CN103233006B - Specific molecular markers of haynaldia villosa 4VS chromosome capable of resisting wheat yellow mosaic virus - Google Patents
Specific molecular markers of haynaldia villosa 4VS chromosome capable of resisting wheat yellow mosaic virus Download PDFInfo
- Publication number
- CN103233006B CN103233006B CN201310172525.9A CN201310172525A CN103233006B CN 103233006 B CN103233006 B CN 103233006B CN 201310172525 A CN201310172525 A CN 201310172525A CN 103233006 B CN103233006 B CN 103233006B
- Authority
- CN
- China
- Prior art keywords
- wheat
- primer
- cinau66
- chromosomal
- cluster hair
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses specific molecular markers of haynaldia villosa 4VS chromosome capable of resisting wheat yellow mosaic virus and belongs to the field of biotechnology. The invention firstly discloses two molecular markers CINAU66 and CINAU295 which are capable of tracking the haynaldia villosa 4VS chromosome. In materials containing the haynaldia villosa 4VS chromosome, marker primers CINAU66F/ CINAU66R are capable of amplifying about 950bp (base pair) of product; and marker primers CINAU295F/ CINAU295R are capable of amplifying about 380bp of product; and the primers are capable of tracking the haynaldia villosa 4VS chromosome. The haynaldia villosa 4VS chromosome capable of resisting the wheat yellow mosaic virus, disclosed by the invention, is capable of proving new gene resources for the breeding of yellow mosaic virus resisting wheat; and the specific molecular markers capable of specifically tracking the haynaldia villosa 4VS chromosome can be used for molecular marker-assisted selective breeding.
Description
Technical field
The invention belongs to biological technical field, relate to the chromosomal specific molecular marker of cluster hair wheat 4VS of anti-Wheat yellow mosaic virus.
Background technology
Wheat Yellow mosaic disease (wheat yellow mosaic, WYMV) be a kind of soil-borne disease virus disease being caused by Wheat yellow mosaic virus (wheat yellow mosaic bymovirus), the sporangiocyst of the many slime moulds of its vector cereal (Polymyxa graminis) can be survived more than the several years under antecedent soil moisture condition, by propagation such as farming operation, sick soil, the residual bodies of old complaint, or be mingled in and in seed, carry out long-distance communications by band amboceptor soil.There is the field of Wheat Yellow mosaic disease, generally can underproduction 20-30%, when serious, can reach 70%, even total crop failure (Liu Weihua etc., 2004; Liu etc., 2005a, 2005b).China's annual Wheat Yellow mosaic disease generation area reaches more than 1,000 ten thousand mu, and presents the trend of expanding year by year, and popular threat occurs progressively to be increased, and Wheat Production has been caused to heavy losses (Chen Jianping, 2005; Sun Ping Jian etc., 2011).
Selection and popularization disease-resistant variety is to control most economical, the effective approach of Wheat Yellow mosaic disease.China has been bred as the peaceful wheat of instrument, peaceful Feng little Mai, peaceful wheat No. 9, peaceful wheat 13, raise spoke wheat 9311 and raise the high resistance new variety such as spoke wheat No. 4, effectively controlled spread (He Zhentian etc., 2009) of this disease.But in breeding work, mainly utilize at present wheat 2D and 5A karyomit(e) main effect anti yellow flower leaf disease site (Nishio etc., 2010 on long-armed; Zhu etc., 2012), the hereditary basis of wheat anti yellow flower leaf disease is comparatively narrow.Therefore, excavate and utilize new anti yellow flower leaf disease genetic resources, locating and clone disease-resistant new gene is an active demand in the work of wheat anti yellow flower leaf disease genetic improvement.
Cultivar hereditary basis is increasingly narrow has become the Main Bottleneck (Li Zhensheng, 2010) that wheat breeding makes a breakthrough.Wheat sibling species belongs to genetic resourceses such as containing abundant antibiont and abiotic stress and high yield, figure of merit, by distant hybirdization nearly the excellent genes in edge species import common wheat, be widen wheat genetic basis, advance the effective way that makes a breakthrough of wheat breeding (lucky perfectly sound etc., 2001; Zhang Zengyan etc., 2004; Wang Shumin etc., 2011).
Cluster hair wheat (Haynaldia villosa, genome VV) originates in Mediterranean, is the nearly edge species of diploid of cultivated wheat, the multiple diseases (Gradzielewska, 2006) such as mildew-resistance, stripe rust, gaeumannomyces graminis disease, eye spot and yellow mosaic disease of holding concurrently.Cytogenetics institute of Agricultural University Of Nanjing starts to carry out the research that excellent cluster hair wheat gene is imported to common wheat from the seventies in last century, utilizes distant hybirdization and chromosome engineering means to be bred as a whole set of alien addition lines of wheat-haynaldia villosa 1V-7V, relates to the T6VS6AL translocation line of 4V and the chromosomal alien substitution of 6V and mildew-resistance.For the excellent gene that further research cluster hair wheat is taken, first to cluster hair wheat, wheat-haynaldia villosa double diploid, wheat-haynaldia villosa 4V disome alien addition line, 4V(4D) alien substitution, the T4VS4DL compensatory translocation line that isozygotys carried out the Wheat Yellow mosaic disease resistance qualification of multiple years, and carried out the research such as exploitation and screening of cluster hair wheat 4VS karyomit(e) specific molecular marker.
Summary of the invention
The object of the invention is to the above-mentioned defect for prior art, the chromosomal specific molecular marker of cluster hair wheat 4VS of anti-Wheat yellow mosaic virus is provided.
Another object of the present invention is to the application of the chromosomal specific molecular marker of cluster hair wheat 4VS that described anti-Wheat yellow mosaic virus is provided.
Object of the present invention can be achieved through the following technical solutions:
The chromosomal specific molecular marker of cluster hair wheat 4VS, is selected from any one in mark CINAU66 and mark CINAU295; The primer sequence of mark CINAU66 is: CINAU66F:SEQ ID NO.1, and CINAU66R:SEQ ID NO.2 can amplify the specific band of about 950bp from contain the chromosomal disease-resistant plant of cluster hair wheat 4VS with the primer of mark CINAU66; The primer sequence of mark CINAU295 is: CINAU295F:SEQ ID NO.3, CINAU295R:SEQ ID NO.4 amplifies the specific band of about 380bp from contain the chromosomal disease-resistant plant of cluster hair wheat 4VS with the primer of mark CINAU295.
The chromosomal specific molecular marker primer of cluster hair wheat 4VS of the present invention, be selected from a pair of arbitrarily in CINAU66F/CINAU66R or CINAU295F/CINAU295R, primer CINAU66F sequence is: SEQ ID NO.1, primer CINAU66R sequence is: SEQ ID NO.2, primer CINAU295F sequence is: SEQ ID NO.3, primer CINAU295R sequence is SEQ ID NO.4.
Molecule marker of the present invention contains the application in cluster hair wheat 4VS karyomit(e) wheat in qualification.
The application of molecule marker of the present invention in molecular marker assisted selection breeding.
Molecule marker primer of the present invention contains the application in cluster hair wheat 4VS karyomit(e) wheat in qualification.
The application of molecule marker primer of the present invention in molecular marker assisted selection breeding.
The chromosomal method of cluster hair wheat 4VS of utilizing the anti-Wheat yellow mosaic virus of molecule marker primer mark of the present invention, comprises the following steps:
(1), using the DNA of material to be identified as template, carry out pcr amplification with the primer of molecule marker CINAU66 claimed in claim 2 or CINAU295;
Pcr amplification system is: containing the 1 μ L DNA profiling of 20-100ngDNA, 1.0 μ L10 × PCR buffer, 0.8 μ L MgCl
2, 0.8 μ L dNTP, the each 0.2 μ L of left and right primer, 0.15 μ L Taq DNA polymerase, 5.85 μ L ddH
2o;
PCR program is: 94 DEG C of denaturations 3 minutes; 94 DEG C of sex change 30 seconds, 55 DEG C of annealing 50 seconds, 72 DEG C extend 1 point 10 seconds, 35 circulations; 72 DEG C are extended 10 minutes; 10 DEG C of preservations;
PCR product detects: PCR product is electrophoretic separation on the non-denaturing polyacrylamide gel of acrylamide and methene the proportion of acylamide 39:1, then detects with argentation;
(2) two pairs of labeled primers identify that the chromosomal standard of cluster hair wheat 4VS is: carry out pcr amplification with the primer of mark CINAU66, can amplify the plant of about 950bp specific band for containing the chromosomal plant of cluster hair wheat 4VS; Carry out pcr amplification with the primer of mark CINAU295, can amplify the plant of about 380bp specific band for containing the chromosomal plant of cluster hair wheat 4VS.
The chromosomal structure variation body of cluster hair wheat 4VS that relates in the present invention is stablized the resistance of Wheat Yellow mosaic disease, and in four environment, (2007 in six directions test point, Nanjing; Continuous 3 years of 2008-2010 is in test point, Yangzhou, Jiangsu) all to Wheat Yellow mosaic disease performance high resistance.
Can special tracking cluster hair wheat 4VS in the present invention the primer of chromosomal two marks be respectively taking wheat EST(BE500311 and BE637507) sequence (Fig. 4) of obtaining as stencil design.
Beneficial effect:
1, disclosed stable to the resistance of Wheat Yellow mosaic disease from the chromosomal structure variation body of cluster hair wheat 4VS in the present invention, in four environment, (2007 in six directions test point, Nanjing; Continuous 3 years of 2008-2010 is in test point, Yangzhou, Jiangsu) all to Wheat Yellow mosaic disease performance high resistance.In wheat breeding for disease resistance, there is higher utility value from the chromosomal anti-Wheat Yellow mosaic disease gene of cluster hair wheat 4VS.
2, in the present invention, the primer (CINAU66F/CINAU66R and CINAU295F/CINAU295R) of the chromosomal two pairs of molecule markers of cluster hair wheat 4VS of the anti-Wheat Yellow mosaic disease of the special tracking of disclosed energy designs based on wheat est sequence, whether be used for identifying in plant cluster hair wheat 4VS karyomit(e), simple, convenient and swift, amplification is stable.
3, labeled primer CINAU66F/CINAU66R is closely connected with cluster hair wheat 4VS karyomit(e) with the product of CINAU295F/CINAU295R amplification, so carry out pcr amplification with these two pairs of labeled primers, utilize the chromosomal accuracy of molecular marker assisted selection cluster hair wheat 4VS high.
Brief description of the drawings
Fig. 1: the wheat-haynaldia villosa T4VS4DL compensatory translocation line that isozygotys.(a): isozygoty translocation line tip of a root mitotic chromosome GISH in mid-term figure of wheat-haynaldia villosa T4VS4DL, cluster hair wheat total genomic dna fluorescein-12-dUTP mark, presents green; (b): isozygoty translocation line tip of a root mitotic chromosome FISH in mid-term figure of wheat-haynaldia villosa T4VS4DL, tumor-necrosis factor glycoproteins clone pSc119.2 biotin-16-dUTP mark, present green, tumor-necrosis factor glycoproteins clone pAs1 digoxigenin-11-dUTP mark, presents danger signal.
Fig. 2: wheat anti yellow flower leaf disease individual plant Resistance Identification grade scale
Fig. 3: wheat-haynaldia villosa double diploid (a), wheat-haynaldia villosa 4V(4D) the isozygoty Wheat Yellow mosaic disease resistance qualification result in compensatory translocation line (c) common wheat town 9523 of alien substitution (b), T4VS4DL
Fig. 4: the two couples of labeled primer CINAU66F/CINAU66R and the corresponding wheat EST(BE500311 of CINAU295F/CINAU295R and BE637507) sequence and primer sequence position
Fig. 5: with cluster hair wheat, wheat-haynaldia villosa double diploid, wheat-haynaldia villosa 1V-7V disome alien addition line, 4V(4D) alien substitution, T4VS4DL isozygotys the DNA of compensatory translocation line and common wheat China spring as template, use respectively two couples of labeled primer CINAU66F/CINAU66R (a) and CINAU295F/CINAU295R (b) in the present invention to carry out pcr amplification, result shows that labeled primer CINAU66F/CINAU66R is at disease-resistant material cluster hair wheat, wheat-haynaldia villosa double diploid, wheat-haynaldia villosa 4V disome alien addition line, 4V(4D) alien substitution, T4VS4DL isozygotys and all amplifies the specific band of about 950bp in compensatory translocation line, labeled primer CINAU295F/CINAU295R all amplifies the specific band of about 380bp, and these two pairs of labeled primers all do not amplify corresponding specific band in susceptible contrast common wheat China spring.Arrow is depicted as specific band.
Note:
M:Marker; 1: cluster hair wheat; 2: wheat-haynaldia villosa double diploid; 3: durum wheat; 4: China spring; The 5:T4VS4DL compensatory translocation line that isozygotys; The 6:T4VL5DL translocation line that isozygotys; 7-13: wheat-haynaldia villosa 1V-7V disome alien addition line.
Embodiment
1, cluster hair wheat 4VS takes the excavation of anti-Wheat Yellow mosaic disease gene
The Resistance Identification standard of wheat anti yellow flower leaf disease is divided into 0-5 level (Fig. 2) (reference: Zhu X B, Wang H Y, Guo J, Wu Z Z, Cao A Z, Bie T D, Nie M J, You F M, Cheng Z B, Xiao J, Liu Y Y, Cheng S H, Chen P D, Wang X E.Mapping and validation of quantitative trait loci associated with wheat yellow mosaic bymovirus resistance in bread wheat.Theoretical and Applied Genetics, 2012, 124 (1): 177-188.): 0 grade is that plant is asymptomatic, 1 grade for plant stunts not obviously, and slight floral leaf, does not generally produce obvious streaked necrosis spot, not yellow of blade or minority yellow, 2 grades for plant stunts not obviously, and slight floral leaf, produces obvious streaked necrosis spot, and blade yellow is obvious, 3 grades are slightly stunt for plant, and floral leaf is obvious, and streaked necrosis spot accounts for leaf area 1/2 left and right, partial blade yellow, and minority is withered, and the yellow of tillering is stunt, 4 grades are obviously stunt for plant, serious floral leaf, striped spot accounts for leaf area 3/4 left and right, the thin and delicate distortion of lobus cardiacus or be contracting top shape, partial blade with tiller withered, 5 grades are seriously stunt for plant, most of blade and tiller or whole strain withered.Disease-resistant contrast ' west wind wheat ' is to Wheat Yellow mosaic disease performance high resistance, and resistance level is 0 grade; ' town 9523 ' shows high sense, and anti-level level is 5 grades in susceptible contrast.In four environment, (2007 in six directions test point, Nanjing; Continuous 3 years of 2008-2010 is in test point, Yangzhou, Jiangsu) to wheat-haynaldia villosa double diploid, wheat-haynaldia villosa 4V(4D) isozygoty compensatory translocation line and common wheat town 9523 of alien substitution, T4VS4DL carried out the qualification of Wheat Yellow mosaic disease resistance, found that every chromosomal material of cluster hair wheat 4VS that contains is all to Wheat Yellow mosaic disease performance high resistance (Fig. 3).It is to study never to report that cluster hair wheat 4VS karyomit(e) is taken anti-Wheat Yellow mosaic disease gene in the past, can be used as the new genetic resources of wheat anti yellow flower leaf disease breeding and is used.
2, the design of the chromosomal molecule marker primer of special tracking cluster hair wheat 4VS
In exploitation with screen in the chromosomal specific molecular marker research of the cluster hair wheat 4VS of anti-Wheat Yellow mosaic disease, the two couples of molecule marker CINAU66 and CINAU295 can special tracking cluster hair wheat 4VS karyomit(e)s (Fig. 5).The primer of these two pairs of marks is that (document Qi LL sees reference according to two est sequences (BE500311 and BE637507) on wheat Part IV homology group, Echalier B, Chao S, Lazo GR, Butler GE, Anderson OD et al (2004) A chromosome bin map of16, 000expressed sequence tag loci and distribution of genes among the three genomes of polyploid wheat.Genetics168:701-712), adopt online primer-design software Primer3V0.4.0 to design (http://frodo.wi.mit.edu/primer3/).
The primer of mark CINAU66 is CINAU66F:GCTGAAACAAGAGATTGGCTTA(SEQ ID NO.1) and CINAU66R:GCCTTATGCCGCGTAATAGAT(SEQ ID NO.2); (Fig. 4)
The primer of mark CINAU295 is CINAU295F:GGATGATCTGATTGCACTTT(SEQ ID NO.3) and CINAU295R:GCATCTTTAACCTGTTGCTT(SEQ ID NO.4).(Fig. 4)
3. labeled primer CINAU66F/CINAU66R and CINAU295F/CINAU295R are in the Molecular Detection relating in cluster hair wheat 4VS chromosome material
Utilize labeled primer CINAU66F/CINAU66R to carry out pcr amplification detection relating in cluster hair wheat 4VS chromosome structure varient.Result shows: in high resistance parent cluster hair wheat, wheat-haynaldia villosa double diploid, wheat-haynaldia villosa 4V disome alien addition line, T4VS4DL isozygoty compensatory translocation line, all amplify the specific band of about 950bp, and in the chromosomal high sense material of cluster hair wheat 4VS, all do not amplify this specific band (Fig. 5 a) not containing.
Utilize labeled primer CINAU295F/CINAU295R to carry out pcr amplification detection relating in cluster hair wheat 4VS chromosome structure varient.Result shows: in high resistance parent cluster hair wheat, wheat-haynaldia villosa double diploid, wheat-haynaldia villosa 4V disome alien addition line, T4VS4DL isozygoty compensatory translocation line, all amplify the specific band of about 380bp, and in the chromosomal high sense material of cluster hair wheat 4VS, all do not amplify this specific band (Fig. 5 b) not containing.
PCR reagent set becomes: containing the 1.0 μ L DNA profilings of 20-100ng DNA, 1.0 μ L10 × PCR buffer, 0.8 μ LMgCl
2, 0.8 μ LdNTP, the each 0.2 μ L of left and right primer, 0.15 μ L Taq DNA polymerase, 5.85 μ L dd H
2o.
PCR program is: 94 DEG C of denaturations 3 minutes; 94 DEG C of sex change 30 seconds, 55 DEG C of annealing 50 seconds, 72 DEG C extend 1 point 10 seconds, 35 circulations; 72 DEG C are extended 10 minutes; 10 DEG C of preservations, electrophoretic separation on the non-denaturing polyacrylamide gel that PCR product is 39:1 at acrylamide and methene the proportion of acylamide, then dye with argentation.
Claims (4)
1. the chromosomal specific molecular marker of cluster hair wheat 4VS, is characterized in that being selected from mark
cINAU66, mark
cINAU66primer sequence be: CINAU66F:SEQ ID NO.1, CINAU66R:SEQ ID NO.2, described specific molecular marker
cINAU66to use
cINAU66the primer specific band that amplifies 950bp from contain the chromosomal disease-resistant plant of cluster hair wheat 4VS obtain.
2. molecule marker claimed in claim 1 contains the application in cluster hair wheat 4VS karyomit(e) wheat in qualification.
3. the application of molecule marker claimed in claim 1 in molecular marker assisted selection breeding.
4. utilize specific molecular marker described in claim 1 to detect the chromosomal method of cluster hair wheat 4VS of anti-Wheat yellow mosaic virus, comprise the following steps:
(1) using the DNA of material to be identified as template, with described molecule marker
cINAU66primer carry out pcr amplification; Mark
cINAU66primer sequence be: CINAU66F:SEQ ID NO.1, CINAU66R:SEQ ID NO.2;
Pcr amplification system is: containing the 1 μ L DNA profiling of 20-100ngDNA, 1.0 μ L 10 × PCR buffer, 0.8 μ L MgCl
2, 0.8 μ L dNTP, the each 0.2 μ L of upstream and downstream primer, 0.15 μ L
taqdNA polysaccharase, 5.85 μ L ddH
2o;
PCR program is: 94 DEG C of denaturations 3 minutes; 94 DEG C of sex change 30 seconds, 55 DEG C of annealing 50 seconds, 72 DEG C extend 1 point 10 seconds, 35 circulations; 72 DEG C are extended 10 minutes; 10 DEG C of preservations;
PCR product detects: PCR product is electrophoretic separation on the non-denaturing polyacrylamide gel of acrylamide and methene the proportion of acylamide 39:1, then detects with argentation;
(2) labeled primer identifies that the chromosomal standard of cluster hair wheat 4VS is: use mark
cINAU66primer carry out pcr amplification, can amplify the plant of 950bp specific band for containing the chromosomal plant of cluster hair wheat 4VS.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310172525.9A CN103233006B (en) | 2013-05-10 | 2013-05-10 | Specific molecular markers of haynaldia villosa 4VS chromosome capable of resisting wheat yellow mosaic virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310172525.9A CN103233006B (en) | 2013-05-10 | 2013-05-10 | Specific molecular markers of haynaldia villosa 4VS chromosome capable of resisting wheat yellow mosaic virus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103233006A CN103233006A (en) | 2013-08-07 |
| CN103233006B true CN103233006B (en) | 2014-10-29 |
Family
ID=48881072
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310172525.9A Active CN103233006B (en) | 2013-05-10 | 2013-05-10 | Specific molecular markers of haynaldia villosa 4VS chromosome capable of resisting wheat yellow mosaic virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103233006B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114292852B (en) * | 2022-01-21 | 2022-11-01 | 中国农业科学院作物科学研究所 | Marking composition created by wheat yellow mosaic disease resistant material |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101121945A (en) * | 2007-06-29 | 2008-02-13 | 天津师范大学 | Special RAPD molecule marker for wheat 6VS |
-
2013
- 2013-05-10 CN CN201310172525.9A patent/CN103233006B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101121945A (en) * | 2007-06-29 | 2008-02-13 | 天津师范大学 | Special RAPD molecule marker for wheat 6VS |
Non-Patent Citations (6)
| Title |
|---|
| A Chromosome Bin Map of 16000 Expressed Sequence Tag Loci and Distribution of Genes Among the Three Genomes of Polyploid Wheat;L.L.Qi et al.;《Genetics》;20041031;第168卷;701-712 * |
| BE500311.1;Olin Anderson;《GenBank》;20000804;1-2 * |
| BE637507.1;Olin Anderson;《GenBank》;20000825;1-2 * |
| L.L.Qi et al..A Chromosome Bin Map of 16000 Expressed Sequence Tag Loci and Distribution of Genes Among the Three Genomes of Polyploid Wheat.《Genetics》.2004,第168卷701-712. |
| Olin Anderson.BE500311.1.《GenBank》.2000,1-2. |
| Olin Anderson.BE637507.1.《GenBank》.2000,1-2. |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103233006A (en) | 2013-08-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103952402B (en) | A kind of SNP site relevant to root system of plant proterties and application thereof | |
| CN104560983B (en) | Two SNP marker and its application with anti-cucumber powdery mildew close linkage | |
| CN103999767A (en) | Breeding method of tomato breeding material with resistance to root knot nematode disease and yellow leaf curl virus disease | |
| CN104365471B (en) | One soft, the selection-breeding of mildew-resistance Triticum aestivum-Haynaldia villosa translocation line, authentication method | |
| CN106566888A (en) | Method for selecting and breeding variety with diversified resistance by molecular marker-assisted selection | |
| CN104152446A (en) | SSR molecular markers cosegregated from cucumber powdery mildew-resistant major QTL | |
| CN100494403C (en) | Method of assisting screening for cold resistant paddy rice and its special primer | |
| CN105123507A (en) | Scab-resistant gene Fhb7 short-segment translocation line derived from elytrigia elongata and application thereof | |
| CN101240342B (en) | Cucumber powdery mildew resistance main effect QTL compact linkage molecule labeling method and applying method | |
| CN107988411B (en) | KASP molecular marker of wheat scab resistance major QTL and application thereof | |
| CN103233006B (en) | Specific molecular markers of haynaldia villosa 4VS chromosome capable of resisting wheat yellow mosaic virus | |
| CN105331689B (en) | Wheat-elytrigia elongata powdery mildew resistant translocation line breeding method and molecular marker thereof | |
| CN103688846A (en) | Wheat-tritileymus 3D (3Ns) alien substitution line cultivation method and identification method | |
| CN110093435B (en) | Wheat SSR molecular marker primer and screening method thereof | |
| CN103981178A (en) | Cotton fiber length-associated major gene locus linked SSR (signal sequence receptor) molecular marker and application thereof | |
| CN103275975B (en) | Wheat new few-tillering QTL (quantitative trait locus), primer pair, molecular marker, molecular marking method and application | |
| CN102260669B (en) | Molecular marking method for anti-wheat yellow mosaic virus active quantitative trait locus (QTL) in Xifeng wheat | |
| CN110878300A (en) | DNA marker closely linked with wheat 7DL chromosome gibberellic disease resistant gene and application thereof | |
| CN105177020B (en) | Wheat glume villin gene Hg chain SSR molecular marker and its application | |
| CN107326070A (en) | The special codominant marker of one haynaldia villosa 4VL chromosome and its primer and purposes | |
| CN105850722A (en) | Culture method for stable and homozygous tobacco chromosome single fragment substitution line | |
| CN103571832B (en) | Molecular marker tightly interlocked with resistance gene TuRBCS01 of brassica rapa pekinensis TuMV | |
| CN108570515B (en) | Cold-resistant gene qCT6.7 for rice at booting stageDODMolecular marker and application thereof | |
| CN103409414B (en) | Sugarcane genome endogenous reference gene acetolactate synthase gene PCR (polymerase chain reaction) primer sequences and amplification method | |
| CN105695589A (en) | Complete set of reagent and molecular marker for detecting containing of 6V#4S chromosome arm of dasypyrum villosum in wheat |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| EE01 | Entry into force of recordation of patent licensing contract | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Application publication date: 20130807 Assignee: JIANGSU JINSE AGRICULTURE Co.,Ltd. Assignor: NANJING AGRICULTURAL University Contract record no.: X2021980001703 Denomination of invention: Specific molecular markers of Haynaldia villosa 4Vs chromosome resistant to wheat yellow mosaic virus Granted publication date: 20141029 License type: Common License Record date: 20210316 |