CN103194450A - Method for increasing activity of myogenin (MyoG) gene promoter - Google Patents

Abstract

The invention relates to a method for increasing the activity of a myogenin (MyoG) gene promoter, and belongs to the technical field of genetic engineering. The method for increasing the activity of the myogenin (MyoG) gene promoter is characterized in that a deletion fragment which is 373 bp in length and has higher muscle specific promoter activity, namely pGL3-MyoGpro373, is obtained by adopting a method for analyzing the activity of a promoter deletion fragment by means of cloning a nucleotide sequence, which is at the 5' end control region of the MyoG gene and is 2125 bp in length; a promoter element therein having the SP1 positive regulation effect is cloned; the two fragments are connected in series, so that an expression carrier containing two copying numbers of promoter regulatory elements is constructed; the expression carrier is called as pGL3-MyoGpro373-double, namely a promoter sequence having double characteristics; and the base composition of the expression carrier is represented by Seq ID No:2.

Description

The method of a kind of raising myogenin (MyoG) gene promoter activity

Technical field

The present invention relates to the method for a kind of raising myogenin (MyoG is the abbreviation of myogenin) gene promoter activity, belong to the gene engineering field.

Background technology

Eukaryotic gene expression regulation is a complexity and tight process.In the research of transgenic animal, the efficient specific promotor that obtains the energy widespread use has very important meaning for expression of exogenous gene.The Mammals core promoter comprises TATA box and promotor proximal members, is positioned at transcription initiation site upstream about 200 to 300bp.The broad sense promotor comprises all cis-regulating element such as promotor proximal members, enhanser and silencer, generally has 2 at least to the length more than the 3kb.In fact core promoter is RNA polymerase identification and combination, and makes the main site of genetic transcription.Main and the general transcription factor II(TFII of the gene core promotor of proteins encoded) combination.General transcription factor II(TFII) composition TFIID can identify the TATA box, (have another name called TATA frame, TATA box/Hogness box, be positioned at about 25bp place, transcription initiation site upstream).TF II-D, B, F and RNA polymerase II make the rna plymerase ii phosphorylation in conjunction with forming a basic initiation complex, and startup is transcribed, and RNA polymerase can specific recognition and the dna sequence dna of combination.Promotor is an integral part of gene (gene), and controlling gene is expressed the time of origin of (transcribing) and the degree of expression.

Promotor (Promoters) determines the activity of gene just as " switch ".Since gene is into the Nucleotide (nucleotides) of sequence, promotor also should be made up of DNA so.Not controlling gene activity of promotor itself, but by be called this protein (proteins) of transcribing (transcription) factor in conjunction with and the controlling gene activity.Transcription factor is being commanded the activity of enzyme (enzymes) (RNA polymerase polymerases) just as one side " flag ".This kind of enzyme is being made the rna replicon basis of gene.Generally be divided into various ways such as wide spectrum expression type promotor, tissue-specific promoter, tumor-specific promoters.The promotor of gene partly changes (sudden change), then causes the insufficiency of accommodation of genetic expression.This variation is common in malignant tumour.Eukaryotic cell contains the different RNA polymerase of 3 classes, according to its susceptibility difference to α-amanitine, is divided into RNA polymerase I (A), RNA polymerase II (B), RNA polymerase III (C), and is as follows:

The kind of enzyme	Exist	Function	Susceptibility to inhibition
				The RNA polymerase I	Kernel	Synthetic rRNA precursor	Insensitive
The RNA polymerase II	Caryoplasm	Synthetic mRNA precursor and most of snRNA	The lower concentration sensitivity
				The RNA polymerase III	Caryoplasm	Synthetic 5S rRNA precursor, tRNA precursor and other nuclear and small cytoplasmic RNA precursor	The high density sensitivity

Eukaryotic cell also has the mitochondrial RNA(mt RNA) polysaccharase, is present in plastosome, can produce mitochondrial RNA(mt RNA); The chloroplast RNA polysaccharase is present in chloroplast(id), can produce chloroplast RNA.

As RNA polymerase II identification II class promotor, catalysis mRNA and most of small nuclear RNA (snRNA) are synthetic, and its promotor is very complicated, mainly comprises 4 positions: first position is that its base of initial position of transcribing mostly is A greatly; Second position is TATA frame (TATA box), and its consensus sequence is TATA(A/T) A(A/T), be 7 Nucleotide that are rich in AT.The TATA frame is the Pribnow frame that is similar to prokaryotic promoter, is positioned at-25; The 3rd position is CAAT box (CAAT box), its consensus sequence be GGNCAATCT(wherein N be C or T), be positioned near-75; The 4th part is enhanser (enhancer), increases the speed of transcribing.

The basic structure of promoter region: promotor is one section dna sequence dna that is positioned at structure gene 5' end upstream, can activate RNA polymerase, makes it to combine exactly with template DNA and have the specificity of transcription initiation.Because can the specific transcriptional of gene depend on enzyme and promotor and form binary complex effectively, is the problem that at first will solve in the transcription initiation process so how RNA polymerase finds promotor effectively and combine with it.There is experiment to show that concerning many promotors, the speed that RNA polymerase combines with it is higher 100 times than the random collision in the pedesis at least.

Know now, transcribe initial be the critical stage of genetic expression, and the major issue in this stage is the interaction of RNA polymerase and promotor: the structure influence of promotor the avidity of it and RNA polymerase, thereby influenced the level of genetic expression.

Why RNA polymerase can only have special shape in order to be combined with RNA polymerase at the promotor place in conjunction with the nucleotide sequence at obvious promotor place, just looks like that enzyme exactly is fit to the same with the structure of its substrate mutually.The order of 100 above promotors is compared, and finding has two common orders at the about 10bp in upstream and the 35bp place in the synthetic beginning of RNA site, be called-10 with-35 sequences.The common sequence of these two sequences is as follows ,-35 districts " AATGTGTGGAAT " ,-10 districts " TTGACATATATT ".Most of promotors all have common sequence (consensus sequence), have only the difference of a few Nucleotide.

Transcriptional units (transcription unit) is one section dna sequence dna that begins to finish to terminator (terminator) from promotor, and RNA polymerase begins to advance along template from transcriptional start point, till terminator, transcribes out a RNA chain.In cell, a transcriptional units can be a gene, also can be several genes.

Transcriptional start point refer to the corresponding DNA chain of first Nucleotide of nascent RNA chain on base, studies confirm that to be generally a purine.Often the starting point front, namely 5 ' terminal sequence is called upstream (upstream), and the thereafter and i.e. 3 ' sequence of not holding is called downstream (downstream).When describing the position of base, generally use numeral, starting point is+1, downstream direction is followed successively by+2 ,+3 ..., updrift side is followed successively by-1 ,-2 ,-3 ...

Promoter region is the land of RNA polymerase, and its structure is directly connected to the efficient of transcribing.About its constructional feature, Pribnow has designed an experiment, he rna polymerase holoenzyme after template DNA is combined; with DNase l hydrolysis DNA; use the phenol extracting then, obtain a dna fragmentation of being protected by RNA polymerase behind the deposition and purification DNA, 41～44 nucleotide pairs are arranged approximately.He has successively separated the A2 of fd phage, T7 phage and A3 promotor, h and has bitten 5 sections of the PR promotor of σ thalline and the UV5 promotors of intestinal bacteria lactose operon etc. by the zone of enzyme protection; and carried out sequential analysis; later on the someone finds after having done the sequential analysis of more than 50 promotor again; in protected district by a common sequence of being formed by 5 Nucleotide; be combining closely a little of RNA polymerase; be called Pribnow district (Pribnow box) now; the central authorities in this district approximately are positioned at 10bp place, starting point upstream, so be called-10 districts again.Many prokaryotic organism all contain this two important promoter regions: RNA polymerase is called promoter region with the zone of promotor combination.With various prokaryotic genes with rna polymerase holoenzyme in conjunction with after, with DNase I hydrolysis DNA, the dna fragmentation that obtains at last being combined with RNA polymerase and be not hydrolyzed, these fragments have a common sequence of being made up of 5 Nucleotide (TATAA), naming with its discoverer is Pribnow frame (Pribnow box), the central authorities of this frame are positioned at 10bp place, starting point upstream, so claim-10 sequences (10 sequence) again, found another common sequence (TTGACA) afterwards at-35 bp places again.Hogness etc. have found the common sequence of similar Pribnow frame again in eukaryotic gene, namely be positioned at the TATAAAAG at-25～-30 bp places, also claim TATA frame (TATA box).The conserved sequence of TATA frame upstream be called upstream promoter element (upstream promoter element, UPE) or upstream activating sequence (upstream activating sequence, UAS).Also have one section common sequence C CAAT in addition at-70～-78 bp places, be called CAAT box (CAAT box).In eukaryotic gene, elder generations such as Hogness have found the Hogness district (Hogness box) in similar Pribrow district in globin gene, and this is to be positioned at the common sequence at transcripting start point upstream-25～-30 bp places like TAAA, is also referred to as the TATA district.In addition, in initiation site upstream-70～-78 bp places also educate the common sequence C CAAT of another section, this be with prokaryotic organism in-the corresponding sequence in 35bp district. be called CAAT district (CAAT box).

-10 districts and-35 districts: find but after the protected fragment of purifying that RNA polymerase can not recombine maybe can not be selected correct starting point, shows outside the protective belt also to have the sequence relevant to the identification of promotor with RNA polymerase.Really, scientist is soon just from having found common sequence: the TTGACA of another section near-35 bp of the left and right promotor PL of phage and PR and SY40 promotor.Effort through the several years, analyzed after the sequence of 46 people enterobacteria promotors. prove conclusively most promotors and all have this two sections common sequences, namely be positioned at-the 10bp place (... T89A89T50A65A100 ...) the TATA district and-35 bp places (... T85T83G81A61C69A52 ...) the TTGACA district.It has been established that, and-10 TATA district and-35 TTGACA district are the binding sites of RNA polymerase and promotor, can identify mutually with Sigma Factors and have very high avidity.The height that influence the genetic transcription activity is understood with few nucleotide purpose change between-35 districts by-10 districts in the prokaryotic organism, and strong promoter is generally 17 ± 1 bp, when spacing all can reduce the activity of promotor during less than 15 bp or greater than 20 bp.In eukaryotic gene, there is the minority gene not have the TATA frame.Do not have in the eukaryotic gene promoter sequence of TATA frame, the enrichment GC that has namely has the GC frame; What have does not then have a GC frame.The GC frame is positioned at-80～-GCCACACCC or the GGGCGGG sequence at 110bp place.The main effect of TATA frame be make transcribe accurately initial; CAAT box and GC frame then mainly are that the frequency, particularly CAAT box of control transcription initiation is bigger to the effect of transcription initiation frequency.As between the TATA frame is with adjacent UPE, inserting Nucleotide, also can influence to transcribe and make it to weaken.-10 sequences are called Pribnow box (prokaryotic organism) again.Corresponding sequence is positioned at-the 35bp place in eukaryote, is called the TATA box, is called Goldberg-Hogness box again, is the combining site of RNA polymerase II.-10 and-35 these two positions all very important: [1] RNA polymerase can and-35 and-10 sequences in base and the phosphate in the dna backbone contact; [2] activity of leaving common sequence promotor far away also a little less than; The most important thing is that [3] destroying in the sudden change of promoter function has 75% all to be to have changed the base in the common sequence, all the other 25% also are nearer from common sequence.-35 and-10 sequences at a distance of about 20bp, namely roughly be that duplex is around two length of enclosing.Because these two lands are the same sides at dna molecular, as seen this enzyme is to be combined in double-helical one side.Can imagine that it can " feel the special shape that base produces in the bottom of trench of each land." prokaryotic organism also have the minority promotor to lack one of these two sequences (35 and-10).In this case, RNA polymerase often can not be identified this promotor separately, and the help of auxiliary protein need be arranged.It may be this defective that these rho factors and the reaction of contiguous sequence can remedy promotor.In eukaryote, the CAAT order is arranged at 70-80bp place, transcription initiation site upstream, be also referred to as CAAT box.This order also is the common sequence of relatively guarding: GCCTCAATCT.The RNA polymerase II can be identified an order.In the research to rabbit beta globin genes CAAT order, find in recent years, induce CAAT to occur in sequence sudden change with manual method the transcriptional level of rabbit beta globin genes is reduced.

In the promotor-10 and-35 sequences are the combination of RNA polymerase institute and the essential order of effect.But near other DNA sequence also can influence the function of promotor.For example, the order between upstream 50 to 150 Nucleotide of the synthetic initiation site of ribosome-RNA(rRNA) is exactly necessary to the complete activity of promotor.If this section of DNA lacks in proper order and replaced (for example being cloned in the rRNA gene in the plasmid DNA) by other foreign DNAs, then the frequency of transcription initiation will reduce by 10 times.Equally, in other cases, the DNA sequence that is rich in AT of remote part is considered to promote the frequency of transcription initiation.Sometimes the upstream order can be some directly combining site of " activator " of activator RNA polysaccharase.But the upstream order often has other function.For example the upstream order can attract topoisomerase, and the latter can cause the part of combination to produce the superhelix state that is conducive to transcription initiation.The fine variation of the caused dna structure of upstream order may be transmitted to distance quite far away at duplex, so the variation of upstream order can have influence on-10 and the dna structure details in-35 districts.

The specificity of promotor is controlled by a plurality of elements, and the controlling element that plays a crucial role at different sorts and different development stage is also inequality, and the interaction between controlling element and the trans-acting factor is also very complicated.Therefore foreign gene can efficiently be expressed specifically in animal tissues, the selection of promotor is to make up one of important condition of its expression vector.At present adopt promoter deletion fragment activation analysis method usually for the research of transgenic animal field promoter activity.Namely according to the analysis of transcription factor forecasting software with determine the promoter deletion clip size, adopt the PCR method to obtain the deletion fragments of different sizes.Make up promoter activity by pGL3-Basic then and detect carrier, measure test kit by two uciferase activities and detect promoter deletion fragment activity.Change if occur sp act between the promoter deletion fragment, can verify by base mutation.Promotor very long (2-3kb), boundary is uncertain, more long-term job is more strong but do not mean promotor.Long simultaneously promotor is also not too convenient for Study on Transgenic Animal.Therefore determine that a suitable size and active promotor are very necessary.Therefore the present invention detects by activity by determining the deletion fragment of different lengths ox MyoG gene promoter, therefrom selects the short deletion fragment of some length with higher expression activity, i.e. the core promoter fragment.Further this core promoter fragment is transformed on this basis.

The MyoG gene is the important positive regulation factor in the skeletal muscle growth course.Have critical role in muscle differentiation regulatory gene, it is relevant with myofiber quantity, the speed of growth that its heritable variation is considered to, and finally cause the increase of meat yield.MyoG regulation and control mesoblastema is divided into sarcoplast, is fused to the myofiber of multinuclear again by the monokaryon sarcoplast.Therefore the MyoG gene has vital role in the research process of transgenic animal.Studies show that in a large number there is gene pleiomorphism in the MyoG gene ox, pig, sheep and chicken etc., relevant with meat productivity and meat, the MyoG activity of gene expression is more high, muscle specific is more strong, and the quality of animals such as the ox of cultivation, pig, sheep and chicken is more good.Does how transforming the MyoG gene promoter promote MyoG expression of gene activity and has a great problem that stronger muscle specific becomes the urgent need solution? so, invent a kind of with Japan and the MyoG gene promoter of ox as the transformation object, carry out pcr amplification by the suitableeest clip size and the strongest active promoter deletion fragment, and it is series at before this deletion fragment, and be positioned at before the MyoG genetic transcription initiation site, and then can construct an expression vector with promoter sequence of " double " (two) feature, can make the MyoG gene in cell system, obtain higher expression activity and method with a kind of raising myogenin (MyoG) gene promoter activity of stronger muscle specific is necessary by cell transfecting and two luciferase reporter gene expression systems.

Summary of the invention

Promote MyoG expression of gene activity and have the difficult problem of stronger muscle specific in order to overcome promotor how to transform the MyoG gene, the invention provides the method for a kind of raising myogenin (MyoG) gene promoter activity, the method of this a kind of raising myogenin (MyoG) gene promoter activity utilizes the MyoG gene promoter of Japan and ox as transforming object, carry out pcr amplification by the suitableeest clip size and the strongest active promoter deletion fragment, and it is series at before this deletion fragment, and be positioned at before the MyoG genetic transcription initiation site, and then can construct an expression vector with promoter sequence of " double " feature, can make the MyoG gene in cell system, obtain higher expression activity and have stronger muscle specific by cell transfecting and two luciferase reporter gene expression systems, promote MyoG expression of gene activity and have the purpose of stronger muscle specific thereby reach by the promotor of transforming the MyoG gene.

The technical solution adopted for the present invention to solve the technical problems is:

The method of a kind of raising myogenin of the present invention (MyoG) gene promoter activity is the 2125bp(base pair by clone MyoG gene 5 ' end control region length at first, and base pair is abbreviated as bp; The kb=kilobase is to kilobase) nucleotide sequence, adopting the method for promoter deletion fragment activation analysis to obtain 1 length is 373bp, and the comparatively desirable deletion fragment with higher muscle specific promoter activity is pGL3-MyoGpro373(pGL3-basic: the luciferase reporter gene plasmid).Inner by the bioinformatic analysis result at the 373bp deletion fragment, the promoter element that its inside is had a positive regulating and controlling effect of SP1 is cloned again, and be connected to before 373 deletion fragments of pGL3-MyoGpro373, thereby made up an expression vector that contains two copy number promoter regulation elements, be called pGL3-MyoGpro373-double, namely have the promoter sequence of " double " feature.By mouse C2C12 cell and the fibroblastic transfection of ox are shown that with two fluorescein report detections the promoter sequence with " double " feature can significantly improve MyoG expression of gene activity, the relative expression quantity of pGL3-MyoGpro373-double in mouse C2C12 cell is about 3 times of pGL3-MyoGpro373, and has good muscle specific.Promoter sequence with " double " feature can better be brought into play the promoter activity of MyoG gene, thereby instructs the expression of MyoG gene in sarcoplast.This invention simultaneously also provides a new thinking for the transformation of other gene promoters, and is also significant to the research of gene function.

Compared with prior art, the present invention has designed a kind of remodeling method of gene promoter of uniqueness.Cloned the core fragment of MyoG gene promoter by the method for PCR, and the gene element of selecting core fragment inside to have positive regulating and controlling effect is cloned again, and these two fragments are connected, acquisition has the MyoG gene promoter sequence of " double " feature, can significantly improve MyoG expression of gene activity, and have muscle specific.Compare with existing skeletal muscle specificity promoter, technology of the present invention has tangible difference and obvious improvement and specific aim.The present invention simultaneously with the MyoG gene promoter of Japan and ox as research and transformation object, in the hope of obtaining better meat quality improved effect.The promoter sequence that adopts above-mentioned transformation is applied to the cultivation of transgenic cattle by the eukaryotic gene expression system, can significantly improve MyoG expression of gene efficient, helps to improve meat quality and the speed of growth of transgenic cattle.

Beneficial effect of the present invention is: the nucleic acid sequence of promoter of " double " feature that the inventive method is transformed, structure by the pGL3-MyoGpro373-double expression vector, make the MyoG gene promoter in sarcoplast, have higher expression activity and stronger muscle specific, the expression activity of MyoG gene promoter has been improved about 3 times.Thereby satisfied goal gene at the research needs of muscle cell differentiation and breeding, can be applied to the production of transgenic cattle and other transgenic animal simultaneously, had important value for the improvement of meat quality.Use the remodeling method of this promotor, except the transformation to the MyoG gene promoter, can also be applied to the research field that other muscle development genes involveds and other transgenic animal produce, can greatly improve the transgenosis effect, be with a wide range of applications.In addition, the raising by muscle related gene expression activity has certain theory and actual application value for the treatment of muscle degenerative diseases such as amyotrophy.

Description of drawings

The present invention is further described below in conjunction with accompanying drawing.

Fig. 1 is the bioinformatic analysis diagram (Seq ID No:1) of promoter deletion fragment of the MyoG gene of 373bp for length.Contain 3 SP1(Sp1:stimulatory protein 1 in the nucleotide sequence between the arrow, stimulatory protein(SP) 1), the transcription factor of 2 MEf3,1 MEF2 and 1 TATA box regulation and control binding site, this section sequence is carried out the PCR clone, and be used for embodiment two about the structure of Japan and ox pGL3-MyoGpro373-double expression vector.

Fig. 2 is Japan and ox pGL3-MyoGpro373-double expression vector establishment synoptic diagram.MyoGpro region representation length is the promoter deletion fragment of MyoG gene of 373bp and the MyoG gene that connects subsequently thereof among the figure.The MyoGpro two side areas is the nucleotide sequence between the arrow among Fig. 1, is that the nucleic acid fragment of 373bp forms and connect with length, so is called the nucleic acid sequence of promoter of the MyoG gene with " double " feature.The carrier that obtains is the pGL3-MyoGpro373-double expression vector.

Fig. 3 is the nucleic acid sequence of promoter Seq ID No:2 with MyoG gene of " double " feature.Promoter fragment (double) through transforming before the MyoG gene: indicating the base that adds between the black alkali base with the Song typeface is a part of sequence of 373 promoter deletion sheet intersegmental parts of pcr amplification, i.e. nucleotide sequence between the arrow among Fig. 1.It for length is the MyoG gene promoter deletion fragment of 373bp thereafter.Be the Nhel that when the nucleotide sequence between the arrow among Fig. 1 is carried out pcr amplification, introduces and the restriction enzyme site of BglII to add the black base that indicates.

Fig. 4 is pGL3-MyoGpro373 and pGL3-MyoGpro373-double transfection C2C12 cell activity detected result.Wherein MyoG expression of gene activity is proofreaied and correct by renilla luciferase, has obtained the relative reactivity value of genetic expression.The relative expression quantity of pGL3-MyoGpro373-double in mouse C2C12 cell is about 3 times of pGL3-MyoGpro373, though its expression activity is lower than the pGL3-MyoG-CMV expression vector.

Fig. 5 is the fibroblastic active detected result of pGL3-MyoGpro373 and pGL3-MyoGpro373-double transfection ox.PGL3-MyoG-CMV(CMV: cytomegalovirus) for having the MyoG expression vector of viral promotors, it has stronger startup activity (shown in Figure 4) for the MyoG gene, but in inoblast, also has stronger startup activity, therefore do not possess muscle specific, be in the consideration of transgenic animal biological safety problem aspect simultaneously, it is not suitable for being applied to the actual production in transgenic animal.And pGL3-MyoGpro373-double expresses in the ox inoblast hardly, shows that it has very strong muscle specific.

Embodiment

In the context of the present specification, unless specialize otherwise the used any term of this specification sheets has those skilled in the art's implication of common sense in the art, and the experimental technique of unreceipted detailed conditions is to carry out according to the routine test method or according to the process specifications that supplier advises.

The structure of embodiment one Japan and ox MyoG gene promoter deletion sequence pGL3-MyoGpro expression vector

Collect Japan and the ox inoblast of capacity, utilize Tissue DNA Kit to extract genomic dna, packing-70 ℃ preservation is standby.According to the MyoG gene order among the NCBI, utilize software Primer Premier 5 design primers.Obtaining length by the PCR reaction is the Japan of 2125bp and the MyoG gene 5 ' end control region sequence of ox.

Utilize transcription factor forecasting software: MatInspector(http: //www.genomatix.de/en/index.html) fragment of being cloned into is carried out Transcription Factor Binding Sites Prediction.Obtain the promoter deletion fragment of a series of different lengthss and position by the analysis of information biology, make up corresponding MyoG gene promoter deletion sequence pGL3-MyoGpro expression vector respectively.By transfection mouse C2C12 cell and ox inoblast, parallel two luciferase reporter genes detect, and obtaining 1 length is 373bp, and has the comparatively desirable deletion fragment of higher muscle specific promoter activity, called after pGL3-MyoGpro373.

The primer title	Primer sequence
		MyoG pro373 upstream (5 '-3 ')	ATTGAAAGGAGCAGATGAGG（Seq ID No:5）
MyoG pro373 downstream (5 '-3 ')	TCAGAAGAGACTTGTTCCTGCCACC（Seq ID No:6）

It is as follows that Tissue DNA Kit extracts the genomic dna step:

1. discard nutrient solution, use 4mlPBS washed cell 3 times, use 500 μ l trypsin digestion and cells then, in centrifuge tube, the centrifugal 5min of 1000rpm room temperature thoroughly removes supernatant with cell transfer;

2. add 25ulOB proteolytic enzyme, mixing in 65 ℃ of water bath processing 5min, allows the complete cracking of cell;

3. add 220ulBuffer BL, the vortex mixing is handled 10min in 70 ℃;

4. add 220ul dehydrated alcohol vortex mixing;

5. all lysates that the 4th step was obtained change in the pillar and (comprise all throw outs), and the centrifugal 1min of 12000rpm discards filtered solution and collection tube with in conjunction with DNA;

6. add 500ulHB Buffer, the centrifugal 1min of 12000rpm discards filtered solution and collection tube;

7. add 700ulDNA Wash Buffer, the centrifugal 1min of 12000rpm discards filtered solution;

8. repeating step 7;

9. the centrifugal hollow 2min of 12000rpm is with dry pillar;

10. pillar is placed the 1.5mlEP pipe, add the DNA Elution Buffer of 50 ~ 200ul70 ℃ of preheating, room temperature leaves standstill 3min, and the centrifugal 1min of 15000rpm is with eluted dna.

PCR reaction conditions: 94 ℃ of 5min

With reference to " molecular cloning experiment guide " method, the PCR product is carried out the agarose gel electrophoresis inspection.

(1) prepare 0.8% sepharose with 1 * TAE damping fluid, agarose heating is dissolved the back and is added ethidium bromide EB to make the running gel plate stand-by.

(2) get amplified production and add 6 * Loading Buffer(sample-loading buffer) mixing, sample hole in the adding, simultaneously with standard DNA molecular mass (DL-2000/DL-15000 Marker) in contrast, 100V/cm constant current electrophoresis 15min, the photo analytical results is observed and left and taken to the ultraviolet gel imaging system.

The glue of PCR product reclaims purifying: reclaim dna fragmentation and adopt Beijing TransGen company glue recovery test kit to carry out from sepharose, concrete grammar is as follows:

(1) the agar sugar that will contain purpose fragment band is cut off, and puts into the centrifuge tube of 1.5mL.

(2) add the sol solutions of 300 μ L by every 100mg agarose, place 55 ℃ of water-bath 10min, agarose is dissolved fully, every 2min puts upside down mixing once.Agar liquid glucose after will dissolving moves into the adsorption column dress and lives, and room temperature leaves standstill 1-2min, and the centrifugal 30s of 12000rpm removes waste liquid in the collection tube.

(3) 700 μ L rinsing liquid rinsings, 10000rpm is centrifugal, and 30s outwells waste liquid, repeats once to outwell waste liquid again, centrifugal 30s under the 10000rpm.

(4) adsorption column is put in the new 1.5mL centrifuge tube, central authorities add elution buffer H at adsorption column ₂O 30 μ L-50 μ L, room temperature is placed 1-2min, the centrifugal 1min of 10000rpm.1.5mL the DNA in the centrifuge tube is stored in-20 ℃.

The double digestion of plasmid

Reagent	Consumption
		BglII	1μL
HindIII	1μL
10×K Buffer	2μL
		Plasmid	3μL
ddH2O to	20μL

The endonuclease reaction condition is: 37 ℃ of water-baths, 3h.After endonuclease reaction is finished, 0.8% agarose gel electrophoresis detected result.

The ligation of recombinant plasmid pGL3-MyoG

Reagent	Consumption
		The purpose fragment	9μL
T4 Buffer	2μL
		The T4 ligase enzyme	1μL
pGL3-Basic	3μL
		ddH 2O to	20μL

Condition of contact: 16 ℃ are spent the night.

After connection was finished, 20 μ L products all transformed DH5 α competent cell, and coating LB solid medium is inverted overnight incubation for 37 ℃.Choose the mono-clonal thalline and extract plasmid, BglII and HindIII double digestion are identified positive recombinant plasmid.

Conversion process:

(1) competent cell is taken out from refrigerator, put on ice, treat its thawing.

(2) get 15 μ L DNA connection product and add in the 100 μ L competent cells, after mixing gently, ice bath 30min.

(3) 42 ℃ of heat-shocked 90s place cooled on ice 2min then rapidly.

(4) competent cell is all joined in the 1.5 mL pipes that 600 μ L LB are housed, 37 ℃ are shaken bacterium cultivation 1h, make the recovery of host bacterium and express resistant gene.

(5) centrifugal 10000rpm 1min abandons supernatant, remaining bacterium liquid piping and druming is overhang and coats contain the antibiotic LB nutrient agar of corresponding ammonia Bian, should put 20 μ L ammonia Bian microbiotic in the 20 mL LB substratum.Be inverted to cultivate 12 ~ 16h for 37 ℃, treat that bacterium colony grows after, the single bacterium colony of random choose is done further culture identification.

Mouse C2C12 cell and ox inoblast are cultivated.When the stand density of culturing cell arrives the 80%-90% left and right sides, discard nutrient solution, use the PBS of no calcium ions and magnesium ions to wash three times, add 0.25% tryptic digestion of 0.5mL, place 1-2min for 37 ℃.During microscopically 80% cell rounding, add the cell grown cultures liquid termination digestion that 5.5mL contains DMEM cell culture fluid+15% standard foetal calf serum, go down to posterity in the 1:2 ratio.

Cell transfecting: the transfection plasmid extracts with no intracellular toxin plasmid extraction kit.Plasmid transfection reagent is polymine (PEI).Before the transfection 24h with cell with 4-8 * 10 ⁵In the density shop and 24 orifice plates of cells/well.When treating that the complete adherent growth to 80% of cell～90% merges, according to PEI transfection operation steps with different expression vectors and sea pansy gene confidential reference items plasmid phRL-TK with the 50:1(mass ratio) ratio cotransfection mouse C2C12 cell and ox inoblast respectively, pGL3-Basic empty carrier and phRL-TK with same condition as negative control group cotransfection cell, behind the transfection 4h, change differentiation culture liquid (2% horse serum+98%DMEM cell culture fluid) into, collecting cell behind the transfection 72h.

Two luciferase reporter genes detect: adopt two luciferase reporter gene detection kit (Promega) to measure the expression level of reporter gene.Experimental procedure is summarized as follows: discards the cell culture fluid in 24 orifice plates, uses PBS washed cell 2 times, adding 100ul cell pyrolysis liquid (1 * PLB), after room temperature is placed 15min, the collecting cell lysate.Get the 20ul cell pyrolysis liquid to the fluorometric assay pipe, add 100uL detection reagent (firefly luciferase.LARII), measure luminous value with Chemiluminescence Apparatus (FB 12 Luminometer) behind the mixing, the value during record 10s adds the Stop﹠amp of 100ul at last; GLO reagent is measured as interior target Renilla luciferase luminous value, the value when detecting 10s simultaneously, both ratios are the relative reactivity RLA(Relative Luciferase Activity of luciferase).The numerical value of RLA is 3 repeated experiments mean+SD as a result.The concrete operations step is referring to Promega detection kit specification sheets

The preparation of 1 * PLB: calculate according to the institute expense, 5 * PLB of 1 times of volume is added in the distilled water of 4 times of volumes, mix 4 ℃ of preservations.The preparation before each use of this solution is fresh.

LAR II: with fluoroscopic examination damping fluid (Luciferase Assay Buffer II) dissolved freeze-dried powder, mix the back and can preserve one month at-20 ℃, can preserve 1 year at-70 ℃.

Stop ﹠amp; Glo reagent: get an amount of 50 * Stop ﹠amp; Glo Substrate joins the Stop ﹠amp of requirement; Among the Glo Buffer, make final concentration become 1 times of concentration.

Specimen preparation

Discard the cell culture fluid in 24 orifice plates, add 1 * PBS and clean culturing cell, wash 2 times.Remove scavenging solution, add the fresh preparation lysate (1 * PLB) of 100 μ l.Room temperature is placed 15min, and the collecting cell lysate is in centrifuge tube.The centrifugal 5min of 12 000 r/min gets 20 μ L supernatant liquors in clean centrifuge tube, and sample retention is in-20 ℃

The structure of embodiment two Japan and ox pGL3-MyoGpro373-double expression vector

Following desiring to make money or profit with the MyoG promoter regulation element between the method for the PCR amplification red arrow, and being connected to before the 373bp deletion fragment of pGL3-MyoGpro373 is the nucleic acid sequence of promoter of MyoG gene with " double " feature.Nhel and BglII that restriction enzyme site is introduced have been introduced during pcr amplification, the nucleic acid sequence of promoter that will have the MyoG gene of " double " feature by double digestion and ligation is connected in the upstream of MyoG gene, thereby has made up pGL3-MyoGpro373-double.

The preparation of the system that pcr amplification purpose fragment is used

Be that template is template with pGL3-MyoGpro, utilize the primer among the table 2-17, carry out pcr amplification with LA Taq polysaccharase.The PCR response procedures is: 94 ℃ of pre-sex change 5min, and 94 ℃ of sex change 30s, 68 ° of annealing 30s, 72 ℃ are extended 1min, totally 35 circulations; 72 ℃ are extended 10min eventually, are cooled to 4 ℃ of preservations.Obtain containing the sequence of multiple controlling element with its called after double.

To the PCR product carry out the agarose gel electrophoresis inspection, reclaim purifying, enzyme is cut, connect with 2 in identical

Cell transfecting and the detection of embodiment three pGL3-MyoGpro373-double expression vectors

With the pGL3-MyoG-CMV(CMV(cytomegalovirus that has made up) the MyoG expression vector of promotor), pGL3-MyoGpro373, pGL3-MyoGpro373-double and pGL3-Basic expression vector transfection mouse C2C12 cell and ox inoblast respectively, and carry out two uciferase activities and measure.Specific implementation method is identical with embodiment 1.Detected result shows that the specific activity pGL3-MyoGpro373 that transforms back pGL3-MyoGpro373-double promotor has improved 3 times.And kept good muscle specific, can be good at being applied in the research of transgenic animal.

More than show and described ultimate principle of the present invention and principal character and advantage of the present invention.The technician of the industry should be appreciated that; the present invention is not restricted to the described embodiments; that describes in above-described embodiment and the specification sheets just illustrates principle of the present invention; without departing from the spirit and scope of the present invention; the present invention also has various changes and modifications; these changes and improvements all fall in the claimed scope of the invention, and the claimed scope of the present invention is defined by its equivalent of appending claims.

＜110〉Northeast Agricultural University

＜120〉method of a kind of raising myogenin (MyoG) gene promoter activity

<160>10

<210>1

<211>446

<212>DNA

＜213〉artificial sequence

<400>1

CCTTGGCCTT?CCCCCACCCC?ACCCCTCTTC?TTTGAGGCTA?GCAGCAGGCA 50

GGCCGCCCAG?CTAGGAGTAA?TTGAAAGGAG?CAGATGAGGG?GAGAATGTGT 100

GTCCTCCCCC?AGCTTCCCGG?CCCCCACGGG?GGCTGTCGAG?AAATGAAAAC 150

TAGTCAGATT?ACACCCGTGG?CCTCCCTCCC?AGTGCACGGG?AGCCAGCTAG 200

GGGTAGGCCG?GCTGGGGCGG?GGGCCGGGGT?GGTGTGTGTGCA?GGGGGAGAGG?250

GAAGGGGAAT?CACGTCTAAT?CCACTGTAAA?CCGTCTTGATG?TGCAGCAACA 300

GCTTAGAGGG?CGGCTCAGGT?TTCTGTGGCG?TTGGCTATAT?TTATCTCTGG 350

TTCCATGCCA?GCGGGGAGGG?TTTAAATGGC?ACCCAGCAGT?TGGCGTGAGG 400

GGCCGCAGGA?GCTTGGGGGC?TGGTGGCAGG?AACAAGTCTC?TTCTGA 446

<210>2

<211>558

<212>DNA

＜213〉artificial sequence

<400>2

GCTAGCTAGT?GGGGCGGGGG?CCGGGGTGGT?GTGTGCAGGG?GGAGAGGGAA?GGGGAATCAC 60

GTCTAATCCA?CTGTAAACGT?CTTGATGTGC?AGCAACAGCT?TAGAGGGGGG?CTCAGGTTTC 120

TGTGGCGTTG?GCTATATTTA?TCTCTGGTTC?CATGCCAGCG?GGGAGGGTTA?AA GGAAGATC 180

TTCCATTGAA?AGGAGCAGAT?GAGGGGAGAA?TGTGTGTCCT?CCCCCAGCTT?CCCGGCCCCC 240

ACGGGGGCTG?TCGAGAAATG?AAAACTAGTC?AGATTACACC?CGTGGCCTCC?CTCCCAGTGC 300

ATGGGAGCCA?GCTAGGGGTA?GGCCGGCTGG?GGCGGGGGCC?GGGGTGGTGT?GTGCAGGGGG 360

AGAGGGAAGG?GGAATCACGT?CTAATCCACT?GTAAACGTCT?TGATGTGCAG?CAACAGCTTA 420

GAGGGGGGCT?CAGGTTTCTG?TGGCGTTGGC?TATATTTATC?TCTGGTTCCA?TGCCAGCGGG 480

GAGGGTTTAA?ATGGCACCCA?GCAAGTTGGC?GTGAGGGGCC?GCAGGAGCTT?GGGGGCTGGT 540

GGCAGGAACA?AGTCTCTT 558

<210>3

<211>16

<212>DNA

＜213〉artificial sequence

<400>3

CCCAATATAG?GGATCGAACT?CAGGTC 16

<210>4

<211>15

<212>DNA

＜213〉artificial sequence

<400>4

TCAGAAGAGA?CTTGTTCCTG?CCACC 15

<210>5

<211>10

<212>DNA

＜213〉artificial sequence

<400>5

ATTGAAAGGA?GCAGATGAGG 10

<210>6

<211>15

<212>DNA

＜213〉artificial sequence

<400>6

TCAGAAGAGA?CTTGTTCCTG?CCACC 15

<210>7

<211>15

<212>DNA

＜213〉artificial sequence

<400>7

CTAGCTAGCT?AGTGGGGCGG?GGGCC 15

<210>8

<211>15

<212>DNA

＜213〉artificial sequence

<400>8

GGAAGATCTT?CCTTTAAACC?CTCCCCGCTG?GCAT 34

Claims (1)

1. method that improves myogenin (MyoG) gene promoter activity, it is characterized in that by clone MyoG gene 5 ' end control region length be the nucleotide sequence of 2125bp, adopting 1 length of method acquisition of promoter deletion fragment activation analysis is 373bp, and the comparatively desirable deletion fragment with higher muscle specific promoter activity is pGL3-MyoGpro373, this fragment is the core fragment of MyoG gene promoter, inner by the bioinformatic analysis result at the 373bp deletion fragment, the promoter element that its inside is had a positive regulating and controlling effect of SP1 is cloned again, and these two fragments are connected, the promoter element with the positive regulating and controlling effect of SP1 that is about to new clone is connected to before 373 deletion fragments of pGL3-MyoGpro373, thereby made up an expression vector that contains two copy number promoter regulation elements, be called pGL3-MyoGpro373-double, the promoter sequence that namely has " double " feature is shown in its based composition Seq ID No:2.

Images