CN103146829A - Method for assistant selection of goose muscle fatty acid performances by utilizing molecular markers - Google Patents

Abstract

The invention discloses a method for assistant selection of goose muscle fatty acid performances by utilizing molecular markers and belongs to the technical field of animal genetic engineering. The method comprises the following steps of: (1), designing a special primer of a goose THRSP (Thyroid Hormone Response Gene) alpha gene segment; (2), carrying out PCR (Polymerase Chain Reaction) amplification; (3), carrying out polymorphic analysis to a PCR product; and (4), selecting superior goose parent individuals. According to the method for assistant selection of goose muscle fatty acid performances by utilizing molecular markers disclosed by the invention, the goose muscle fatty acid performances can be selected according to a gene type; the method has the characteristics of being high in precision, simple to operate, low in selection cost (about 0.3 RMB per goose) and the like; and the slaughter performances can be selected at the early life stage of the goose, so that the generation interval is shortened, the breeding process of the goose is quickened up, and each generation can be shortened by about three months. The method can be popularized and applied in the goose quality breeding field.

Description

Utilize the method for the acid shape of molecular marker assisted selection goose muscle fat

Technical field

The present invention relates to animal gene engineering technology field, be specifically related to the clone of the acid shape genes involved of goose muscle fat and the application in marker assisted selection thereof.

Background technology

Lipid acid is important chemical substance and the histiocytic important component part that consists of fat, and the lipid acid in muscle fat forms the local flavor that not only affects meat, and relevant with the consumer health.Nutritional studies thinks, human body blood fat and blood cholesterol content are subjected to the impact that in diet, lipid acid consists of, and saturated fatty acid wherein causes that blood fat raises, and unsaturated fatty acids has the effect of hypercholesterolemia.Epidemic research is found, the lipid content in diet, lipid acid composition directly related with cardiovascular disorder (Williams, 2000).Therefore as one of important indicator of estimating muscle nutrition value, the composition of lipid acid is subject to people's attention day by day.

It is reported, kind is the major influence factors that determines that in meat, fatty acid component changes, and the livestock and poultry species that has a high-quality Meat Performance by cultivation improves that in meat product, unsaturated fatty acid content seems particularly important.The difference that in Comprehensive Assessment different varieties animal muscle, saturated lipid acid and unsaturated fatty acids form is breeding selection material group's prerequisite.But be difficult on living animal due to muscle fat acid directly measure, the conventional breeding method is by slaughtering, get fresh chest muscle meat sample, adopt vapor-phase chromatography to carry out the lipid acid ratio analysis, cycle is long, efficient is low, the high in cost of production shortcoming and the method that this employing phenotype is selected genotype indirectly exists, so conventional breeding method progress is slower.For this reason, many investigators are constantly exploring new more efficiently animal muscle lipid acid proterties selection technology, to change the deficiency of conventional system of selection.

Molecular genetic marker causes the DNA fragmentation length polymorphism as the basis take species gene sudden change, has many advantages: the difference that (1) can the direct detection DNA level is not subjected to the restriction of space-time; (2) marker number is abundant, polymorphism is high; (3) the codominance sign, can distinguish homozygote and heterozygote; (4) can explain some individual heritable variation in family; (5) can identify the individuality of different sexes, different ages; (6) in the process of selecting the acid shape of muscle fat, needn't do expensive slaughter experiment.This shows, utilize the genetic marker be easy to identify, including Molecular Marker Information in breeding plan in, to carry out assisted Selection be to improve efficiency of selection, shortens the generation interval, improves selection intensity, accelerates the effective means of genetic progress.Developing rapidly of genome research in recent years, the application of the technique means such as gene pyramiding, transgenosis makes molecular marker assisted selection be applied to genetic improvement and becomes a reality, and make significant progress (You Xiaoyan etc., 2007; Liu etc., 2008; Wu etc., 2006; Thue, 2002).Yet, at present also rarely have report for the marker assisted selection of the acid shape of goose muscle fat in the world, effective evaluation system of selection of the acid shape of goose muscle fat is also never proposed, select the field still to belong to blank at the molecule marker of the acid shape of goose muscle fat.Therefore set up a kind of effective molecule marking method of evaluating the acid shape of goose muscle fat very necessary, also can be the meat goose kind with the acid shape of good muscle fat simultaneously and select to provide reliable foundation.

Summary of the invention

The present invention seeks to, select the acid shape of goose muscle fat still to belong to blank deficiency for the relevant molecular marking technique that utilizes, the THRSP that utilizes that a kind of life goose just can begin in early days, accuracy is high, the seed selection cycle is short, cost is low is provided ^αThe gene molecule Genetic Markers is selected the method for the acid shape of goose muscle fat.

The method of utilizing the acid shape of molecular marker assisted selection goose muscle fat of the present invention, obtain after completing following element task:

1) the acid shape THRSP of goose muscle fat ^αGene cloning and polymorphism analysis:

According to GenBank No. EU710582.1 goose THRSP ^αGene order, utilize Primer and Oligo software design primer, upstream primer sequence A SF:5 '-GTGCTGCCTGTACCGTCCAA-3 ', downstream primer sequence A SR:5 '-GGGAAGCAGTTACACCATCAGAG-3 ', take goose poba gene group DNA as template, carry out pcr amplification reaction, the PCR reaction system of employing and reaction conditions are same as the technical scheme in summary of the invention; The PCR product detects through 1.5% agarose gel electrophoresis, result as shown in Figure 1, the amplified production specificity is good, clip size conforms to the 221bp of expection.Separation and purification purpose fragment is carried out direct Sequencing, found that to comprise goose THRSP in the pcr amplification product sequence ^αThe 3' flanking region Partial Fragment of gene shows the analytical results of single nucleotide polymorphism (SNPs), at the 109bp place, a base mutation (C/T) (see figure 2) occurs, and has three kinds of genotype of CC, CT and TT;

2) to the mensuration of goose muscle fat acid relative content:

Take the fresh leg flesh of goose in-70 ℃ of freezing preservations, adopt the gas chromatography mass spectrometry method to measure saturated fatty acid (comprising lauric acid, myristic acid, pentadecylic acid, palmitinic acid, margaric acid, stearic acid, eicosanoic acid and behenic acid) and unsaturated fatty acids (comprising pentadecylenic acid, Zoomeric acid, heptadecenoic acid, oleic acid, eicosenoic acid, erucic acid, linolic acid, linolenic acid, arachidonic acid) relative content;

3) goose THRSP ^αThe analysis of gene pleiomorphism and muscle fat acid relative content cognation:

Adopt the GLM program of SAS9.1 software to THRSP ^αGene pleiomorphism and muscle fat acid relative content carries out association analysis, indices corresponding to different genotype with least squares means ± standard error (LSM ± SE) expression, linear model is:

Y _ij ?=?μ+G _i +L _j ?+(GL) _ij ?+S _k +E _ijk

Wherein: Y _ij Be the observed value of proterties, μBe colony's average, G _i Be the genotype effect, L _j Be variety effect, (GL) _ij For genotype and kind make mutually effect, S _k Be sex-effects, E _{Ij k} Be random residual.

Result is as shown in table 1, goose THRSP ^α3 kinds of genotype of gene mutation site are on muscle fat acid relative content existence impact in various degree.Wherein the saturated fatty acid content of CT genotype individuality is the highest, with the individual comparing difference of CC and TT genotype significantly ( P＜0.01 or P＜0.05); And the unsaturated fatty acid content of CC genotype individuality is the highest, with the individual comparing difference of CT and TT genotype significantly ( P＜0.01 or P＜0.05); The individual saturated fatty acid of TT genotype and unsaturated fatty acids relative content are between CT and CC genotype individuality.

 

The individual muscle fat acid of table 1 different genotype East Zhejiang province white goose relative content

On the basis of obtaining the acid shape relevant information of above-mentioned goose molecular genetic marker and muscle fat, the object of the invention is achieved through the following technical solutions.

Utilize the method for the acid shape of molecular marker assisted selection goose muscle fat, carry out according to the following steps:

(1) design goose THRSP ^αThe Auele Specific Primer of gene fragment: according to GenBank No. EU710582.1 goose THRSP ^αGene order design primer:

Its upstream primer sequence is ASF:5 '-GTGCTGCCTGTACCGTCCAA-3 ';

Its downstream primer sequence is ASR:5 '-GGGAAGCAGTTACACCATCAGAG-3 ';

(2) pcr amplification reaction: 100-200 meat goose of random selection is individual in meat gaggle body to be selected, gather blood from each individual wing vein, the phenol-chloroform method is extracted poba gene group DNA routinely, and adopts above-mentioned primer and genomic dna template to carry out pcr amplification reaction; The reaction system that adopts is 25 μ L:10 * PCR Buffer (Mg ²⁺Plus) 2.5 μ L, 2.5 mmolL ^-1DNTP1.0-3.0 μ L, 10 μ molL ^-1Upstream primer 0.4-0.6 μ L, 10 μ molL ^-1Downstream primer 0.4-0.6 μ L, 50 ng μ L ^-1Template DNA 0.5 μ L, 5.0U μ L ^-1RTaq enzyme 0.15-0.35 μ L, ddH ₂O17.45-20.05 μ L; The pcr amplification reaction condition is 95 ^o C denaturation 5 min, 95 ^oC sex change 30s, 50-60 ^oThe C 30s that anneals, 72 ^oC extends 30s, 33-38 circulation, 72 ^oC extends 10 min, 4 ^oC finishes reaction;

(3) polymorphism analysis of pcr amplification product: get each individual PCR product and detect through 1.5% agarose gel electrophoresis, direct Sequencing is carried out in the separation and purification approximately purpose fragment of 221bp, analyzes its SNPs single nucleotide polymorphism, clear and definite each individual affiliated genotype;

(4) selection of winning meat goose parent individuality: the genotypic individuality of the CC that selects and remain is eliminated CT and the genotypic individuality of TT as meat goose Selection parent.

The invention has the beneficial effects as follows:

The first, the present invention carries out the selection of the acid shape of muscle fat to goose according to genotype, has the characteristics such as tolerance range is high, simple to operate, expense low (alternative costs are about 0.3 yuan /), and can carry out the scale detection of automatization;

Second, utilize molecule marking method of the present invention can early stage at the life of meat goose (in rear 1 week of birth) can begin to select the proterties of muscle fat acid, and needn't do expensive adult meat goose slaughter experiment, generation interval can be shortened, improve selection intensity, select earlier good kind goose parent, thereby accelerate the breeding process of meat goose, can shorten select time about 3 months with slaughter experiment system of selection more per generation of routine;

The 3rd, utilize molecule marking method of the present invention that the acid shape of goose muscle fat is selected, can be not only that in meat goose breeding work, marker assisted selection provides more effective, a simple and easy to do molecule marking method, can overcome simultaneously the impacts such as the acid shape system of selection of conventional muscle fat workload is large, easily affected by environment and breeding cycle is long, for the acid shape improvement of goose muscle fat provides a kind of effective molecular marker breeding means, accelerated the genetic breeding progress of meat goose.

Description of drawings

Fig. 1: the acid shape THRSP of goose muscle fat ^αGene PCR product agarose gel electrophoretogram

Wherein, sepharose concentration is 1.2%, swimming lane 1 ~ 10:THRSP ^αGene PCR amplified production, length are 221bp; M swimming lane: DNA molecular amount mark (DL2000 DNA ladder).

Fig. 2: the acid shape THRSP of goose muscle fat ^αGene clone partial dna sequence figure

In figure, the 109th place of DNA sequence dna shows by the allelic mutation of C to T, sees parenthesis part.

Embodiment

The present invention is described in further detail by following examples, but be to be understood that the present invention is not placed restrictions on by following content.

The rTaq that following examples adopt, dNTPs, 10 * PCR Buffer, 6 * loading buffer and DL2000 DNA ladder are all available from precious biotechnology (Dalian) company limited.

The selection of the acid shape of embodiment 1:(East Zhejiang province white goose muscle fat)

(1) according to GenBank No. EU710582.1 goose THRSP ^αGene order design primer:

Its upstream primer sequence is ASF:5 '-GTGCTGCCTGTACCGTCCAA-3 ';

Its downstream primer sequence is ASR:5 '-GGGAAGCAGTTACACCATCAGAG-3 ';

(2) pcr amplification reaction: select 150 conducts individuality of reserving seed for planting in advance in the white goose colony of East Zhejiang province, gather blood from each individual wing vein, the phenol-chloroform method is extracted poba gene group DNA routinely, and adopting above-mentioned primer and genomic dna template to carry out pcr amplification reaction, the reaction system that adopts is 25 μ L:10 * PCR Buffer (Mg ²⁺Plus) 2.5 μ L, 2.5 mmolL ^-1DNTP 3.0 μ L, 10 μ molL ^-1Upstream primer 0.4 μ L, 10 μ molL ^-1Downstream primer 0.4 μ L, 50 ng μ L ^-1Template DNA 0.5 μ L, 5.0U μ L ^-1RTaq enzyme 0.25 μ L, ddH ₂O 17.95 μ L; The pcr amplification reaction condition is 95 ^o C denaturation 5 min, 95 ^oC sex change 30s, 60 ^oThe C 30s that anneals, 72 ^oC extends 30s, 33 circulations, 72 ^oC extends 10 min, 4 ^oC finishes reaction;

(3) polymorphism analysis of pcr amplification product: get each individual PCR product and detect through 1.5% agarose gel electrophoresis, direct Sequencing is carried out in the separation and purification approximately purpose fragment of 221bp, and after analyzing its SNPs single nucleotide polymorphism, clear and definite each individual affiliated genotype;

(4) selection of the winning parent's individuality of East Zhejiang province white goose: the genotypic individuality of tool CC of therefrom selecting and remain is eliminated tool CT and the genotypic individuality of TT as the parent of East Zhejiang province white goose.

Here be described as example take wherein 10 individuality of reserving seed for planting in advance, these 10 East Zhejiang province white gooses are first measured respectively the relative content of each individual muscle fat acid, then through pcr amplification product THRSP ^αThe analysis of the acid shape cognation of gene pleiomorphism and muscle fat: the dependency (seeing table 2 for details) that obtains respectively each individual different genotype and the acid shape of muscle fat with least-square analysis;

The acid shape of the muscle fat of table 2 different genotype East Zhejiang province white goose individuality

From above-mentioned 10 individualities, 1,3, the 6 and No. 10 genotypic individuality of CC selected and remain is as the Selection parent of East Zhejiang province white goose, eliminates all the other CT and the genotypic individuality of TT and namely forms breeding parent colony.

 

The selection of the acid shape of the bright moral goose of embodiment 2:(muscle fat)

In this example, step (2) pcr amplification reaction is: select 200 individualities of reserving seed for planting in advance at bright moral gaggle body, the reaction system that adopts is 25 μ L:10 * PCR Buffer (Mg ²⁺Plus) 2.5 μ L, 2.5 mmolL ^-1DNTP 2.0 μ L, 10 μ molL ^-1Upstream primer 0.5 μ L, 10 μ molL ^-1Downstream primer 0.5 μ L, 50 ng μ L ^-1Template DNA 0.5 μ L, 5.0U μ L ^-1RTaq enzyme 0.15 μ L, ddH ₂O 18.85 μ L; The pcr amplification reaction condition is 95 ^o C denaturation 5 min, 95 ^oC sex change 30s, 55 ^oThe C 30s that anneals, 72 ^oC extends 30s, 35 circulations, 72 ^oC extends 10 min, 4 ^oC finishes reaction; All the other steps (1), (3), (4) are same as embodiment 1 with technique;

Here be described as example take wherein 10 individuality of reserving seed for planting in advance, these 10 bright moral geese are first measured respectively the relative content of each individual muscle fat acid, then through pcr amplification product THRSP ^αThe analysis of the acid shape cognation of gene pleiomorphism and muscle fat: the dependency (seeing table 3 for details) that obtains respectively each individual different genotype and the acid shape of muscle fat with least-square analysis;

The acid shape of the muscle fat of the bright moral goose of table 3 different genotype individuality

From above-mentioned 10 individualities, 3, the 6 and No. 8 genotypic individualities of CC selected and remain are as the Selection parent of bright moral goose, eliminate all the other CT and the genotypic individuality of TT and namely form breeding parent colony.

 

The selection of the acid shape of embodiment 3:(rivers and mountains white goose muscle fat)

In this example, step (2) pcr amplification reaction is: select 100 individualities of reserving seed for planting in advance in rivers and mountains white goose colony, the reaction system that adopts is 25 μ L:10 * PCR Buffer (Mg ²⁺Plus) 2.5 μ L, 2.5 mmolL ^-1DNTP 1.0 μ L, 10 μ molL ^-1Upstream primer 0.6 μ L, 10 μ molL ^-1Downstream primer 0.6 μ L, 50 ng μ L ^-1Template DNA 0.5 μ L, 5.0U μ L ^-1RTaq enzyme 0.35 μ L, ddH ₂O 19.45 μ L; The pcr amplification reaction condition is 95 ^o C denaturation 5 min, 95 ^oC sex change 30s, 50 ^oThe C 30s that anneals, 72 ^oC extends 30s, 38 circulations, 72 ^oC extends 10 min, 4 ^oC finishes reaction; All the other steps (1), (3), (4) are same as embodiment 1 with technique;

Here be described as example take wherein 10 individuality of reserving seed for planting in advance, these 10 rivers and mountains white gooses are first measured respectively the relative content of each individual muscle fat acid, then through pcr amplification product THRSP ^αThe analysis of the acid shape cognation of gene pleiomorphism and muscle fat: the dependency (seeing table 4 for details) that obtains respectively each individual different genotype and the acid shape of muscle fat with least-square analysis;

The acid shape of the muscle fat of table 4 different genotype rivers and mountains white goose individuality

From above-mentioned 10 individualities, 4,6, the 8 and No. 9 genotypic individualities of CC selected and remain are as the Selection parent of rivers and mountains white goose, eliminate all the other CT and the genotypic individuality of TT and namely form breeding parent colony.

Sequence table

 

＜110〉Zhejiang Academy of Agricultural Science

＜120〉utilize the method for the acid shape of molecular marker assisted selection goose muscle fat

<160>2

<210>1

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉design according to known array, synthetic by the handsome Bioisystech Co., Ltd in Shanghai, as the upstream primer of molecule marker

<400>1

GTGCTGCCTGTACCGTCCAA?20

<210>2

<211>23

<212>DNA

＜213〉artificial sequence

<220>

＜223〉design according to known array, synthetic by the handsome Bioisystech Co., Ltd in Shanghai, as the downstream primer of molecule marker

<400>?2

GGGAAGCAGTTACACCATCAGAG?23

Claims (1)

1. utilize the method for the acid shape of molecular marker assisted selection goose muscle fat, it is characterized in that carrying out according to the following steps:

(1) design goose THRSP ^αThe Auele Specific Primer of gene fragment: according to GenBank No. EU710582.1 goose THRSP ^αGene order design primer:

Its upstream primer sequence is ASF:5 '-GTGCTGCCTGTACCGTCCAA-3 ';

Its downstream primer sequence is ASR:5 '-GGGAAGCAGTTACACCATCAGAG-3 ';

(2) pcr amplification reaction: 100-200 meat goose of random selection is individual in meat gaggle body to be selected, gather blood from each individual wing vein, the phenol-chloroform method is extracted poba gene group DNA routinely, and adopts above-mentioned primer and genomic dna template to carry out pcr amplification reaction; The reaction system that adopts is 25 μ L:10 * PCR Buffer (Mg ²⁺Plus) 2.5 μ L, 2.5 mmolL ^-1DNTP1.0-3.0 μ L, 10 μ molL ^-1Upstream primer 0.4-0.6 μ L, 10 μ molL ^-1Downstream primer 0.4-0.6 μ L, 50 ng μ L ^-1Template DNA 0.5 μ L, 5.0U μ L ^-1RTaq enzyme 0.15-0.35 μ L, ddH ₂O17.45-20.05 μ L; The pcr amplification reaction condition is 95 ^oC denaturation 5 min, 95 ^oC sex change 30s, 50-60 ^oThe C 30s that anneals, 72 ^oC extends 30s, 33-38 circulation, 72 ^oC extends 10 min, 4 ^oC finishes reaction;

(3) polymorphism analysis of pcr amplification product: get each individual PCR product and detect through 1.5% agarose gel electrophoresis, direct Sequencing is carried out in the separation and purification approximately purpose fragment of 221bp, analyzes its SNPs single nucleotide polymorphism, clear and definite each individual affiliated genotype;

(4) selection of winning meat goose parent individuality: the genotypic individuality of the CC that selects and remain is eliminated CT and the genotypic individuality of TT as meat goose Selection parent.

Images