CN103275975B - Wheat new few-tillering QTL (quantitative trait locus), primer pair, molecular marker, molecular marking method and application - Google Patents
Wheat new few-tillering QTL (quantitative trait locus), primer pair, molecular marker, molecular marking method and application Download PDFInfo
- Publication number
- CN103275975B CN103275975B CN201310190372.0A CN201310190372A CN103275975B CN 103275975 B CN103275975 B CN 103275975B CN 201310190372 A CN201310190372 A CN 201310190372A CN 103275975 B CN103275975 B CN 103275975B
- Authority
- CN
- China
- Prior art keywords
- wheat
- tillering
- qtl
- primer
- molecular marker
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a wheat new few-tillering QTL (quantitative trait locus), a primer pair, a molecular marker, a molecular marking method and an application. Detection and analysis prove that the molecular marker gpw346 can accurately trace few-tillering major QTL QLtn.sicau-2D.1 of a wheat strain H461 to predicate the tillering characteristics of the wheat so as to further facilitate molecular design breeding. Simultaneously, during laboratory detection employing the molecular marker, the influence of the environment on phenotype can be avoided. The major QTL QLtn.sicau-2D.1 disclosed by the invention and a closely linked molecular marker gpw346 thereof not only provide candidate genes of wheat plant type breeding, but also enhance tillering predication accuracy by utilizing molecular marker assisted selection, the efficiency of plant type breeding is improved, and the purpose of increasing per unit yield of yield can be achieved fast.
Description
Technical field
The invention belongs to Wheat Molecular Breeding field, be specifically related to a grow wheat a woman who has recently been widowed and tiller main effect QTL QLtn.sicau-2D.1, primer pair, molecule marker, molecule marking method and application.
Background technology
Wheat is the second largest food crop that China is only second to paddy rice, and long-term cultivated area, more than 2666.67 ten thousand hectares, accounts for 27% of food crop area; Ultimate production is more than 100,000,000 tons, accounts for 22% of food crop output.
Wheat yield is made up of three elements, i.e. output=spike number * grain number per spike * grain weight.Tiller be affect wheat spike number how many and and then one of the Main Agronomic Characters affecting per unit area yield, be again a kind of special branch phenomenon of monocotyledons, there is important researching value.Tillering also is the Main Agronomic Characters relevant to planting environment adaptability to wheat.Donald (1968) once proposed, and the maximum desirable wheat genotypes of production potential should have upright blade, large fringe, and the short or only stalk of stalk, tillering is the characteristic that perennial herb is left over, and only stalk phenotype plays indirectly pushing effect to tassel Grain formation.Dofing (1993) etc. find that only bar kind provides the several proterties changing phenology and grow, comprise aobvious leaf speed, prematureness and characteristic of more synchronously earing faster, these characteristics are all the important component part promoting productivity in many environments.
The region of high soil fertility condition, is suitable for the kind of planting high tiller number, improves effective panicles per unit area, to reaching maximum potential produtivity.But in the poor area of soil fertility condition, the moistening live Mai Qu of weather is (for strengthening wheat growing way; weaken the competitive power of weeds; usually application rate can be strengthened; directly cause population density excessive; cannot high yield be realized) and (it is low that kind should meet water loss in arid area; organism assimilation efficiency is high; robust plant; and have higher tolerance to other poor environments) etc. these imperfect environment plantations; the stem stalk of low kind of tillering is sturdy, and lodging tolerance is strong, large fringe; the advantages such as many spikelet numbers can be appeared suddenly, and ultimate guarantee crop yield.
The forming process of tillering can be divided into two key steps, i.e. the formation of tiller bud and elongation.Usually can form axillalry bud, i.e. a tiller bud in the axil of every sheet leaf, but be only positioned at the tiller bud of stem culm base not on extend internode can elongation growth for tillering; And the axillalry bud on cane upper extended internode does not generally extend and be in dormant state (Jin Wenkui, Liao Pingan. wheat tillering contains the research of phase birth index. wheat research .2004,25:21-23).
Wheat tillering mutant is less, and genetic research macro-progress is relatively slow, and Current Domestic works main around QTL(quantitative trait locus of tillering outward) Molecular mapping and hereditary effect carry out.Up to now, the relevant main effect QTL of tillering reported is positioned at 1A, 2A, 3A, 6A karyomit(e), and the tin gene studies wherein only on 1A and 3A is more deep, completes Fine Mapping work.
Wheat line H461(derives from No. 2, cross combination SW94-30921 × allos) examine kind relative to kind Chuan Nong 16(state) have that widow is tillered, many grain number per spikes, many spikelet numbers, the characteristic such as high thousand seed weight and high Ear weight.The few shooting property of further research wheat H461, the QTL that setting control is tillered, find closely linked molecule marker, new gene resource is provided by the initiative of material of tillering for wheat is special and Plant-type Breeding, utilize molecular marker assisted selection simultaneously, by strengthening the accuracy of prediction of tillering, improving Plant-type Breeding efficiency, accelerating the target realizing increasing yield of wheat.
Molecular marker assisted selection, does not rely on phenotype and selects, and namely not by the impact of the many factors such as envrionment conditions, Interaction among genes, genotype by environment interaction, but directly selects genotype, thus greatly can improve breeding efficiency.Simple repeated sequence (simple sequence repeats is called for short SSR) is the tandem repetitive sequence be made up of several nucleotide repeating unit that a class is extensively present on genome.Due to the distribution that they are a large amount of on genome, polymorphism is high, and operative technique is simple, low cost, is widely used in molecular mark.Therefore, filter out and the closely linked molecule marker of major gene/QTL of tillering, utilize molecule marker to select wheat tillering major gene/QTL, Effective Regulation wheat tillering occurs, moulding reasonably tillers there is colony, significant to raising wheat population Quality and yield.
Summary of the invention
The widow that the object of this invention is to provide common wheat strain H461 is tillered QTL QLtn.sicau-2D.1.
Another object of the present invention is to provide the compact linkage molecule mark of this QTL.
The third object of the present invention is to provide the primer pair of above-mentioned molecule marker.
The fourth object of the present invention is to provide above-mentioned widow and tillers the application of the closely linked molecule marker of QTL QLtn.sicau-2D.1.
Object of the present invention realizes by following technical scheme:
A woman who has recently been widowed of the present invention tillers main effect QTL QLtn.sicau-2D.1 from wheat H461, this QTL is positioned at wheat 2D the short arm of a chromosome, in the section of distance short arm telomere 1.8cM (as shown in Figure 1), significantly reduces wheat tillering, LOD value is greater than 3.0, explains the phenotypic variation of about 45%.
The present invention tillers the upstream primer sequence of molecule marker of main effect QTL QLtn.sicau-2D.1 as shown in SEQ ID NO.1 for the identification of wheat H461 a woman who has recently been widowed, and downstream primer sequence is as shown in SEQ ID NO.2.
Described molecule marker is the amplified fragments of the pcr amplification gained carried out for substrate with the genomic dna of wheat H461, and and genetic distance between QLtn.sicau-2D.1 be 0.8cM.
Applicant provides a kind of widow of qualification the molecule marking method of tillering main effect QTL QLtn.sicau-2D.1, comprising: using the DNA of material to be identified as template, carries out pcr amplification with the primer pair of above-mentioned molecule marker; PCR primer carries out native polyacrylamide gel electrophoresis separation, then detects with argentation; Can amplify with the plant of H461 same clip is the plant containing few main effect QTL QLtn.sicau-2D.1 of tillering.
Applicant provides a kind of widow of qualification the molecule marking method of tillering main effect QTL QLtn.sicau-2D.1, preferably includes following steps:
1) using the DNA of material to be identified as template, pcr amplification is carried out with the primer pair of molecule marker according to claim 2: a) pcr amplification reaction system: it is 50 μ l that 5 μ l10xPCR buffer, 1.5U Ex Taq TM archaeal dna polymerase, 2mmol/L MgCl2,0.2mmol/L dNTP, each 150ng, 100ng template DNA of upstream and downstream primer, distilled water add to total amount; B) PCR program: 94 DEG C of denaturation 5min; 94 DEG C of sex change 30s, 60 DEG C of annealing 45s, 72 DEG C of extensions 30s, totally 35 circulations; 72 DEG C extend 5min; C) PCR primer detects: PCR primer 6% denaturing polyacrylamide gel (Acr:Bis=19:1) electrophoretic separation, and electrode buffer is 1xTBE, firm power 80W, voltage 2000 volts; Gel finally detects with cma staining.
2) labeled primer identifies that the result of QLtn.sicau-2D.1 is: can amplify with the plant of H461 same clip is the plant containing few main effect QTL QLtn.sicau-2D.1 of tillering.
Described QTL is in the special application of tillering in material initiative of wheat.
Described molecular marker primer pair is in the special application of tillering in material initiative of wheat.
The application of described QTL in wheat plant types breeding.
Described molecular marker primer pair assists the application in wheat plant types breeding at molecule marker.
Tiller QTL and molecule marker thereof of wheat H461 of the present invention widow obtains by the following method:
1) utilize wheat widow to tiller strain H461 for female parent, with spike number type wheat river agriculture 16 for paternal hybrid, obtain Hybrids F1, F1 generation individual plant selfing obtains F2, forms F2 genetic mapping colony at F2 random selecting 180 individual plants.
2) F2 population tiller phenotypic evaluation
The tiller number of wheat aging time field test F2 colony plant.
3) ssr analysis
A) DNA extraction: extract parent H461, river agriculture 16 and F2 colony plant DNA by CTAB method.
B) screening of polymorphic molecular marker between parent: choose GrainGenes(http: //wheat.pw.usda.gov/cgi-bin/graingenes) the upper genomic 615 pairs of SSR primers of covering hexaploid wheat A, B, D announced, with the DNA of parent H461 and river agriculture 16 for template, carry out pcr amplification, obtain 168 pairs of polymorphism SSR molecular marker altogether;
C) ssr analysis of F2 colony: the 168 pairs of polymorphism marks obtained with above-mentioned steps, for primer, utilize often pair of primer to increase the DNA of parent H461, river agriculture 16 and F2 colony plant simultaneously, carry out genotype identification, acquisition molecular marker data.The banding pattern of parent H461 is designated as A, and the banding pattern of parent river agriculture 16 is designated as B.What F2 colony strain banding pattern derived from H461 is designated as A, and what derive from river agriculture 16 is designated as B.
D) structure of linkage map: according to the molecular marker data of 168 pairs of primers, utilizes mapping software JoinMap4.0 to build genetic map.Build linkage group successively with LOD value 3 to 10, find optimum reference numerals and flag sequence, determine the linkage group of follow-up use.The Interval mapping model of software MapQTL6.0 (Interval Mapping) and many QTL is utilized to make graph model (Multiple QTL Model), and to tiller QTL in conjunction with F2 population tiller phenotypic data location widow, calculate the genetic distance between the position of few QTL of tillering and molecule marker, find that a wheat H461 karyomit(e) 2DS upper significantly existence main effect widow is tillered QTL QLtn.sicau-2D.1, interpret table form variation about 45%, its closely linked molecule marker is gpw346, and genetic distance is 0.8cM.
Beneficial effect:
The present invention widow made public for the first time from wheat H461 is tillered main effect QTL QLtn.sicau-2D.1, and be positioned at wheat 2D the short arm of a chromosome, in the section of distance short arm telomere 1.8cM (as shown in Figure 1), significantly reduce wheat tillering, LOD value is greater than 3.0; Contribution rate is large, the soluble phenotypic variation of about 45%.This QTL QLtn.sicau-2D.1 has higher utility value in wheat plant types (regulation and control are tillered) breeding.
The tiller molecule marker gpw346 of main effect QTL QLtn.sicau-2D.1 of the first public wheat H461 a woman who has recently been widowed of the present invention be codominant marker, for the identification of in plant whether containing QTL QLtn.sicau-2D.1, easy to detect, amplification is stablized, simple and easy to do.
Genetic distance between the amplified production of molecule marker gpw346 disclosed by the invention and QLtn.sicau-2D.1 is only 0.8cM, chain very tight, utilize the accuracy of molecular marker assisted selection QLtn.sicau-2D.1 high, improve the selection determination rates of the specific kind of tillering of wheat adapting to varying environment, cost-saving.
Accompanying drawing explanation
Fig. 1. wheat H461 widow tiller the position of main effect QTL QLtn.sicau-2D.1 on 2D karyomit(e) and and molecule marker of the present invention between Genetic linkage map.
The electrophoretogram of the F2 plant molecule marker gpw346 detection of Fig. 2 .H461* Chuanmai 107; Wherein 1 and 2 be respectively H461 and river agriculture 16,5,8,9,14,17 is few Tillering gene type plant, 6,11,15,18,20,21,24 is many Tillering genes type plant, and 3,4,7,10,12,13,16,19,22,23 is heterozygous genotypes plant.
Embodiment
Below in conjunction with specific embodiment, the present invention is described in detail.
Embodiment 1: wheat H461 of the present invention few the tiller location of main effect QTL and the acquisition of molecule marker
1) utilize wheat widow to tiller strain H461 for female parent, with spike number type wheat river agriculture 16 for paternal hybrid, obtain Hybrids F1, F1 generation individual plant selfing obtains F2, forms F2 genetic mapping colony at F2 random selecting 180 individual plants.
2) F2 population tiller phenotypic evaluation
The tiller number of wheat aging time field test F2 colony plant.
3) ssr analysis
A) DNA extraction: extract parent H461, river agriculture 16 and F2 colony plant DNA by CTAB method.
B) screening of polymorphic molecular marker between parent: choose GrainGenes(http: //wheat.pw.usda.gov/cgi-bin/graingenes) the upper genomic 615 pairs of SSR primers of covering hexaploid wheat A, B, D announced, with the DNA of parent H461 and river agriculture 16 for template, carry out pcr amplification, obtain 168 pairs of polymorphism SSR molecular marker altogether;
C) ssr analysis of F2 colony: the 168 pairs of polymorphism marks obtained with above-mentioned steps, for primer, utilize often pair of primer to increase the DNA of parent H461, river agriculture 16 and F2 colony plant simultaneously, carry out genotype identification, acquisition molecular marker data.The banding pattern of parent H461 is designated as A, and the banding pattern of parent river agriculture 16 is designated as B.What F2 colony strain banding pattern derived from H461 is designated as A, and what derive from river agriculture 16 is designated as B.
D) structure of linkage map: according to the molecular marker data of 168 pairs of primers, utilizes mapping software JoinMap4.0 to build genetic map.Build linkage group successively with LOD value 3 to 10, find optimum reference numerals and flag sequence, determine the linkage group of follow-up use.The Interval mapping model of software MapQTL6.0 (Interval Mapping) and many QTL is utilized to make graph model (Multiple QTL Model), and to tiller QTL in conjunction with F2 population tiller phenotypic data location widow, calculate the genetic distance between the position of few QTL of tillering and molecule marker, find that a wheat H461 karyomit(e) 2DS upper significantly existence main effect widow is tillered QTL QLtn.sicau-2D.1, interpret table form variation about 45%, its closely linked molecule marker is gpw346, and genetic distance is 0.8cM.
Embodiment 2: molecule marker of the present invention is selecting few application test of tillering on main effect QTL QLtn.sicau-2D.1
1) utilize wheat widow to tiller strain H461 for female parent, with wheat breed Chuanmai 107 of tillering for paternal hybrid, obtain Hybrids F1 more, F1 generation individual plant selfing obtains F2, at F2 random selecting 22 individual plants.
2) carry out gpw346 marker detection to obtained 22 F2 individual plants, concrete grammar is: the genomic dna extracting 22 F2 individual plants in seedling stage; Take genomic dna as substrate, with the primer pair of molecule marker gpw346 for primer carries out pcr amplification, described primer is:
Upstream primer: 5' – CGACCTTTCCCAATTCACAC – 3',
Downstream primer: 5' – TGCTTTTATTCCATCGCACA – 3'.
Pcr amplification reaction system: it is 50 μ l that 5 μ l10xPCR buffer, 1.5U Ex Taq TM archaeal dna polymerase, 2mmol/L MgCl2,0.2mmol/L dNTP, each 150ng, 100ng template DNA of upstream and downstream primer, distilled water add to total amount; B) PCR program: 94 DEG C of denaturation 5min; 94 DEG C of sex change 30s, 60 DEG C of annealing 45s, 72 DEG C of extensions 30s, totally 35 circulations; 72 DEG C extend 5min; By obtained PCR primer 6% denaturing polyacrylamide gel (Acr:Bis=19:1) electrophoretic separation, electrode buffer is 1xTBE, firm power 80W, voltage 2000 volts; Gel finally detects with cma staining.Electrophoresis result (see figure 2) finds that wherein 5 plant have the gpw346 loci of H461, predict that these 5 plant tiller number after maturation is lower; And 7 plant have the gpw346 loci of Chuanmai 107, predict that these 7 plant tiller number after maturation is higher.
3) tiller number of wheat aging time field test 22 F2 plant, the plant tillering number (1-3) that result (see table 1) has a gpw346 loci of H461 is significantly lower than the plant tillering number (8-10) of gpw346 loci with Chuanmai 107; Actual result is consistent with expected results, illustrates that widow of the present invention main effect QTL QLtn.sicau-2D.1 of tillering has the effect significantly reducing tiller number really; Simultaneously molecule marker gpw346 of the present invention may be used for selecting widow to tiller main effect QTL QLtn.sicau-2D.1.
Table 1 Molecular Prediction of the few main effect QTL QLtn.sicau-2D.1 of tillering of wheat H461 derives the tillering ability comparing result table (Line represents the line number in field) of offspring
Should be understood that, for those of ordinary skills, can be improved according to the above description or convert, and all these improve and convert the protection domain that all should belong to claims of the present invention.
Claims (4)
1. identify a molecule marking method for the few main effect QTL of tillering of wheat, it is characterized in that, described QTL is positioned at wheat 2D the short arm of a chromosome, and in the section of distance short arm telomere 1.8cM, significantly reduce wheat tillering, LOD value is greater than 3.0, explains the phenotypic variation of about 45%; Using the DNA of material to be identified as template, carry out pcr amplification with the such as primer pair shown in SEQ ID NO.1, SEQ ID NO.2; PCR primer carries out native polyacrylamide gel electrophoresis separation, then detects with argentation; Can amplify with the plant carrying out the amplified fragments same clip of pcr amplification gained for substrate with the genomic dna of wheat H461 is the plant containing few main effect QTL QLtn.sicau-2D.1 of tillering.
2. molecule marking method according to claim 1, is characterized in that, comprises the steps:
1) using the DNA of material to be identified as template, pcr amplification is carried out with the such as primer pair shown in SEQ ID NO.1, SEQ ID NO.2: a) pcr amplification reaction system: 5 μ l 10xPCR buffer, 1.5U Ex TaqTMDNA polysaccharase, 2mmol/L MgCl
2, to add to total amount be 50 μ l for 0.2mmol/L dNTP, each 150ng, 100ng template DNA of upstream and downstream primer, distilled water; B) PCR program: 94 DEG C of denaturation 5min; 94 DEG C of sex change 30s, 60 DEG C of annealing 45s, 72 DEG C of extensions 30s, totally 35 circulations; 72 DEG C extend 5min; C) PCR primer detects: PCR primer concentration is the denaturing polyacrylamide gel electrophoresis separation of 6%, Acr:Bis=19:1, and electrode buffer is 1xTBE, firm power 80W, voltage 2000 volts; Gel finally detects with cma staining;
2) labeled primer identifies that the result of QLtn.sicau-2D.1 is: can amplify with the genomic dna of wheat H461 for plant that substrate carries out the amplified fragments same clip of PCR gained is have widow to tiller the plant of main effect QTL QLtn.sicau-2D.1.
3. molecular marker primer pair is preparing the special application of tillering in material of wheat, and the upstream primer sequence of described molecule marker is as shown in SEQ ID NO.1, and downstream primer sequence is as shown in SEQ ID NO.2.
4. molecular marker primer pair assists the application in wheat plant types breeding at molecule marker, and the upstream primer sequence of described molecule marker is as shown in SEQ ID NO.1, and downstream primer sequence is as shown in SEQ ID NO.2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310190372.0A CN103275975B (en) | 2013-05-21 | 2013-05-21 | Wheat new few-tillering QTL (quantitative trait locus), primer pair, molecular marker, molecular marking method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310190372.0A CN103275975B (en) | 2013-05-21 | 2013-05-21 | Wheat new few-tillering QTL (quantitative trait locus), primer pair, molecular marker, molecular marking method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103275975A CN103275975A (en) | 2013-09-04 |
| CN103275975B true CN103275975B (en) | 2015-05-27 |
Family
ID=49058596
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310190372.0A Expired - Fee Related CN103275975B (en) | 2013-05-21 | 2013-05-21 | Wheat new few-tillering QTL (quantitative trait locus), primer pair, molecular marker, molecular marking method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103275975B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104372003B (en) * | 2014-10-27 | 2017-05-24 | 中国科学院遗传与发育生物学研究所 | Molecular marker closely linked with major QTL of wheat height and uppermost internode length as well as acquisition method and application of molecular marker |
| CN104818272B (en) * | 2015-05-04 | 2018-02-23 | 四川农业大学 | The molecular labeling SSR52 of wheat widow Tillering gene Ltn3 a kind of and its application |
| CN104818271B (en) * | 2015-05-04 | 2018-04-27 | 四川农业大学 | The molecular labeling HRM5 of wheat widow Tillering gene Ltn3 a kind of and its application |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101748217A (en) * | 2010-02-10 | 2010-06-23 | 四川省农业科学院作物研究所 | Molecule marker technology for auxiliary transforming of high-yield locus of Chuanmai 42 |
| CN101760543A (en) * | 2008-12-19 | 2010-06-30 | 李祥 | Research progress of QTL mapping in wheat |
| WO2010076766A1 (en) * | 2008-12-30 | 2010-07-08 | Institute Of Genetics And Developmental Biology | Genes associated with plant tiller number and uses thereof |
-
2013
- 2013-05-21 CN CN201310190372.0A patent/CN103275975B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101760543A (en) * | 2008-12-19 | 2010-06-30 | 李祥 | Research progress of QTL mapping in wheat |
| WO2010076766A1 (en) * | 2008-12-30 | 2010-07-08 | Institute Of Genetics And Developmental Biology | Genes associated with plant tiller number and uses thereof |
| CN101748217A (en) * | 2010-02-10 | 2010-06-23 | 四川省农业科学院作物研究所 | Molecule marker technology for auxiliary transforming of high-yield locus of Chuanmai 42 |
Non-Patent Citations (3)
| Title |
|---|
| GrainGenes Marker Report: GPW346;Sourdille Pierre;《GrainGenes》;20090930;全文 * |
| Mapping of QTL for tiller number at different stages of growth in wheat using double haploid and immortalized F2 populations;Li Z等;《J.Genet.》;20101231;第89卷(第4期);409-415 * |
| 小麦新品种川农16与新材料H461储藏蛋白及SSR差异分析;谢玥等;《西北农业学报》;20051231;第14卷(第6期);34-37 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103275975A (en) | 2013-09-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105525008A (en) | SSR molecular marker linked with wheat spikelet number QTL and application of SSR molecular marker | |
| CN103290002B (en) | Molecular marker of wheat tiller QTL (quantitative trait locus) QMtn. sicau-2B.1 and application thereof | |
| CN108754009B (en) | Method for screening tobacco black shank resistant heterogenous chromosome plant by using molecular marker | |
| CN109321671A (en) | Wheat stripe rust resisting ospc gene QYr.sicau-1B-1 SSR molecular marker and application | |
| CN103275975B (en) | Wheat new few-tillering QTL (quantitative trait locus), primer pair, molecular marker, molecular marking method and application | |
| CN104818271B (en) | The molecular labeling HRM5 of wheat widow Tillering gene Ltn3 a kind of and its application | |
| CN100494403C (en) | Method of assisting screening for cold resistant paddy rice and its special primer | |
| CN104818272B (en) | The molecular labeling SSR52 of wheat widow Tillering gene Ltn3 a kind of and its application | |
| CN104531882A (en) | Molecular marker primer pair, method and application for authenticating new dwarf main effect QTL of wheat | |
| CN109486829B (en) | Rice semi-dwarf gene sd1 allele and identification method thereof | |
| CN103290003B (en) | Molecular marker of wheat neo-few-tillering gene Ltn1 and application | |
| CN110004242B (en) | Molecular marker BrSF0239 primer of main QTL sites in flowering phase and mature phase of brassica napus and application thereof | |
| CN106755465A (en) | The molecular labeling of QTL QFll.sicau 2D close linkage long with wheat flag leaf and application | |
| CN106701751A (en) | Molecular marker closely linked with wheat flag leaf length QTL QFll.sicau-4D and application thereof | |
| CN108048599B (en) | Molecular marker closely linked with rape lateral root number major QTL site RtA07-2 and application | |
| CN104232764B (en) | The SNP marker of the low-phosphorous responsive genes ZmARF31 of corn and application thereof | |
| CN103834647B (en) | Wheat Dwarfing gene Rht dC20closely linked SSR marker Xgwm537 and uses thereof | |
| CN107746895B (en) | Molecular marker for improving barley harvest index QTL site under low-phosphorus condition and application | |
| CN104762298A (en) | Rice seedling-stage salt-tolerant gene qST11 and molecular marker method thereof | |
| CN105624277B (en) | Method for obtaining molecular marker closely linked with tobacco plant height development character | |
| CN108570515B (en) | Cold-resistant gene qCT6.7 for rice at booting stageDODMolecular marker and application thereof | |
| CN105850722A (en) | Culture method for stable and homozygous tobacco chromosome single fragment substitution line | |
| CN105177020A (en) | SSR molecular marker of wheat glume tomentum gene Hg linkage and application thereof | |
| CN105524994A (en) | Molecular marker HRM7 of barley grain length gene LkI2 and application of molecular marker | |
| CN111004857A (en) | Molecular marker primer of major QTL (quantitative trait locus) site of soybean branch number and application of molecular marker primer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150527 Termination date: 20160521 |