CN103074375A - Inducible lentivirus miRNA expression vector and construction method thereof - Google Patents
Inducible lentivirus miRNA expression vector and construction method thereof Download PDFInfo
- Publication number
- CN103074375A CN103074375A CN2011103297533A CN201110329753A CN103074375A CN 103074375 A CN103074375 A CN 103074375A CN 2011103297533 A CN2011103297533 A CN 2011103297533A CN 201110329753 A CN201110329753 A CN 201110329753A CN 103074375 A CN103074375 A CN 103074375A
- Authority
- CN
- China
- Prior art keywords
- tre
- sequence
- carrier
- cell
- expression vector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides an inducible lentivirus miRNA expression vector comprising gene HIV-1 RNA packaging signals of lentivirus transfer structure, 5'LTR and 3'LTR, tetracycline response element (TRE), and EF-1alpha promoter. The system provides an expression vector which can guide the synthesizing of miRNA in mammalian cells. With the tetracycline response element (TRE) and the EF-1alpha promoter adopted by the vector, high-level expression of the vector in mammalian cells can be ensured. Under the existence of no doxycycline (DOX) existence, target miRNA expression is inhibited; and when Dox exists, the expression of miRNA is induced.
Description
Technical field
The invention belongs to biotechnology and medical field, be specifically related to induce slow virus miRNA expression vector and construction process thereof.
Technical background
MiRNAs is that a kind of can regulatory gene to express length be the non-coding RNA chain of 21-25 Nucleotide, has the various kinds of cell functions such as control cell proliferation, differentiation, apoptosis, tumour formation and drug susceptibility.As everyone knows, miRNAs lives through the transgenations such as gene amplification, gene elmination and epigenetic silence, and these transgenations finally can activate or the deactivation disease gene.In human various diseases, some miRNAs lacks of proper care all the time.The miRNAs of these imbalances is not limited to specific disease type, and the miRNAs of exception table and the clinical state of an illness, and is relevant such as neoplasm staging, drug susceptibility and patient's survival rate etc.In addition, there are some researches show that recently miRNAs helps cell transformation, tumour to form and stem cell is safeguarded.At last, miRNAs function assessment research observes directly specificity miRNAs in vivo or externally has powerful antitumour activity or a carcinogenic activity.Because the miRNAs of unconventionality expression plays keying action in the development of human diseases, correct imbalance and the defective of miRNAs by the function of antagonism or recovery miRNAs and will bring huge progress to clinical disease treatment.Therapeutic strategy based on miRNA has become a methods for the treatment of that has potentiality.In order to make miRNAs become effective methods for the treatment of, they should be regulated and control by systematicness, are transported to particular organization by special and efficient transfer system, are then taken in endochylema by target cell.In endochylema, they are used by cell with complete form.It is very effective that miRNAs is used for the short-term gene inhibition at mammal cell line, but the target gene that knocks out that is used for the transcriptional level long-term stability is inconvenient.Similar with other nucleotide structure, miRNAs is existence and stability and branch problem in clinical application.MiRNAs is the same with siRNAs, and the cytolemma penetrativity is poor, the interior transfer of body internal stability finite sum cell depends on system regulation.In order to make miRNAs be transformed into the clinical treatment method that patient is benefited from a kind of laboratory facilities, we need a kind of high specificity and efficient gene to shift expression system.
Because slow virus, such as human immunodeficiency virus I, can the transfection somatoblast or Unseparated Cell and its DNA is incorporated in the host cell gene group, thereby be a kind of effective launch vehicle of miRNAs treatment.Lentiviral vectors normally obtains by several different plasmid co-transfection 293T human embryonic kidney cells.First clinical lentiviral vectors product is from two pUC pUCs.In order further to improve the biological safety of this system, the lentiviral gene group has been divided into 4 plasmids.These plasmids are respectively: the envelope glycoprotein plasmid of the transferring plasmid of self-inactivation, encoding gag-pol albumen packaging plasmid, rev plasmid and the bubble type Stomatovirus G albumen (VSV-G) of can encoding.Lentiviral vectors is with goal gene or the stable the most effectively launch vehicle of transferring to cell of gene silencing sequence.Transgenosis is combined and fusion with target cell membrane with false configuration slow virus envelope protein.Then, the lentiviral gene group RNA that contains miRNAs gene or gene silencing sequence is reversed and records into DNA, and forever integrates with the genome of high efficient and cell.At last, miRNAs gene or gene silencing sequence produce the desired result of cell permanent change on gene level at cell inner expression.
The expression system of strict control single-gene such as specificity miRNAs will help under the complicated gene environment condition research such as mammalian cell miRNAs function greatly.Ideally, such system not only can mediate " switch " state of miRNAs expression activity, can also mediate and allow its limited expression under the setting threshold level.
Summary of the invention
Task of the present invention provides a kind of slow virus miRNA expression vector and construction process thereof of inducing.
Realize that technical scheme of the present invention is: this slow virus miRNA expression vector of inducing provided by the invention, comprise gene HIV-1RNA packaging signal, 5 ' LTR and 3 ' LTR and tsiklomitsin response element (TRE) and the EF-1 α promotor of lentivirus transfer structure, see Fig. 1.The production cell that the present invention program provides can be 293T renal epithelial cell system, CHO Chinese hamster ovary cell, COS African monkey kidney cell line, HepG2 Bel7402, BHK Syria hamster kidney cell line, Sf9 insect ovary cell line, Sf21 insect ovary cell line, the dirty cell of 293 human embryo kidney (HEK)s, HEK 293 human embryonic kidney cell lines, SODk0, NIH-3T3 mouse fibroblast cell system, Vero African green monkey kidney cell or the dirty cell of PerC6 human embryo kidney (HEK).But the gene of the present invention's abduction delivering is the RNAs of miRNA.The lentiviral gene expression vector that the present invention uses is that third generation lentiviral gene shifts expression vector, be about to whole lentiviral gene component and become four plasmids: the envelope glycoprotein plasmid of the transferring plasmid of self-inactivation, encoding gag-pol albumen packaging plasmid, rev plasmid and the bubble type Stomatovirus G albumen (VSV-G) of can encoding, the expression of miRNA has stable and inheritability, induce slow virus miRNA expression vector to be usually used in making up animal model, such as transgenic mouse.
The slow virus miRNA expression vector establishment method of inducing provided by the invention may further comprise the steps:
(1) make up pCR2.1-EF-α cloning vector and pCR2.1-TRE cloning vector, concrete steps are:
1. according to carrier pTRE2hyg (BD Life Science) sequence (seeing figure .2), design the PCR primer of TRE sequence, upstream primer is 5 '-ACCGGTAGACGCTGTCGAA-3 ', contains the Agel restriction enzyme site; Downstream primer 5 '-ACGCGTAGCAACCAGGTGT-3 ' contains the Mlul restriction enzyme site;
2. Clal enzyme cutting pTRE2hyg carrier (seeing Fig. 3) is used the described primer PCR amplification of step 1 TRE sequence; (seeing Fig. 4,5)
3. adopt clone TA cloning test kit, with the T4 ligase enzyme PCR product TRE sequence is connected with linearizing pCR2.1 carrier; (seeing Fig. 6 .7)
4. with the resulting product pCR2.1-TRE of step 3 carrier transformed competence colibacillus bacillus coli DH 51, screening positive clone;
5. the plasmid that increases, enzyme is cut evaluation;
6. after enzyme is cut and identified correctly, send company's order-checking;
7. according to pEP-miR carrier (Cell Biolabs, Inc) sequence (seeing figure .8), design EF-α promotor PCR primer, the Mlul restriction enzyme site is contained in upstream 5 '-ACGCGTGATGCCTCCCCG-3 '; The scall restriction enzyme site is contained in downstream 5 '-GTCGACACCCGTTGCGAAA-3 ', then uses pcr amplification EF-α promoter sequence, by above-mentioned steps 3-6, obtains pCR2.1-EF-1 α carrier.(seeing Fig. 9-13)
(2) make up pLKO.1-TRE-EF-α-MCS-puro expression vector, concrete steps are:
1. the double digestion method is scaled off TRE and EF-α sequence from constructed pCR2.1-TRE carrier and pCR2.1-EF-α carrier; (Figure 14,15)
2. cut earnestly pLKO.1-puro (seeing Figure 16) with Agel and two restriction enzyme sites of Mlul, and the TRE sequence is connected with pLKO.1-puro, obtain pLKO.1-TRE-puro; (seeing Figure 17);
3. the pLKO.1-TRE-MCS-puro that step 2 is obtained cuts through Mlul and Sal enzyme, and is connected with amplification EF-α promoter sequence, obtains pLKO.1-TRE-EF-α-MCS-puro; (figure .18)
4. with step 3 products therefrom pLKO.1-TRE-EF-α-puro transformed competence colibacillus bacillus coli DH 51, double digestion is identified;
5. the plasmid that increases, enzyme is cut evaluation;
6. send company's order-checking.
(3) make up the EGFP expression vector, concrete steps are:
1. according to pEGFP-N1 carrier (BD Life Science) (seeing figure .19), design the EGFP aligning primer, 5 '-GTCGACGCAGGGCAATAATGAT-3 ' contains the Scall restriction enzyme site; Downstream 5 ' CTCGAGCGGCGGGTCTTGTAGT-3 ' contains restriction enzyme site Xho l;
2. pcr amplification EGFP sequence; (seeing Figure 20)
3. with the resulting EGFP sequence (Figure 21) that gets of step 2, behind double digestion, be connected with pLKO.1; (seeing figure .22)
4. with the resulting product pCR2.1-TRE of step 3 carrier transformed competence colibacillus bacillus coli DH 51, screening positive clone;
5. the plasmid that increases, enzyme is cut evaluation;
6. send company's order-checking.
Take slow virus as the basis gene therapy representing latest generation powerful, multipurpose carrier, different transgenosis can be entered nearly all mammalian cell, comprise primary cultured cell, Unseparated Cell, tumour cell and stem cell.According to the present invention, can regulate the expression of miRNAs in mammalian cell but make up inducible expression.In native system, the expression of miRNAs is subjected to the control of tsiklomitsin response element and EF-1 α promotor.Can regulate miRNAs high level expression in mammalian cell after above-mentioned miRNAs expression system and the associating of Tet-On clone.After adding doxycycline, above-mentioned expression system is activated.The expression level of miRNAs is subjected to the strict regulation and control of different doxycycline concentration.Because the structure gene that can induce slow virus miRNAs expression system can be effectively miRNA to be expressed is integrated into cell genomic dna selectively, thereby this system can be for setting up stable cell lines or the transgenic animal effective means of providing convenience.Whether experiment Main Analysis cell or transgenic animal can for good and all keep and inherit this phenotype that is subjected to strict regulation and control.
The concrete technical scheme of the present invention comprises:
1. make up and can induce slow virus miRNAs expression vector: the structure mammalian cell that is useful on can induce the essential element of slow virus miRNAs expression vector all to be entered pLKO.1puro carrier (Sigma-Aldrich) by subclone.Also comprise the puromycin resistance gene that is subjected to people hPGK promoter regulation for carrier.From pEP-miR carrier (Cell Biolabs, Inc) amplification people EF-1 α gene promoter.The tsiklomitsin response element is from pTRE2hyg carrier (BD Life Science).All pcr amplified fragments are cloned into the pCR2.1 carrier by TA Cloning test kit (Invitrogen).Subsequently, EF-1 α gene promoter and tsiklomitsin response element are confirmed by order-checking.Then, EF-1 α gene promoter and tsiklomitsin response element cut down and are connected on the pLKO.1puro carrier that digests with the respective limits restriction endonuclease from the pCR2.1 carrier with restriction enzyme.The affirmation of again checking order of EF-1 α gene promoter, tsiklomitsin response element and homing sequence obtains to induce slow virus expression system (doxycycline induces miRNA to express) at last.Above-mentioned expression system comprises tsiklomitsin response element (TRE), and this element is comprised of the direct repeat sequence of Tet manipulation sequence (TetO) formation of 7 42bp.The TRE element is positioned at EF-1 α gene promoter upstream.Therefore, EF-1 α gene promoter is in silence state when being attached on the TRE without rtTA, thereby has stoped miRNA " leakage " to express.
2. the preparation of slow virus: 24h before transfection places the 293T cell in the orifice plate and to cultivate.Cell is cultivated with the RPMI1640 that contains 10% foetal calf serum.Cell serum free medium or contain the DMEM of serum or the RPMI substratum in carry out transfection, infection multiplicity is 50-1000pfu/cell.At 37 degree, hatched in the serum free medium 4 hours or in the DMEM that contains serum or RPMI substratum, hatched 18 hours.Then, clean cell and replaced medium.After the transfection 48 hours, collect the cell conditioned medium liquid that contains virus, then at room temperature, the centrifugal 10min of 1500rmp.In addition, use the envelope glycoprotein G from VSV-G to modify the scope that slow virus can enlarge the slow-virus transfection mammalian host cell.
3. slow virus titer determination: by the titre of p24 antigen ELISA measuring slow-virus transfection particle, and by conversion factor the pg/ml of p24 is converted into TU/ml (transducing unit per ml).And, the transfection unit of slow virus (TU/ml) but be to determine by the slow virus amounts of particles of analyzing transfection KHOS cell.The titre method of calculation are with reference to Follenzi and Naldini, 2002.
U-2OS Tet-On cell Iine:U-2OS osteosarcoma cell line is a kind of clone of stable transfection pTet-On plasmid.PTet-On expresses the reactive trans activating transcription factor (rtTA) of Tet under the control of the vertical early promotor (Pcmv) of powerful cytomegalovirus.TTA is merged by the electronegative transcriptional activation domain (130 amino acid) of the C-terminal of 1-207 amino acid of Tet arrestin and hsv VP16 to form.The pTet-On system class is similar to the pTet-Off system, but owing to 4 amino acid whose sudden changes among the TetR are transformed into rTetR, corresponding tTA has been transformed into rtTA.After the genophore transfection pTet-On clone by the TRE regulation and control, in the situation that doxycycline (Dox) exists rtTA just to be attached on the TRE, thereby activated gene is transcribed.When DOX removed from substratum, the genetic transcription of TRE regulation and control was closed in the mode of height dose-dependently.
4. make up the EGFP expression vector: induce lentiviral vectors to express EGFP in order to make, this gene coded sequence is cloned and is inserted the pKLO.1 carrier from pEGFP-N1 carrier (BD Life Science).In the pTet-On system, the expression of EGFP is regulated by rtTA.
5.miRNA long-term expression: U-2OS Tet-On cell (5 * 10
3/ ml) be inoculated in 96 orifice plates, the inferior daily slow-virus transfection cell that contains the miRNA-199a-3p encoding sequence, and cell was cultured to for 6 weeks in containing the substratum of doxycycline.The expression of miRNA-199a-3p is monitored once weekly with miRNA Real-time PCR (Applied Biosystem).Organize in contrast the pKLO.1-puro-CMV-TurboGFP carrier transfection of expressing GFP of U-2OS Tet-On cell, the same experimental group of the monitoring method of its expression.
6. statistical study: carry out statistical analysis with GraphPadPrism 4 softwares.(GraphPad Software Inc.，San Diego，Calif.，USA)
Can induce the advantage of slow virus miRNA expression system: 1. extremely strict switch regulation and control.This expression system is in the situation that without inductor, it is extremely low that the background of purpose miRNA or leakage are expressed.2. specificity.After protokaryon was regulated albumen (rtTA) introduction mammalian cell, only to its special target sequence generation effect, its reason probably was the dna sequence dna that does not have its adjusting in the eukaryotic gene group.3. height inducibility and fast response time.Under the Tet system, induced reaction just can detect at 30min.According to observations, the abduction delivering level can be up to 1000 times of previous level.4. the clear and definite inductor of characteristic.Doxycycline is cheap, character is clear and definite, can produce the experimental result of high performance reproducibility.5.EF-1 the α promotor with restriction enzyme site, is convenient to the insertion of oligonucleotide.6. this expression system is easy to effective transfection division and the mammalian cell of stationary phase, comprises that some are difficult to the cell of transfection, such as primary cell, stem cell, neurocyte and endotheliocyte.In addition, can induce slow virus miRNA expression vector to cross the animal model of expression with making up miRNA, such as transgenic mouse.
Effective effect of the present invention and characteristics: 1. express the miRNA precursor transcript that comprises original all sequences, and guaranteeing to obtain real ripe miRNAs after this precursor transcript is by the endogenetic mechanisms processing treatment under the control of strict regulatory mechanism.2. guaranteed that based on the expression system that can induce slow virus miRNA comprises expression in Unseparated Cell and the difficult transfectional cell in clone widely.3. higher take replication defect type HIV and FIV as the biological safety of the slow virus expression system on basis.4. can monitor transfectional cell by coexpression EFGP fluorescent mark albumen.Can screen the positive cell of stably express miRNA by the tetracycline selection markers.
The potential application direction of the present invention comprises: 1. the function of studying miRNA by the high expression level of miRNA in cell.2. adopt the slow virus expression system, in primary cell, tumour cell, stem cell and Unseparated Cell, express miRNA.3. the clone of preparation stably express miRNA is studied preach path and seek the target gene that miRNA regulates of cell.4.miRNA the clinical trial of target gene therapy
Description of drawings
Fig. 1 .pKLO.1-TRE-EF-1 α carrier schematic diagram; Fig. 2 .pPTREhyg carrier structure schematic diagram; Fig. 3 .ClaI restriction endonuclease linearizing pPTREhyg carrier; Fig. 4. enzyme is cut rear linearizing pPTREhyg carrier; Fig. 5 .PCR primer amplification TRE sequence; The TRE sequence that Fig. 6 .PCR clone obtains; Fig. 7 .TRE sequence is inserted the pCR2.1 carrier; Fig. 8 .pEP-miR structural representation; Fig. 9 .BamHI enzyme is cut pEP-miR; PEP-miR carrier after Figure 10 .BamHI linearizing; Figure 11 .PCR primer expands once EF-α sequence; The EF-α sequence that Figure 12 .PCR amplification obtains; Figure 13 .EF-α sequence is inserted the pCR2.1 carrier; Figure 14 .Agel and MluI double digestion downcut the TRE sequence; EF-α sequence under Figure 15 .MluI and the Sal double digestion; Figure 16 .PLKO.1 carrier schematic diagram; Figure 17 .TRE sequence and EF-α sequence are inserted the pKLO.1 carrier; Figure 18 is Figure 17 sequential chart; Figure 19 .pEGFP-N1 carrier structure schematic diagram; Figure 20 .PCR amplification EGFP gene; Figure 21 .EPGF extension increasing sequence; Figure 22 .EGFP vector construction schema; Figure 23 .pKLO.1-TRE-EF-1 α-miRNA-Puro makes up schema; Figure 24. viral wrapping process schema; The expression amount of Figure 25 .miRNA-199a-3p.
Embodiment
Embodiment 1: structure can be induced slow virus miRNA expression vector
One, experiment material: pTRE2hyg (BD Life Science), TA cloning test kit (Invitrogen), pEP-miR carrier (Cell Biolabs company) pLKO.1 carrier (Sigma-Aldrich company), pEGFP-N1 carrier (BD Life Science company), agarose (life company), restriction endonuclease (NEB company).
Two, structure can be induced slow virus miRNA expression vector:
(1) makes up pCR2.1-EF-α cloning vector and pCR2.1-TRE cloning vector
1. according to carrier pTRE2hyg (BD Life Science) sequence, see Fig. 2, the PCR primer of design TRE sequence, upstream primer is 5 '-ACCGGTAGACGCTGTCGAA-3 ', contains the Agel restriction enzyme site; Downstream primer 5 '-ACGCGTAGCAACCAGGTGT-3 ' contains the Mlul restriction enzyme site.
2. Clal enzyme cutting pTRE2hyg carrier is seen Fig. 3, with the described primer PCR amplification of step 1 TRE sequence, sees Figure 4 and 5.
3. adopt clone TA cloning test kit, with the T4 ligase enzyme PCR product TRE sequence is connected with linearizing pCR2.1 carrier, see Fig. 6 and 7.
4. with the resulting product pCR2.1-TRE of step 3 carrier transformed competence colibacillus bacillus coli DH 51, screening positive clone.
5. the plasmid that increases, enzyme is cut evaluation.
6. after enzyme is cut and identified correctly, send company's order-checking.
7. according to pEP-miR carrier (Cell Biolabs, Inc) sequence, see Fig. 8, design EF-α promotor PCR primer, the Mlul restriction enzyme site is contained in upstream 5 '-ACGCGTGATGCCTCCCCG-3 '; Downstream 5 '
-GTCGACACCCGTTGCGAAA-3 ' contains the scall restriction enzyme site.Then use pcr amplification EF-α promoter sequence, by above-mentioned steps 3-6, obtain pCR2.1-EF-1 α carrier, see Fig. 9-13.
(2) make up pLKO.1-TRE-EF-α-MCS-puro expression vector
1. the double digestion method is scaled off Figure 14,15 with TRE and EF-α sequence from constructed pCR2.1-TRE carrier and pCR2.1-EF-α carrier.
2. cut earnestly pLKO.1-puro with Agel and two restriction enzyme sites of Mlul, see Figure 16, and the TRE sequence is connected with pLKO.1-puro, obtain pLKO.1-TRE-puro.See Figure 17.
3. the pLKO.1-TRE-MCS-puro that step 2 is obtained cuts through Mlul and Sal enzyme, and is connected with amplification EF-α promoter sequence, obtains pLKO.1-TRE-EF-α-MCS-puro, sees Figure 18.
4. with step 3 products therefrom pLKO.1-TRE-EF-α-puro transformed competence colibacillus bacillus coli DH 51, double digestion is identified
5. the plasmid that increases, enzyme is cut evaluation.
6. order-checking.
(3) make up the EGFP expression vector
1. according to pEGFP-N1 carrier (BD Life Science), see figure .19, design EGFP aligning primer, 5 '-GTCGACGCAGGGCAATAATGAT-3 ' contains the Scall restriction enzyme site; Downstream 5 ' CTCGAGCGGCGGGTCTTGTAGT-3 ' contains restriction enzyme site Xhol.
2. pcr amplification EGFP sequence is seen Figure 20.
3. with the resulting EGFP sequence that gets of step 2, see Figure 21, behind double digestion, be connected with pLKO.1, see Figure 22.
4. with the resulting product pCR2.1-TRE of step 3 carrier transformed competence colibacillus bacillus coli DH 51, screening positive clone.
5. the plasmid that increases, enzyme is cut evaluation.
6. send company's order-checking.
(4) make up pLKO.1-TRE-EF-α-mi RNA199a-3p-puro expression vector (seeing Figure 23)
1.. obtain the miRNA-199a-3p loop-stem structure by By consulting literatures,
5 '-GCCAACCCAGUGUUCAGACUACCUGUUCAGGAGGCUCUCAAUGUGUACAGUAGUCU GCACAUUGGUUAGGC-3 ' also send company synthetic.
2. annealing so that comprise the forward direction of purpose miRNA expressed sequence oligonucleotide and reverse strand separately.
3. use the corresponding restriction endonuclease linearizing slow virus miRNA expression vector of two restriction enzyme sites of BamHl and Clal.
4. the oligonucleotide fragment with annealing is connected on the lentiviral vectors
5. carrier is changed over to screening positive clone behind the bacterium.
6. order-checking is confirmed, the vector construction success
Embodiment 2: the slow virus the induced miRNA expression vector that embodiment 1 makes up is tested at cell inner expression
Experiment material: miRNA-199a-3P (invitrogen company), Lenti-X HT Packaging Mix test kit (clontech company), QuickTiter
TMHIV Lentivirus Quantitation test kit (Cell Biolabs company), U-2OS Tet-On cell line cell, PCR primer (invitrogen company) agarose (life company), restriction endonuclease (NEB company).
The slow virus packing:
1. lentiviral vectors plasmid pLKO.1-TRE-EF-α-miRNA-199a-3p-puro and Lenti-X HT Packaging Mix transfection 293T clone (experimental procedure is with reference to Lenti-X HT Packaging Mix test kit specification sheets) by a certain percentage, (seeing Figure 24).
2. collect slow virus, use QuickTiter
TMHIV Lentivirus Quantitation test kit (Cell Biolabs company).
P24ELISA and definite its are tired and TU/ml.Virus titer can obtain up to 5 * 10
8TU/ml.
U-2OS Tet-On cell line transfection:
1. change the recombinant slow virus that makes up over to U-2OS Tet-On cell line clone, experiment arranges 3 groups, and the blank group is left intact; Negative control group gives empty carrier; Positive controls gives pLKO.1-TRE-EF-α-miRNA-199a-3p-puro.
2. process cell with tsiklomitsin, induce the expression of miRNA.
Determine the expression of miRNA with Real-time PCR:
MiRNA-199a-3p reverse transcription primer and quantitative PCR are synthetic by introvigen company, extract behind the intracellular rna first synthetic cDNA the first chain, with this chain and PCR primer, carry out the PCR reaction, reaction conditions is: 95 ℃ of 1min sex change, 9515s, 6020s, 7015s, 42 circulations.At last, take U6 as confidential reference items, carry out data analysis.
Analysis of experimental data
The miRNA table of positive controls is significantly higher than negative control group and blank group, so this carrier pLKO.1-TRE-EF-α-miRNA-puro makes up effectively.(seeing Figure 25)
Be the sequence table of present patent application below, each sequence is followed successively by in the sequence table: the PCR upstream primer of sequence 1:TRE sequence; The PCR downstream primer of sequence 2:TRE sequence; Sequence 3:EF-α promotor PCR upstream primer; Sequence 4:EF-α promotor PCR downstream primer; Sequence 5:EGFP sequence PCR upstream primer; Sequence 6:EGFP sequence PCR downstream primer '; Sequence 7:miRNA-199a-3p loop-stem structure; Sequence 8:TRE sequence: sequence 9:EF-1 α sequence; The TRE sequence that sequence 10:PCR clone obtains; The EF-α sequence that sequence 11:PCR amplification obtains; Sequence 12:EPGF extension increasing sequence.
Sequence table
＜110〉Wuhan Union Hospital
＜120〉a kind of slow virus miRNA expression vector and construction process thereof of inducing
<160>12
<170>PatentIn version 3.3
<210>1
<211>19
<212>DNA
＜213〉artificial sequence
<400>1
accggtagac gctgtcgaa 19
<210>2
<211>19
<212>DNA
＜213〉artificial sequence
<400>2
acgcgtagca accaggtgt 19
<210>3
<211>18
<212>DNA
＜213〉artificial sequence
<400>3
acgcgtgatg cctccccg 18
<210>4
<211>19
<212>DNA
＜213〉artificial sequence
<400>4
gtcgacaccc gttgcgaaa 19
<210>5
<211>22
<212>DNA
＜213〉artificial sequence
<400>5
gtcgacgcag ggcaataatg at 22
<210>6
<211>22
<212>DNA
＜213〉artificial sequence
<400>6
ctcgagcggc gggtcttgta gt 22
<210>7
<211>71
<212>RNA
＜213〉artificial sequence
<400>7
gccaacccag uguucagacu accuguucag gaggcucuca auguguacag uagucugcac 60
auugguuagg c 71
<210>8
<211>313
<212>DNA
＜213〉artificial sequence
<400>8
tttaccactc cctatcagtg atagagaaaa gtgaaagtcg agtttaccac tccctatcag 60
tgatagagaa aagtgaaagt cgagtttacc actccctatc agtgatagag aaaagtgaaa 120
gtcgagttta ccactcccta tcagtgatag agaaaagtga aagtcgagtt taccactccc 180
tatcagtgat agagaaaagt gaaagtcgag tttaccactc cctatcagtg atagagaaaa 240
gtgaaagtcg agtttaccac tccctatcag tgatagagaa aagtgaaagt cgagctcggt 300
acccgggtcg agg 313
<210>9
<211>406
<212>DNA
＜213〉artificial sequence
<400>9
gcctccccgt caccaccccc cccaacccgc cccgaccgga gctgagagta attcatacaa 60
aaggactcgc ccctgccttg gggaatccca gggaccgtcg ttaaactccc actaacgtag 120
aacccagaga tcgctgcgtt cccgccccct cacccgcccg ctctcgtcat cactgaggtg 180
gagaagagca tgcgtgaggc tccggtgccc gtcagtgggc agagcgcaca tcgcccacag 240
tccccgagaa gttgggggga ggggtcggca attgaaccgg tgcctagaga aggtggcgcg 300
gggtaaactg ggaaagtgat gtcgtgtact ggctccgcct ttttcccgag ggtgggggag 360
aaccgtatat aagtgcagta gtcgccgtga acgttctttt tcgcaa 406
<210>10
<211>351
<212>DNA
＜213〉artificial sequence
<400>10
accggtagac gctgtcgaat ttaccactcc ctatcagtga tagagaaaag tgaaagtcga 60
gtttaccact ccctatcagt gatagagaaa agtgaaagtc gagtttacca ctccctatca 120
gtgatagaga aaagtgaaag tcgagtttac cactccctat cagtgataga gaaaagtgaa 180
agtcgagttt accactccct atcagtgata gagaaaagtg aaagtcgagt ttaccactcc 240
ctatcagtga tagagaaaag tgaaagtcga gtttaccact ccctatcagt gatagagaaa 300
agtgaaagtc gagctcggta cccgggtcga ggacacctgg ttgctacgcg t 351
<210>11
<211>426
<212>DNA
＜213〉artificial sequence
<400>11
acgcgtgatg cctccccgtc accacccccc ccaacccgcc ccgaccggag ctgagagtaa 60
ttcatacaaa aggactcgcc cctgccttgg ggaatcccag ggaccgtcgt taaactccca 120
ctaacgtaga acccagagat cgctgcgttc ccgccccctc acccgcccgc tctcgtcatc 180
actgaggtgg agaagagcat gcgtgaggct ccggtgcccg tcagtgggca gagcgcacat 240
cgcccacagt ccccgagaag ttggggggag gggtcggcaa ttgaaccggt gcctagagaa 300
ggtggcgcgg ggtaaactgg gaaagtgatg tcgtgtactg gctccgcctt tttcccgagg 360
gtgggggaga accgtatata agtgcagtag tcgccgtgaa cgttcttttt cgcaacgggt 420
gtcgac 426
<210>12
<211>745
<212>DNA
＜213〉artificial sequence
<400>12
gtcgacgcag ggcaataatg atacaatgta tcatgcctct ttgcaccatt ctaaagaata 60
acagtgataa tttctgggtt aaggcaatag ccgattagtt ctcgaggatc cgactgaagt 120
cgctagctcg agcttttgga gaatatttct gcatataaat atttctgcat ataaattgta 180
actgatgtaa gaggtttcat attgctaata gcagctacaa tccagctacc attctgcttt 240
tattttatgg ttgggataag gctggattat tctgagtcca agctaggccc ttttgctaat 300
catgttcata cctcttatct tcctcccaca gctcctgggc aacgtgctgg tctgtgtgct 360
ggcccatcac tttggcaaag cacgtgagat ctgaattctg acacaccatg gtgagcaagg 420
gcgaggagct gttcaccggg gtggtgccca tcctggtcga gctggacggc gacgtaaacg 480
gccacaagtt cagcgtgtcc ggcgagggcg agggcgatgc cacctacggc aagctgaccc 540
tgaagttcat ctgcaccacc ggcaagctgc ccgtgccctg gcccaccctc gtgaccaccc 600
tgacctacgg cgtgcagtgc ttcagccgct accccgacca catgaagcag cacgacttct 660
tcaagtccgc catgcccgaa ggctacgtcc aggagcgcac catcttcttc aaggacgacg 720
gcaactacaa gacccgccgc tcgag 745
Claims (6)
1. can induce slow virus miRNA expression vector for one kind, it is characterized in that: this carrier comprises gene HIV-1RNA packaging signal, 5 ' LTR and 3 ' LTR and tsiklomitsin response element (TRE) and the EF-1 α promotor of lentivirus transfer structure.
2. the slow virus miRNA expression vector establishment method of inducing according to claim 1 is characterized in that: produce cell and be 293T renal epithelial cell system, CHO Chinese hamster ovary cell, COS African monkey kidney cell line, HepG2 Bel7402, BHK Syria hamster kidney cell line, Sf9 insect ovary cell line, Sf21 insect ovary cell line, the dirty cell of 293 human embryo kidney (HEK)s, HEK 293 human embryonic kidney cell lines, SODk0, NIH-3T3 mouse fibroblast cell and be, Vero African green monkey kidney cell or the dirty cell of PerC6 human embryo kidney (HEK).
3. the slow virus miRNA expression vector establishment method of inducing according to claim 1 is characterized in that: but the gene of abduction delivering is the RNAs of miRNA.
4. the slow virus miRNA expression vector establishment method of inducing according to claim 1 is characterized in that: the lentiviral gene expression vector is that third generation lentiviral gene shifts expression vector and is about to whole lentiviral gene component and becomes four plasmids: the envelope glycoprotein plasmid of the transferring plasmid of self-inactivation, encoding gag-pol albumen packaging plasmid, rev plasmid and the bubble type Stomatovirus G albumen (VSV-G) of can encoding.
5. the slow virus miRNA expression vector establishment method of inducing according to claim 1 is characterized in that: the expression of miRNA has stable and inheritability, induces slow virus miRNA expression vector to be usually used in making up animal model, such as transgenic mouse.
6. the slow virus miRNA expression vector establishment method of inducing according to claim 1 is as follows:
(1) make up pCR2.1-EF-α cloning vector and pCR2.1-TRE cloning vector, the concrete step comprises:
1. according to carrier pTRE2hyg (BD Life Science) sequence, design the PCR primer of TRE sequence, upstream primer is 5 '-ACCGGTAGACGCTGTCGAA-3 ', contains the Agel restriction enzyme site; Downstream primer 5 '-ACGCGTAGCAACCAGGTGT-3 ' contains the Mlul restriction enzyme site;
2. Clal enzyme cutting pTRE2hyg carrier is used the described primer PCR amplification of step 1 TRE sequence;
3. adopt clone TA cloning test kit, with the T4 ligase enzyme PCR product TRE sequence is connected with linearizing pCR2.1 carrier;
4. with the resulting product pCR2.1-TRE of step 3 carrier transformed competence colibacillus bacillus coli DH 51, screening positive clone;
5. the plasmid that increases, enzyme is cut evaluation;
6. after enzyme is cut and identified correctly, send company's order-checking;
7. according to pEP-miR carrier (Cell Biolabs, Inc) sequence, design EF-α promotor PCR primer, the Mlul restriction enzyme site is contained in upstream 5 '-ACGCGTGATGCCTCCCCG-3 '; The scall restriction enzyme site is contained in downstream 5 '-GTCGACACCCGTTGCGAAA-3 ', then uses pcr amplification EF-α promoter sequence, by above-mentioned steps 3-6, obtains pCR2.1-EF-1 α carrier;
(2) make up pLKO.1-TRE-EF-α-MCS-puro expression vector, the concrete step comprises:
1. the double digestion method is scaled off TRE and EF-α sequence from constructed pCR2.1-TRE carrier and pCR2.1-EF-α carrier;
2. cut earnestly pLKO.1-puro with Agel and two restriction enzyme sites of Mlul, and the TRE sequence is connected with pLKO.1-puro, obtain pLKO.1-TRE-puro;
3. the pLKO.1-TRE-MCS-puro that step 2 is obtained cuts through Mlul and Sal enzyme, and is connected with amplification EF-α promoter sequence, obtains pLKO.1-TRE-EF-α-MCS-puro;
4. with step 3 products therefrom pLKO.1-TRE-EF-α-puro transformed competence colibacillus bacillus coli DH 51, double digestion is identified;
5. the plasmid that increases, enzyme is cut evaluation;
6. order-checking.
(3) make up the EGFP expression vector, the concrete step comprises:
1. according to pEGFP-N1 carrier (BD Life Science), design the EGFP aligning primer, 5 '-GTCGACGCAGGGCAATAATGAT-3 ' contains the Scall restriction enzyme site; Downstream 5 ' CTCGAGCGGCGGGTCTTGTAGT-3 ' contains restriction enzyme site Xhol;
2. pcr amplification EGFP sequence;
3. with the resulting EGFP sequence that gets of step 2, behind double digestion, be connected with pLKO.1;
4. with the resulting product pCR2.1-TRE of step 3 carrier transformed competence colibacillus bacillus coli DH 51, screening positive clone;
5. the plasmid that increases, enzyme is cut evaluation;
6. order-checking.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011103297533A CN103074375A (en) | 2011-10-26 | 2011-10-26 | Inducible lentivirus miRNA expression vector and construction method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011103297533A CN103074375A (en) | 2011-10-26 | 2011-10-26 | Inducible lentivirus miRNA expression vector and construction method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103074375A true CN103074375A (en) | 2013-05-01 |
Family
ID=48151070
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2011103297533A Pending CN103074375A (en) | 2011-10-26 | 2011-10-26 | Inducible lentivirus miRNA expression vector and construction method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103074375A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105925613A (en) * | 2016-05-17 | 2016-09-07 | 深圳市疾病预防控制中心 | Lentiviral expression vector capable of promoting high expression of hepatic cells miR-199b and construction method of lentiviral expression vector |
| CN109679994A (en) * | 2018-12-13 | 2019-04-26 | 湖北汇智铭传生物科技股份有限公司 | Pass through the episomal vector and its construction method of tetracycline inducing expression foreign gene |
| CN110373429A (en) * | 2019-08-01 | 2019-10-25 | 哈尔滨工业大学 | A kind of method that the mammalian cell specificity of lentivirus mediated is overexpressed miRNA |
| CN110540962A (en) * | 2019-08-28 | 2019-12-06 | 北京协同创新研究院 | Method for preparing human definitive endoderm cells |
| WO2021232633A1 (en) * | 2020-05-22 | 2021-11-25 | 深圳市深研生物科技有限公司 | Promoter element, and retroviral genome transcription cassette and vector which contain same |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090217404A1 (en) * | 2002-09-27 | 2009-08-27 | Lowe Scott W | Cell-based RNA interference and related methods and compositions |
| CN101892256A (en) * | 2010-01-27 | 2010-11-24 | 中国农业科学院北京畜牧兽医研究所 | Method for breeding transgenic animal with improved pig growth hormone expression level |
| WO2011025566A1 (en) * | 2009-08-26 | 2011-03-03 | Shi-Lung Lin | Development of universal cancer drugs and vaccines |
-
2011
- 2011-10-26 CN CN2011103297533A patent/CN103074375A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090217404A1 (en) * | 2002-09-27 | 2009-08-27 | Lowe Scott W | Cell-based RNA interference and related methods and compositions |
| WO2011025566A1 (en) * | 2009-08-26 | 2011-03-03 | Shi-Lung Lin | Development of universal cancer drugs and vaccines |
| CN101892256A (en) * | 2010-01-27 | 2010-11-24 | 中国农业科学院北京畜牧兽医研究所 | Method for breeding transgenic animal with improved pig growth hormone expression level |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105925613A (en) * | 2016-05-17 | 2016-09-07 | 深圳市疾病预防控制中心 | Lentiviral expression vector capable of promoting high expression of hepatic cells miR-199b and construction method of lentiviral expression vector |
| CN105925613B (en) * | 2016-05-17 | 2019-09-06 | 深圳市疾病预防控制中心 | Promote the highly expressed Lentiviral of liver cell miR-199b and its construction method |
| CN109679994A (en) * | 2018-12-13 | 2019-04-26 | 湖北汇智铭传生物科技股份有限公司 | Pass through the episomal vector and its construction method of tetracycline inducing expression foreign gene |
| CN109679994B (en) * | 2018-12-13 | 2021-02-02 | 湖北汇智铭传生物科技股份有限公司 | Free vector for inducing expression of exogenous gene by tetracycline and construction method thereof |
| CN110373429A (en) * | 2019-08-01 | 2019-10-25 | 哈尔滨工业大学 | A kind of method that the mammalian cell specificity of lentivirus mediated is overexpressed miRNA |
| CN110540962A (en) * | 2019-08-28 | 2019-12-06 | 北京协同创新研究院 | Method for preparing human definitive endoderm cells |
| CN110540962B (en) * | 2019-08-28 | 2022-02-25 | 北京协同创新研究院 | Method for preparing human definitive endoderm cells |
| WO2021232633A1 (en) * | 2020-05-22 | 2021-11-25 | 深圳市深研生物科技有限公司 | Promoter element, and retroviral genome transcription cassette and vector which contain same |
| CN113699146A (en) * | 2020-05-22 | 2021-11-26 | 深圳市深研生物科技有限公司 | Promoter element, retroviral genome transcription cassette comprising the same, and vector |
| CN113699146B (en) * | 2020-05-22 | 2024-07-02 | 深圳市深研生物科技有限公司 | Promoter element and retroviral genome transcription cassette and vector comprising same |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Verhoef et al. | Strict control of human immunodeficiency virus type 1 replication by a genetic switch: Tet for Tat | |
| Shearer et al. | Experimental design for stable genetic manipulation in mammalian cell lines: lentivirus and alternatives | |
| Coyle et al. | The Tpr protein regulates export of mRNAs with retained introns that traffic through the Nxf1 pathway | |
| Pluta et al. | Use of HIV as a gene transfer vector | |
| KR102663972B1 (en) | HIV immunotherapy without pre-immunization phase | |
| Grainger et al. | Stress-inducible alternative translation initiation of human cytomegalovirus latency protein pUL138 | |
| Jadhav et al. | HIV‐1 Tat C modulates NOX 2 and NOX 4 expressions through miR‐17 in a human microglial cell line | |
| JP4024830B2 (en) | Recombinant viral vector derived from HHV-7, production method thereof, host cell transformation method using the same, host cell transformed therewith and gene therapy method using the same | |
| CN103074375A (en) | Inducible lentivirus miRNA expression vector and construction method thereof | |
| WO2004048583A2 (en) | Compositions and systems for the regulation of genes | |
| Spanevello et al. | Development of lentiviral vectors simultaneously expressing multiple siRNAs against CCR5, vif and tat/rev genes for an HIV-1 gene therapy approach | |
| Niu et al. | Preclinical evaluation of HIV-1 therapeutic ex vivo dendritic cell vaccines expressing consensus Gag antigens and conserved Gag epitopes | |
| Brown et al. | Robust, reversible gene knockdown using a single lentiviral short hairpin RNA vector | |
| Jung et al. | Preclinical assessment of mutant human TRIM5α as an anti-HIV-1 transgene | |
| Keim et al. | Efficient genetic manipulation of 1321N1 astrocytoma cells using lentiviral gene transfer | |
| Poling et al. | A lentiviral vector bearing a reverse intron demonstrates superior expression of both proteins and microRNAs | |
| Sakkhachornphop et al. | Zinc finger protein designed to target 2-long terminal repeat junctions interferes with human immunodeficiency virus integration | |
| Khoury et al. | The RNA-binding proteins SRP14 and HMGB3 control HIV-1 Tat mRNA processing and translation during HIV-1 latency | |
| Zielske et al. | Cytokines, including stem cell factor alone, enhance lentiviral transduction in nondividing human LTCIC and NOD/SCID repopulating cells | |
| Quinto et al. | Potent and stable attenuation of live-HIV-1 by gain of a proteolysis-resistant inhibitor of NF-κB (IκB-αS32/36A) and the implications for vaccine development | |
| RU2426788C1 (en) | Genetic make-ups for anti-hiv therapy | |
| Das et al. | Construction of a doxycycline-dependent simian immunodeficiency virus reveals a nontranscriptional function of tat in viral replication | |
| Mitta et al. | Design and in vivo characterization of self-inactivating human and non-human lentiviral expression vectors engineered for streptogramin-adjustable transgene expression | |
| Gu et al. | The enhancement of RNAi against HIV in vitro and in vivo using H-2Kk protein as a sorting method | |
| CN102352360B (en) | Construction and function test of double-long-hairpin RNA (Ribonucleic Acid) expression element for inhibiting HIV-1 (Human Immunodeficiency Virus-1) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20130501 |