop centrifuge, mortar.

Reagent: phosphoric acid buffer, methyl catechol, hydrogen peroxide, thiobarbituricacidα-(TBA), PEG-6000, NaCl etc.

7.1.1.2 material is prepared

In the present embodiment, adopt the autonomous capsicum Zizphus jujube in Vitro of cultivating of contriver.The picking consistent nursery stock that grows from the subculture tissue cultured seedling of capsicum jujube, intercepting 1.5cm left and right, containing the stem section of single axillalry bud, in access 1/2MS substratum, adds 70ml substratum in every 150ml triangular flask, and every bottle of 3 stem sections were cultivated indoor cultivation about one month.Culture condition is: 25 ± 1 ℃ of temperature; Periodicity of illumination 12h/d; Intensity of illumination 2000-3000 μ molm ^-2s ^-1.

7.1.1.3 material processing

Choose the capsicum jujube tissue cultured seedling that growing way is consistent, with distilled water, its root rinsed well, be placed in PEG-6000 osmotic potential concentration and be respectively 0 MPa(CK), 0.5MPa, 0.8 MPa, 1.2 MPa; The additional concentration of NaCl is respectively 0mM/L(CK), in the 1/2MS nutrient solution of 50mM/L, 100mM/L, 200mM/L, 300mM/L, treatment time is respectively 15min, 45min, 2h, 5h, get respectively its root, stem, leaf, put into rapidly liquid nitrogen freezing after, in-80 ℃ of refrigerators, preserve.

7.1.2 method

7.1.2.1 the extraction of crude enzyme liquid

Get the material of above-mentioned processing, accurately take 0.2g in meeting cold mortar, add liquid nitrogen grinding powdered, proceed in centrifuge tube, adding 1.8ml concentration is that 50mM/LPH value is 7.8 phosphoric acid buffer, under 4 ℃, 12000r in centrifugal 20min, get supernatant liquor, for the mensuration of enzymic activity.

7.1.2.2 the mensuration of enzymic activity and method

The mensuration guaiacol method that peroxidase (POD) is active; The mensuration hydrogen peroxide method that catalase (CAT) is active; Jujube shoot root cauline leaf extracts with trichoroacetic acid(TCA), the dullness under mensuration 532,600,450nm wavelength.

7.2 results and analysis

7.2.1 the mensuration of enzymic activity under jujube seedling drought stress condition

7.2.1.1 the active mensuration of peroxidase (POD)

By Figure 15 to Figure 17, can be found out ,under drought stress condition, promote the expression in various degree of jujube seedling antioxidant enzyme, along with the arid of the increase different concns of time is processed, variation tendency at different tissues position is different, in jujube seedling stem and root, POD activity presents first increases the trend reducing afterwards, when processing 45min, there is flex point, in stem, the processing of 0.8MPa has obviously improved the activity of POD, and the expression amount of the POD activity that 0.5MPa processes in root is the highest; Under drought condition, in jujube seedling leaf, the expression amount of POD activity shows and first reduces the trend raising afterwards, and when 45min processes, the expression amount of POD activity is minimum, but the arid of 0.8MPa is processed along with the prolongation POD activity of time is in reduction gradually.From figure, it can also be seen that the expression amount of POD activity in leaf is the highest, the expression amount in stem is minimum.

After jujube seedling drought stress, in the root of jujube seedling, stem, the processing of same concentration different time and same asynchronism(-nization) concentration all shows as the trend that first raises and reduce afterwards, in the processing of same concentration different time, when 45min processes POD activity show as the highest, when same time different concns is processed, not obvious in the difference of 0.5MPa and 0.8MPa, but the highest, minimum when 1.2MPa processes.

Under certain drought condition, can promote the enhancing of jujube seedling POD activity, when PEG-6000 osmotic potential concentration is 1.2MPa, can suppress the rising of POD activity, result shows simultaneously, and under drought condition, the active performance of the POD of jujube seedling different tissues is different.

7.2.1.2 the active mensuration of catalase (CAT)

By Figure 18 to Figure 20, can be found out, after drought stress, jujube seedling leaf CAT is changed significantly, the processing of same concentration, and along with the increase CAT activity of time shows the trend that first increases rear reduction, when 2h, the CAT activity of different concns reaches respectively maximum value; The processing of same time along with the increase of concentration shows the trend that first increases rear reduction, is respectively processed change in concentration remarkable when 45min, is secondly 2h, and 15min, 5h change not obvious.

After jujube seedling drought stress, the processing of same concentration, along with the increase of time, the CAT activity of jujube seedling stem presents the trend raising gradually; The processing of same time, the processing of different concns PEG, in jujube seedling stem, CAT activity difference is little, but the CAT activity that arid is processed is all high than the CAT activity of contrast, and visible suitable arid is processed the activity that can promote CAT in jujube seedling stem.

After jujube seedling drought stress, the processing of same asynchronism(-nization) concentration, in jujube shoot root, CAT activity presents the trend that first increases rear reduction, reaches maximum value when 0.8MPa processes; The processing of same concentration different time, in jujube shoot root, the activity of CAT reaches maximum value when 2h, declines afterwards.As seen from the figure, in the jujube seedling that arid is processed, CAT is active all higher than control group, and visible suitable arid processing can promote the expression of jujube seedling CAT activity.

7.2.2 the mensuration of enzymic activity under jujube seedling NaCl stress conditions

7.2.2.1 the active mensuration of peroxidase (POD)

By Figure 21 to Figure 23, can be found out, jujube seedling is after salt stress, under same concentration different time is processed, the activity that 50mM/L-300 mM/L processes POD in lower jujube seedling leaf first increases along with the increase of time presents the trend reducing afterwards, at 2h, reach maximum value, in CK, in jujube seedling leaf there is the trend raising gradually in the increase in time of POD activity.Under different concns is processed at one time, when 15min-2h processes, the processing of different salt concn, in jujube seedling leaf, the activity of POD is all higher than contrast, under 5h processes, the processing of different salt concn is all lower than contrast, suppressed the expression of POD activity in its leaf when the NaCl processing jujube seedling 5h with different concns be described.

Jujube seedling is after different concns different time is processed, and in its root, the activity of POD does not occur significantly to change, and visible salt is now processed the expression that does not promote POD activity in jujube shoot root.

Jujube seedling is after same concentration different time is processed, and in jujube shoot root, the trend of rear reduction is first increased in the active appearance of POD, and under 0 mM/L, 50 mM/L, 100 mM/L concentration are processed, when 45min, POD activity reaches maximum value; Under 200 mM/L, 300 mM/L concentration, POD activity is when 2h, to reach maximum value.After different concns is processed at one time, in jujube shoot root, POD activity is all higher than contrast.

7.2.2.2 the active mensuration of catalase (CAT)

By Figure 24 to Figure 26, can be found out, jujube seedling is after salt stress, and in its leaf, the activity of CAT presents and first increases the trend reducing afterwards in the coercing of same concentration different time, and when 2h, peaks; The processing of same asynchronism(-nization) concentration, in its leaf, the activity of CAT is all higher than CK value.

Same concentration different time is processed jujube seedling, and in its stem, CAT activity raises gradually, and when 2h, CAT activity reaches maximum value, reduces gradually afterwards.In 15min-2h,, the processing of different salt concn, in jujube seedling stem, the activity of CAT is all higher than contrast, and after when 5h, the salt of different concns is processed, in stem, the activity of CAT, all lower than contrast, illustrates that processing now has suppressed the expression of CAT.Also illustrate that suitable salt concn can promote the expression of CAT activity in jujube seedling stem simultaneously.

Jujube seedling is after salt stress, and in same concentration, along with the increase of time, in jujube shoot root, the activity of CAT presents the trend that first increases rear reduction, reaches maximum value when 2h; At one time, in the salt stress jujube shoot root of different concns, the expression amount of CAT is all higher than control value.

7.3 embodiment brief summaries

By jujube seedling after Drought and salt is coerced, its physiological property is measured to rear discovery, after coercing, in its different tissues, the expression amount of enzymic activity is all high than the enzymic activity expression amount in control group, after identical Drought and salt Stress treatment, find that the expression of its enzymic activity is different in jujube seedling different tissues, illustrate that jujube seedling can start a series of enzyme gene under adverse environmental factor.

embodiment 8 expression of jujube tree Zj2-CP gene in Arabidopis thaliana body

8.1 materials and reagent

8.1.1 material

Capsicum jujube ( ziziphus jujubawhat Mill lajiaozao) adopt is the autonomous test-tube plantlet of cultivating of contriver.。

8.1.2 reagent

NaCl, 1/2MS substratum, PEG-6000, NAA, 6-BA, MS substratum, inositol, agarose.

8.2 experimental technique

8.2.1 the breeding of jujube seedling

In super clean bench, spirit lamp is lighted, by calcination on spirit lamp after the sterilizations such as needed glass culture dish, tweezers, scissors, sterilization.Select the healthy and strong plant of growth about month, the tissue cultured seedling head of use scissors clip 2-3cm, puts into 1/2MS afterwards or MS substratum is taken root or succeeding transfer culture.It should be noted that whole process will near operation spirit lamp.New substratum is put into culturing room is normal cultivates about one month time, during indefinite observation, with anti-pollution.

8.2.2 material processing

Select the plant of robust growth is carried out respectively to Drought and salt Stress treatment, choose the tissue cultured seedling that growing way is identical and put into respectively the NaCl liquid nutrient medium that contains 50 mM/L, 100mM/L, 200Mm/L, 300mM/L, in the PEG-6000 liquid nutrient medium that contains 0.5MPa, 0.8MPa, 1.2MPa, control group is liquid nutrient medium.After respectively jujube seedling being coerced to 15min, 1h, 3h, 6h, sample, put into rapidly liquid nitrogen ,-80 ℃ of preservations.

8.2.3 primer is synthetic

By jujube tree zjH3gene can be used as reference gene and goal gene is carried out to the detection of mrna expression level.According to jujube tree zjH3gene order is designed for the Auele Specific Primer of PCR, reference gene zjH3upstream and downstream primer be respectively:

Upstream primer H ₁: 5 '-GAGGAAGCAACTGGCAACTAAGG-3 '

Downstream primer H ₂: 5 '-ACCAGCCTCTGGAATGGAAGTTTG-3 '

The upstream and downstream primer of goal gene 2-halfcystine peroxidase gene is respectively:

Upstream primer ZCG1 is: 5 '-TGCTTTCAGCGATCGCTATG-3 '

Downstream primer ZCG2 is: 5 '-AGTGCAATTCCCTGATCAG-3 '

The primer of design is sent with Hua Da gene synthetic.

8.2.4 the extraction of RNA and reverse transcription is synthetic

Vegetable material adopts CTAB method to extract RNA.

By reverse transcription test kit PrimeScript for the RNA being up to the standards rT Master Mix carries out reverse transcription, and reverse transcription system is 20 μ l:5 * Prime Script buffer 4 μ l, RNA sample 2 μ l, S.D.W 14 μ l.

Reverse transcription reaction program is: 37 ℃ of 15min, 85 ℃ of 5s.By reverse transcription product dilution, be the most always the concentration of 100ng/ μ l.

8.2.5 real-time fluorescence quantitative PCR

The product of getting the diluted cDNA of 1 μ l carries out relative quantitative assay as the template of real-time fluorescence quantitative PCR on PCR instrument.The reaction system of real time fluorescent quantitative is 20 μ l:cDNA 1 μ l, Rox 0.4 μ l, each primer 0.4 μ l(primer final concentration of upstream and downstream is 20pmol/ μ l), rTaq 10 μ l, S.D.W 17.8 μ l, each sample is done 3 repetitions.Response procedures is 95 ℃ of 30s, 95 ℃ of 5s, 60 ℃ of 31s, totally 40 circulations.Arrange experimental result, by formula X=2 ^{-Δ Δ Ct}carry out the relative quantitative assay of goal gene.

8.3 expression of jujube tree Zj2-CP gene in jujube tree body

8.3.1 morphologic observation after jujube seedling Stress treatment

The consistent jujube seedling of growth is carried out after the Stress treatment of Drought and salt, and Taking Pictures recording, as shown in Figure 27,28, observes the processing of Different stress from morphology, and the upgrowth situation of jujube seedling does not occur significantly to change.

8.3.2 the quantitative fluorescence analysis of jujube tree Zj2-CP gene after jujube seedling drought stress

As shown in figure 29, the PEG artificial drought conditions of different concns is processed jujube seedling different time, and the relative expression quantity of result Zj2-CP gene is also different.When PEG concentration is 0.5MPa, the relative expression quantity of goal gene is along with extending gradually of the time of coercing shows the trend of rising gradually, simultaneously the osmotic potential concentration of PEG-6000 is that 0.8MPa is while coercing jujube seedling, rising along with the time, the relative expression quantity of goal gene presents the trend increasing gradually, and when the osmotic potential concentration of PEG-6000 is 1.2MPa, the relative expression quantity of jujube tree 2-halfcystine oxydo-reductase is along with the increase of time shows the trend reducing gradually.In control group, along with the increase of time, the variation tendency of the relative expression quantity of goal gene is also not obvious.

8.3.3 the quantitative fluorescence analysis of jujube tree Zj2-CP gene after jujube seedling salt stress

As shown in figure 30, the relative expression quantity of jujube seedling goal gene Zj2-CP gene after salt stress first increases along with the increase of time all presents the trend reducing afterwards, the relative expression quantity that is all goal gene when salt stress is processed 1 hour reaches maximum value, when salt stress 6h, the relative expression quantity of goal gene is all lower than control group, visible can not resist adverse circumstance by improving the expression amount of Zj2-CP gene after long salt stress, need to meet by other degeneration-resistant system the demand of plant.Except the salt of 200mM/L is processed, the salt of all the other different concns process in the relative expression quantity of goal gene all higher than control group, and in the processing of the salt of 200mM/L, although along with the trend of the increase goal gene relative expression quantity of the time of coercing also present first raise after reduction trend, its value is all lower than control group.Relative expression quantity along with the increase goal gene of time in control group does not present obvious variation tendency.

8.4 embodiment brief summaries

By jujube seedling being carried out to after Drought and salt is coerced carrying out real time fluorescent quantitative, result shows all there is variation in various degree along with the relative expression quantity of Zj2-CP gene in the increase jujube seedling of the time of coercing, its relative expression quantity of coercing rear goal gene is all higher than the relative expression quantity of control group, explanation jujube seedling under adverse environmental factor can meet the demand of oneself in order to conform by improving the expression amount of Zj2-CP gene, also illustrate that jujube tree 2-halfcystine oxidoreductase gene is improved the function of plant drought resisting and salt tolerant simultaneously.

< 110 > Research Inst. for fruit Tree, Agricultural Academy of Shanxi Prov.

< 120 > jujube tree 2-halfcystine oxidoreductase genes

〈160〉2

〈210〉1

〈211〉834

〈212〉DNA

< 213 > tall bottle with spout jujubes (Ziziphus jujuba Mill hupingzao)

〈220〉

〈221〉CDS

〈222〉(1)…(834)

〈400〉1

ATGGCTTGCTCTGCTGCCTCTACAGCTCTAATCTCCTCCAACCACCGAGCTT 52

TCTCTTCGAAATCCGCACGGTCCATGCCATCCATGGCTTCCATTTCCTCTTC 104

TCTCTCTCCTCAAACCCTAACCATCCCCAAATCCTTCAACGGCCTCCGCAA 155

ACCTTTCCACTCTGTGCGCGTTCCCAGATCGATTTCGCTCTCTCGTGGCTCT 209

CATTGCAGAAAGAGATTCGTCGTCAGAGCTTCTAGTGAACTTCCACTTGTT 260

GGAAATGTGGCTCCTGATTTTGAGGCGGAGGCTGTTTTCGATCAGGAATTT 311

ATCAAGGTCAAACTCTCTGAATATATTGGGAAGAAGTACGTGATTCTTTTTT 363

TCTATCCGTTGGACTTCACGTTTGTCTGTCCTACAGAGATTACTGCTTTCAG 415

CGATCGCTATGAGGAATTCCAGTCACTAAATACAGAAATATTAGGTGTTTCA 467

ATTGACAGTGTGTTTTCGCACCTTGCATGGGTCCAAACAGATAGAAAGTCT 518

GGTGGTCTTGGTGATCTAAAGTATCCATTGATATCTGATGTTACCAAACAAA 570

TTTCAAAGTCTTTTGGTGTGCTGATACCTGATCAGGGAATTGCACTGAGAG 621

GACTCTTCATTATTGATAAGGAAGGTGTTATTCAGCACTCCACCATTAACAA 672

TCTTGCCATTGGCAGGAGTGTCGATGAGACTAAGAGAACGCTTCAGGCCTT 723

GCAATATGTGCAGGAGAACCCTGATGAAGTTTGCCCTGCTGGGTGGAAGCC 773

AGGAGAGAAGTCCATGAAGCCAGATCCCAAGCTCAGCAAGGAGTACTTTG 823

CAGCAATATAG 834

〈210〉2

〈211〉277

〈212〉PRT

< 213 > tall bottle with spout jujubes (Ziziphus jujuba Mill hupingzao)

〈400〉2

Met Ala Cys Ser Ala Ala Ser Thr Ala Leu Ile Ser Ser Asn His Arg Ala Phe

1 18

Ser Ser Lys Ser Ala Arg Ser Met Pro Ser Met Ala Ser Ile Ser Ser Ser Leu

19 36

Ser Pro Gln Thr Leu Thr Ile Pro Lys Ser Phe Asn Gly Leu Arg Lys Pro Phe

37 54

His Ser Val Arg Val Pro Arg Ser Ile Ser Leu Ser Arg Gly Ser His Cys Arg

55 72

Lys Arg Phe Val Val Arg Ala Ser Ser Glu Leu Pro Leu Val Gly Asn Val Ala

73 90

Pro Asp Phe Glu Ala Glu Ala Val Phe Asp Gln Glu Phe Ile Lys Val Lys Leu

91 108

Ser Glu Tyr Ile Gly Lys Lys Tyr Val Ile Leu Phe Phe Tyr Pro Leu Asp Phe

109 126

Thr Phe Val Cys Pro Thr Glu Ile Thr Ala Phe Ser Asp Arg Tyr Glu Glu Phe

127 144

Gln Ser Leu Asn Thr Glu Ile Leu Gly Val Ser Ile Asp Ser Val Phe Ser His

145 162

Leu Ala Trp Val Gln Thr Asp Arg Lys Ser Gly Gly Leu Gly Asp Leu Lys Tyr

163 180

Pro Leu Ile Ser Asp Val Thr Lys Gln Ile Ser Lys Ser Phe Gly Val Leu Ile

181 198

Pro Asp Gln Gly Ile Ala Leu Arg Gly Leu Phe Ile Ile Asp Lys Glu Gly Val

199 216

Ile Gln His Ser Thr Ile Asn Asn Leu Ala Ile Gly Arg Ser Val Asp Glu Thr

217 234

Lys Arg Thr Leu Gln Ala Leu Gln Tyr Val Gln Glu Asn Pro Asp Glu Val Cys

235 252

Pro Ala Gly Trp Lys Pro Gly Glu Lys Ser Met Lys Pro Asp Pro Lys Leu Ser

253 270

Lys Glu Tyr Phe Ala Ala Ile ***

271 277

Claims (3)

1. a jujube tree 2-halfcystine oxidoreductase gene, the nucleotide sequence that it is characterized in that this gene is the sequence as shown in SEQ ID NO:1.

2. the amino acid of a kind of jujube tree 2-halfcystine oxidoreductase gene coding according to claim 1, is characterized in that this amino acid whose sequence is the sequence as shown in SEQ ID NO:2.

3. the application of a kind of jujube tree 2-halfcystine oxidoreductase gene as claimed in claim 1 in improving plant drought resistance, salt tolerance.