CN105925613B - Promote the highly expressed Lentiviral of liver cell miR-199b and its construction method - Google Patents
Promote the highly expressed Lentiviral of liver cell miR-199b and its construction method Download PDFInfo
- Publication number
- CN105925613B CN105925613B CN201610325842.3A CN201610325842A CN105925613B CN 105925613 B CN105925613 B CN 105925613B CN 201610325842 A CN201610325842 A CN 201610325842A CN 105925613 B CN105925613 B CN 105925613B
- Authority
- CN
- China
- Prior art keywords
- sequence
- mirna
- pri
- gene
- liver cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
- C12N2740/15041—Use of virus, viral particle or viral elements as a vector
- C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Virology (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The present invention provides a kind of highly expressed Lentiviral of promotion liver cell miR-199b, the basic sequence, resistance gene sequences, multiple cloning sites sequence, promoter sequence including pCDH-CMV-MCS-EF1-Puro viral vectors and the Pri-miRNA-199b sequence product containing green fluorescence gene；The multiple cloning sites sequence includes Nhe I restriction enzyme site and BamH I restriction enzyme site, and the Pri-miRNA-199b sequence product forward direction containing green fluorescence gene is inserted into the multiple cloning sites sequence.The invention belongs to gene engineering technology field, recombinant slow virus expression vector provided by the invention has transfection efficiency height, and the few advantage of dosage can lasting, efficient in source of people liver cell, steadily improve miRNA-199b expression.
Description
Technical field
The invention belongs to gene engineering technology fields, more particularly to promote the highly expressed slow virus table of liver cell miR-199b
Up to carrier and its construction method.
Background technique
MiRNA is the endogenic non-coding small molecule of a kind of evolution conservative, is prevalent in diversity organism internal reference
With gene regulation.MiRNA major regulatory coding albumen gene expression, mechanism of action be degradation be complementary combination
MRNA or the mRNA translation for inhibiting incomplete pairing, have very important biological action.
MiRNA is to become primary miRNA (pri-miRNA) by DNA transcription under DNA polymerase i I effect in nucleus.
MiRNA in core under the action of enzyme RNase III-Drosha processing be cut into the hairpin structure of six or seven ten nucleotide sequences before
Body pre-miRNA, then the nuclear translocation receptor family member of dependenc RNA is transported under the action of exporting albumen Exportin-5 again
Endochylema.Secondary operation is single-stranded mature miRNA under endochylema RNase III Dicer enzyme effect, compound with RNA induction silencing
Object, which combines, forms RISC, inhibits it to translate after identifying said target mrna or by going polyadenylation and the effect of raising one's hat that mRNA is caused to degrade.
By miRNA microRNA target prediction software lookup can combination complementary with 3 '-UTR of SET gene miRNAs, including
MiRNA-23a, miRNA-21, miRNA-199b, miRNA-20a, miRNA-29b, miRNA-194, miRNA-221, miRNA-
129 etc..
It has been found that miR-199b abnormal low expression and closely related with patient's prognosis in liver cancer in existing research.Li Weihua
Et al. by miR-199b fragment transfection into Ewing sarcoma cell, but utilize be liposome transiently transfect and and unstable turn
Dye, plasmid can gradually be lost with cell Proliferation.Therefore functional study of the miR-199b in liver cell is restricted.
Have not yet to see lasting, stable and high efficient expression miR-199b the recombinant vector in source of people liver cell.
Summary of the invention
To solve problems of the prior art, it is highly expressed slow to provide a kind of promotion liver cell miR-199b by the present invention
Virus expression carrier, by by the Pri-miRNA-199b sequence product containing green fluorescence gene and pCDH-CMV-MCS-
The recombinant slow virus expression vector that EF1-Puro viral vectors connects has transfection efficiency high, the few advantage of dosage, can be
Lasting, efficient in source of people liver cell, steadily raising miRNA-199b expression.In the present invention, miR-199b refers to miRNA-199b.
The present invention provides a kind of highly expressed Lentiviral of promotion liver cell miR-199b, including pCDH-CMV-
The basic sequence of MCS-EF1-Puro viral vectors, resistance gene sequences, multiple cloning sites sequence, promoter sequence and containing green
The Pri-miRNA-199b sequence product of color fluorogene；The multiple cloning sites sequence includes Nhe I restriction enzyme site and BamH
I restriction enzyme site, the Pri-miRNA-199b sequence product forward direction containing green fluorescence gene are inserted into the multiple cloning sites
In sequence.
By adopting the above technical scheme, the Pri-miRNA-199b sequence product provided by the invention containing green fluorescence gene
The recombinant slow virus expression vector that insertion pCDH-CMV-MCS-EF1-Puro viral vectors constructs has transfection efficiency height,
The few advantage of dosage, sustainable, efficient, steadily raising miRNA-199b expression, can be applied to preparation treatment miRNA-199b
In the exploitation of abnormal expression related disease drug.
Preferably, the Pri-miRNA-199b sequence product containing green fluorescence gene is obtained by PCR amplification, with
Pri-miRNA-199b recombinant plasmid is template, and PCR primer includes upstream primer and downstream primer, the sequence of the upstream primer
Are as follows: CTAGCTAGCATGGCCCAGTCCAAGCAC, i.e. SEQ ID NO:1, the sequence of the downstream primer are as follows:
CGGGATCCATCCTCTCAGTCTTCCTC, i.e. SEQ ID NO:2.Using above-mentioned template and PCR primer, can be expanded by PCR
Increase the Pri-miRNA-199b sequence containing green fluorescence gene out, reduce sequent synthesis expense, cost is relatively low and is convenient for seeing
Examine detection transfection efficiency.
It is highly preferred that the Pri-miRNA-199b recombinant plasmid includes pCI MammaLian Expression
Basic sequence, resistance gene sequences, multiple cloning sites sequence, promoter sequence and the Pri-miRNA- of Vector expression vector
199b sequence；The multiple cloning sites include EcoRI restriction enzyme site and Kpn I restriction enzyme site, the Pri-miRNA-199b sequence
Column are positive to be inserted into the multiple cloning sites sequence.
It is further preferred that the Pri-miRNA-199b sequence is obtained by PCR amplification, PCR primer includes that upstream is drawn
Object and downstream primer, the sequence of the upstream primer are as follows: GGAATTCACAGACACTGCTGCCTGGAT, i.e. SEQ ID NO:3,
The sequence of the downstream primer are as follows: GGGGTACCCCATCCTCTCAGTCTTCCTC, i.e. SEQ ID NO:4.By PCR amplification,
Two specific cleavage sites of EcoRI and KpnI are introduced.
The equal primer free dimer of upstream primer and downstream primer provided by the invention, and upstream primer and downstream primer are moved back
Fiery temperature spread is smaller.
Correspondingly, the present invention also provides a kind of buildings for promoting the highly expressed Lentiviral of liver cell miR-199b
Method includes the following steps:
The design of primers of S1:Pri-miRNA-199b: the miRNA- with SET gene association is found by the library miRBase
The Pri-miRNA sequence of 199b gene, and EcoR I and Kpn I specific cleavage site is introduced, design upstream primer are as follows:
GGAATTCACAGACACTGCTGCCTGGAT, i.e. SEQ ID NO:3；Downstream primer are as follows:
GGGGTACCCCATCCTCTCAGTCTTCCTC, i.e. SEQ ID NO:4；Above-mentioned primer includes by the product that PCR amplification obtains
EcoR I and Kpn I specific cleavage site；
The acquisition of S2:Pri-miRNA-199b sequence:, will using RNA Reverse Transcriptase kit after extracting human liver cell total serum IgE
RNA reverse transcription be cDNA, using cDNA as template, and in step S1 upstream primer and downstream primer carry out PCR amplification, acquisition
Pri-miRNA-199b sequence；
The acquisition of S3:Pri-miRNA-199b recombinant plasmid: pCI MammaLian Expression Vector carrier warp
The Pri-miRNA- that after Xho I and EcoR I site inserts Zsgreen- green fluorescence gene and step S2 is obtained is transformed
Respectively after EcoR I and Kpn I restriction enzymes double zyme cutting, T4 DNA ligase is connected 199b gene order
The connection product is transformed into competent E.coli by product, on even spread to the culture medium flat plate of LB containing ampicillin,
Picking positive monoclonal bacterium colony culture saves bacterium solution and carries out PCR Preliminary Identification, and Preliminary Identification result is illustrated Pri-miRNA-
199b sequence is inserted into successful bacterium solution and carries out sequencing identification, and the correct Escherichia coli of sequencing identification are cultivated and extracted, are contained
The Pri-miRNA-199b recombinant plasmid of Pri-miRNA-199b sequence；
S4: the acquisition of the Pri-miRNA-199b sequence product containing green fluorescence gene: the Pri- obtained with step S3
MiRNA-199b recombinant plasmid is that template carries out PCR amplification, and PCR primer includes upstream primer and downstream primer, and the upstream is drawn
The sequence of object are as follows: CTAGCTAGCATGGCCCAGTCCAAGCAC, i.e. SEQ ID NO:1, the sequence of the downstream primer are as follows:
CGGGATCCATCCTCTCAGTCTTCCTC, i.e. SEQ ID NO:2, obtain the Pri-miRNA-199b containing green fluorescence gene
Sequence product；
S5: promote the building of the highly expressed Lentiviral of liver cell miR-199b: by pCDH-CMV-MCS-EF1-
After Puro viral vectors carries out double digestion with Nhe I and BamH I restriction enzyme, T4DNA ligase obtains step S4
Pri-miRNA-199b sequence product containing green fluorescence gene is connected to pCDH-CMV-MCS-EF1-Puro viral vectors,
Obtain recombinant slow virus expression vector.
Preferably, the human liver cell is HL-7702 cell, and the competent E.coli is JM 109.
In addition, the present invention also provides the highly expressed Lentivirals of promotion liver cell miR-199b to prepare
Treat the purposes in SET gene or the drug of miR-199b abnormal gene expression related disease.
Compared with prior art, the beneficial effect comprise that the present invention contains green fluorescence gene by that will expand
Pri-miRNA-199b sequence product, and be inserted into pCDH-CMV-MCS-EF1-Puro viral vectors and construct to obtain stable weight
Group Lentiviral, the Lentiviral have transfection efficiency high, and dosage is few, can be special, lasting, efficient, stable
Ground promote human liver cell miRNA-199b high expression, can be applied to in the research of miRNA-199b abnormal gene expression.This hair
It is bright to additionally provide the special construction method for promoting the highly expressed Lentiviral of liver cell miRNA-199b, operating effect
It is good, reduce sequent synthesis expense, cost is relatively low and detects transfection efficiency convenient for observation.
Detailed description of the invention
Gel electrophoresis figure in Fig. 1 embodiment of the present invention three after PCR amplification.
The sequencing result figure of Pri-miR-199b recombinant plasmid in Fig. 2 embodiment of the present invention three.
The double digestion result figure of Pri-miRNA-199b recombinant plasmid in Fig. 3 embodiment of the present invention three.
The map of Fig. 4 pCDH-CMV-MCS-EF1-Puro viral vectors.
The sequencing result figure of recombinant slow virus expression vector in Fig. 5 embodiment of the present invention six.
The double digestion result figure of recombinant slow virus expression vector in Fig. 6 embodiment of the present invention six.
Shows fluorescent microscopy images in Fig. 7 embodiment of the present invention eight after viral supernatants infection HL-7702 liver cell.
Relative expression's result figure of real-time fluorescence quantitative PCR detection miR-199b in Fig. 8 embodiment of the present invention eight.
Specific embodiment
The present invention is described in further details with reference to the accompanying drawings and examples.
Used material can be obtained by being commercially available or by the conventional method of this field in the present invention.Such as: HL-
7702 cells are purchased from Shanghai Cell Bank of the Chinese Academy of Sciences, and pCI MammaLian Expression Vector expression vector is purchased from
Promega company, the U.S., pCDH-CMV-MCS-EF1-Puro viral vectors are purchased from Shenzhen Bo Aokang Bioisystech Co., Ltd
Rneasy Mini Kit kit and Reverse Transcriptase kit are purchased from QIAGEN company, Germany, Endo-free Plasmid Maxi
Kit is purchased from U.S. Omega company, and virus packaging auxiliary reagent box is purchased from Takara company, Japan, and T4DNA ligase is purchased from precious raw
Object engineering (Dalian) Co., Ltd.
The primer of one Pri-miRNA-199b of embodiment
The Pri-miRNA sequence with the miRNA-199b gene of SET gene association is found by the library miRBase, and is introduced
EcoR I and Kpn I specific cleavage site designs upstream primer are as follows: GGAATTCACAGACACTGCTGCCTGGAT, i.e. SEQ
ID NO:3；Downstream primer are as follows: GGGGTACCCCATCCTCTCAGTCTTCCTC, i.e. SEQ ID NO:4 transfer to the raw work in Shanghai raw
The synthesis of object company.
The acquisition of two Pri-miRNA-199b sequence of embodiment
When cultivating HL-7702 liver cell to logarithmic growth phase, after cleaning cell three times with PBS buffer solution, residual PBS is delayed
Fliud flushing is drawn completely, is operated according to Rneasy Mini Kit kit specification, obtains total serum IgE.Utilize RNA reverse transcription
Kit by RNA reverse transcription be cDNA, using cDNA as template, and in embodiment one upstream primer and downstream primer carry out
PCR amplification obtains Pri-miRNA-199b sequence.Pcr amplification reaction system is as shown in table 1, pcr amplification reaction condition such as table 2
It is shown.
1 pcr amplification reaction system of table
2 pcr amplification reaction condition of table
The acquisition of three Pri-miRNA-199b recombinant plasmid of embodiment
PCI MammaLian Expression Vector carrier is transformed by Shenzhen Bo Aokang Biotechnology Co., Ltd
Zsgreen- green fluorescence gene is inserted, the insertion point of green fluorescence gene is XhoI and EcoRI.Improved pCI
The Pri-miRNA-199b gene order that MammaLian Expression Vector carrier and step S2 are obtained is respectively through EcoR
After I and Kpn I restriction enzymes double zyme cutting, T4 DNA ligase connects to obtain connection product.The connection product is transformed into
In competent E.coli, on even spread to the culture medium flat plate of LB containing ampicillin, picking positive monoclonal bacterium colony culture
It saves bacterium solution and carries out PCR Preliminary Identification, the gel electrophoresis figure after PCR amplification is as shown in Figure 1, result illustrates that bacterium colony PCR is identified
As a result it is the positive, can be used for picking plasmid and expand culture.Preliminary Identification result is illustrated that Pri-miRNA-199b sequence is inserted
Enter successful bacterium solution and carry out sequencing identification, as a result as shown in Fig. 2, being consistent with expection.Correct Escherichia coli training is identified into sequencing
It supports, and is stripped using Endo-free Plasmid Maxi Kit, obtain the Pri- of the sequence containing Pri-miRNA-199b
MiRNA-199b recombinant plasmid；Double digestion identification is carried out to the Pri-miRNA-199b recombinant plasmid of extraction, as a result such as Fig. 3 institute
Show, illustrates the success of Pri-miRNA-199b construction of recombinant plasmid.
Example IV contains the acquisition of the Pri-miRNA-199b sequence product of green fluorescence gene
PCR amplification is carried out as template using the Pri-miRNA-199b recombinant plasmid that embodiment three obtains, PCR primer includes upper
Swim primer and downstream primer, the sequence of the upstream primer are as follows: CTAGCTAGCATGGCCCAGTCCAAGCAC, i.e. SEQ ID
NO:1, the sequence of the downstream primer are as follows: CGGGATCCATCCTCTCAGTCTTCCTC, i.e. SEQ ID NO:2 are obtained containing green
The Pri-miRNA-199b sequence product of color fluorogene.PCR amplification system is as shown in table 3, pcr amplification reaction condition such as table 4
It is shown.
3 PCR amplification system of table
4 pcr amplification reaction condition of table
The building of the promotion highly expressed Lentiviral of liver cell miR-199b of embodiment five
PCDH-CMV-MCS-EF1-Puro viral vectors is subjected to double digestion with Nhe I and BamH I restriction enzyme
Afterwards, the Pri-miRNA-199b sequence product containing green fluorescence gene that T4DNA ligase obtains example IV is connected to
PCDH-CMV-MCS-EF1-Puro viral vectors obtains recombinant slow virus expression vector.PCDH-CMV-MCS-EF1-Puro disease
The map of poisonous carrier is as shown in Figure 4.
The identification of the promotion highly expressed Lentiviral of liver cell miR-199b of embodiment six
The recombinant slow virus expression vector that embodiment five obtains is transformed into competent E.coli, even spread is to containing
On ampicillin LB culture medium flat plate, picking positive monoclonal bacterium colony culture saves bacterium solution and carries out PCR Preliminary Identification.It will be first
Step qualification result illustrates that Pri-miRNA-199b sequence is inserted into successful bacterium solution and carries out sequencing identification, as a result as shown in figure 5, with pre-
Phase is consistent.Correct Escherichia coli culture is identified into sequencing, and is stripped using Endo-free Plasmid Maxi Kit,
Obtain recombinant slow virus expression vector；Double digestion identification is carried out to the recombinant slow virus expression vector of extracting, as a result such as Fig. 6 institute
Show, illustrates the success of recombinant slow virus expression vector establishment.
Embodiment seven transfects Pri-miRNA-199b recombinant slow virus expression vector and carries out viral packaging
293T cell is cultivated, the recombinant slow virus expression vector that Example six extracts transfects 293T cell, according to virus
Packaging auxiliary reagent box operational manual is operated, and Pri-miR-199b viral supernatants are collected after 48h, and 5000g is centrifuged 10min
After take supernatant, calculate virus titre be 3.4x106IFU。
The detection of the viral supernatants infectious effect of eight Pri-miRNA-199b recombinant viral vector of embodiment
Pri-miR-199b viral supernatants are infected into HL-7702 liver cell, observe virus under fluorescence microscope after 36h
Infectious effect is as shown in fig. 7, the efficiency of infection of viral supernatants is very high as can be seen from Figure 7.
After Pri-miR-199b recombinant virus Supernatant infection HL-7702 liver cell, successful liver cell will be infected and do not felt
After total serum IgE behind normal liver cell culture 2 months of dye extracts respectively, carry out real-time fluorescence quantitative PCR detection miR-199b's
Relative expression's situation, structure is as shown in figure 8, con refers to the control group being uninfected by.As it can be observed in the picture that Pri-miR-199b recombinant virus
The relative expression quantity of miR-199b after infection HL-7702 liver cell is significantly larger than the relative expression quantity of control group.
The above content is a further detailed description of the present invention in conjunction with specific preferred embodiments, and it cannot be said that
Specific implementation of the invention is only limited to these instructions.For those of ordinary skill in the art to which the present invention belongs, exist
Under the premise of not departing from present inventive concept, a number of simple deductions or replacements can also be made, all shall be regarded as belonging to of the invention
Protection scope.
SEQUENCE LISTING
<110>Center of Diseases Prevention & Control, Shenzhen City
<120>promote the highly expressed Lentiviral of liver cell miR-199b and its construction method
<130>
<160> 4
<170> PatentIn version 3.5
<210> 1
<211> 27
<212> DNA
<213>artificial sequence
<400> 1
ctagctagca tggcccagtc caagcac 27
<210> 2
<211> 26
<212> DNA
<213>artificial sequence
<400> 2
cgggatccat cctctcagtc ttcctc 26
<210> 3
<211> 27
<212> DNA
<213>artificial sequence
<400> 3
ggaattcaca gacactgctg cctggat 27
<210> 4
<211> 28
<212> DNA
<213>artificial sequence
<400> 4
ggggtacccc atcctctcag tcttcctc 28
Claims (5)
1. a kind of highly expressed Lentiviral of promotion liver cell miR-199b, it is characterised in that: including pCDH-CMV-
The basic sequence of MCS-EF1-Puro viral vectors, resistance gene sequences, multiple cloning sites sequence, promoter sequence and containing green
The Pri-miRNA-199b sequence product of color fluorogene；The multiple cloning sites sequence includes Nhe I restriction enzyme site and BamH
I restriction enzyme site, the Pri-miRNA-199b sequence product forward direction containing green fluorescence gene are inserted into the multiple cloning sites
In sequence；
The Pri-miRNA-199b sequence product containing green fluorescence gene is obtained by PCR amplification, with Pri-miRNA-
199b recombinant plasmid is template, and PCR primer includes upstream primer and downstream primer, the sequence of the upstream primer are as follows:
CTAGCTAGCATGGCCCAGTCCAAGCAC, i.e. SEQ ID NO:1, the sequence of the downstream primer are as follows:
CGGGATCCATCCTCTCAGTCTTCCTC, i.e. SEQ ID NO:2；
The Pri-miRNA-199b recombinant plasmid includes the base of pCI MammaLian Expression Vector expression vector
This sequence, resistance gene sequences, multiple cloning sites sequence, promoter sequence and Pri-miRNA-199b sequence；It is described polyclonal
Site includes EcoR I restriction enzyme site and Kpn I restriction enzyme site, and the Pri-miRNA-199b sequence forward direction is inserted into described more grams
In grand site sequence.
2. the highly expressed Lentiviral of promotion liver cell miR-199b according to claim 1, it is characterised in that:
The Pri-miRNA-199b sequence is obtained by PCR amplification, and PCR primer includes upstream primer and downstream primer, the upstream
The sequence of primer are as follows: GGAATTCACAGACACTGCTGCCTGGAT, i.e. SEQ ID NO:3, the sequence of the downstream primer are as follows:
GGGGTACCCCATCCTCTCAGTCTTCCTC, i.e. SEQ ID NO:4.
3. a kind of construction method for promoting the highly expressed Lentiviral of liver cell miR-199b, it is characterised in that: including
Following steps:
The design of primers of S1:Pri-miRNA-199b: the miRNA-199b base with SET gene association is found by the library miRBase
The Pri-miRNA sequence of cause, and EcoR I and Kpn I specific cleavage site is introduced, design upstream primer are as follows:
GGAATTCACAGACACTGCTGCCTGGAT, i.e. SEQ ID NO:3；Downstream primer are as follows:
GGGGTACCCCATCCTCTCAGTCTTCCTC, i.e. SEQ ID NO:4；
The acquisition of S2:Pri-miRNA-199b sequence: after extracting human liver cell total serum IgE, using RNA Reverse Transcriptase kit by RNA
Reverse transcription is cDNA, using cDNA as template, and in step S1 upstream primer and downstream primer carry out PCR amplification, obtain
Pri-miRNA-199b sequence；
The acquisition of S3:Pri-miRNA-199b recombinant plasmid: pCI MammaLian Expression Vector carrier is engineered
After Xho I and EcoR I site inserts Zsgreen- green fluorescence gene and step S2 obtain Pri-miRNA-199b
Respectively after EcoR I and Kpn I restriction enzymes double zyme cutting, T4DNA ligase connects to obtain connection product gene order,
The connection product is transformed into competent E.coli, on even spread to the culture medium flat plate of LB containing ampicillin, picking
Positive monoclonal bacterium colony culture saves bacterium solution and carries out PCR Preliminary Identification, and Preliminary Identification result is illustrated Pri-miRNA-199b
Sequence is inserted into successful bacterium solution and carries out sequencing identification, and the correct Escherichia coli of sequencing identification are cultivated and extracted, are obtained containing Pri-
The Pri-miRNA-199b recombinant plasmid of miRNA-199b sequence；
S4: the acquisition of the Pri-miRNA-199b sequence product containing green fluorescence gene: the Pri- obtained with step S3
MiRNA-199b recombinant plasmid is that template carries out PCR amplification, and PCR primer includes upstream primer and downstream primer, and the upstream is drawn
The sequence of object are as follows: CTAGCTAGCATGGCCCAGTCCAAGCAC, i.e. SEQ ID NO:1, the sequence of the downstream primer are as follows:
CGGGATCCATCCTCTCAGTCTTCCTC, i.e. SEQ ID NO:2, obtain the Pri-miRNA-199b containing green fluorescence gene
Sequence product；
S5: promote the building of the highly expressed Lentiviral of liver cell miR-199b: by pCDH-CMV-MCS-EF1-Puro
After viral vectors carries out double digestion with Nhe I and BamH I restriction enzyme, T4DNA ligase contains what step S4 was obtained
The Pri-miRNA-199b sequence product of green fluorescence gene is connected to pCDH-CMV-MCS-EF1-Puro viral vectors, obtains
Recombinant slow virus expression vector.
4. the construction method according to claim 3 for promoting the highly expressed Lentiviral of liver cell miR-199b,
It is characterized by: the human liver cell is HL-7702 cell, the competent E.coli is JM 109.
5. the highly expressed Lentiviral of promotion liver cell miR-199b described in any one of Claims 1-4 is being made
Purposes in standby treatment SET gene or the drug of miR-199b abnormal gene expression related disease.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610325842.3A CN105925613B (en) | 2016-05-17 | 2016-05-17 | Promote the highly expressed Lentiviral of liver cell miR-199b and its construction method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610325842.3A CN105925613B (en) | 2016-05-17 | 2016-05-17 | Promote the highly expressed Lentiviral of liver cell miR-199b and its construction method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105925613A CN105925613A (en) | 2016-09-07 |
| CN105925613B true CN105925613B (en) | 2019-09-06 |
Family
ID=56841361
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610325842.3A Active CN105925613B (en) | 2016-05-17 | 2016-05-17 | Promote the highly expressed Lentiviral of liver cell miR-199b and its construction method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105925613B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108424934A (en) * | 2018-04-16 | 2018-08-21 | 和元生物技术（上海）股份有限公司 | A kind of slow virus CAG-CMV double-promoters transformation vector construction and application |
| CN112522318A (en) * | 2020-11-11 | 2021-03-19 | 深圳市疾病预防控制中心（深圳市卫生检验中心、深圳市预防医学研究所） | Lentiviral expression vector with high expression of neuroblast miR-200b/c and construction method thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103074375A (en) * | 2011-10-26 | 2013-05-01 | 华中科技大学同济医学院附属协和医院 | Inducible lentivirus miRNA expression vector and construction method thereof |
-
2016
- 2016-05-17 CN CN201610325842.3A patent/CN105925613B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103074375A (en) * | 2011-10-26 | 2013-05-01 | 华中科技大学同济医学院附属协和医院 | Inducible lentivirus miRNA expression vector and construction method thereof |
Non-Patent Citations (2)
| Title |
|---|
| microRNA-199b-5p 在尤文肉瘤细胞系中的功能研究;李卫华 等;《中国修复重建外科杂志》;20150531;第29卷(第5期);第595-599页 |
| Underexpressed microRNA-199b-5p targets Hypoxia-Inducible Factor-1a in hepatocellular carcinoma and predicts prognosis of hepatocellular carcinoma patients;C Wang et al.;《Journal of Gastroenterology and Hepatology》;20111231;第26卷(第11期);第1630-1637页 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105925613A (en) | 2016-09-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105087645A (en) | Building and application of M protein three-amino acid site-mutated vesicular stomatitis virus (VSV) carrier for pigs | |
| CN105925613B (en) | Promote the highly expressed Lentiviral of liver cell miR-199b and its construction method | |
| TW201842923A (en) | Use of a composition comprising mir-302 precursors for the manufacture of a medicine for treatment of lung cancer | |
| CN101288770A (en) | New herpes simplex virus type II DNA vaccine | |
| CN113416768B (en) | Application of PRKRA gene as target in inhibiting replication of peste des petits ruminants virus | |
| CN115161321A (en) | Application of ssc-miR-30c-3p in preparation of PDCoV proliferation-resistant medicine | |
| US20200165607A1 (en) | Composition and method of using mir-302 precursors as anti-cancer drugs for treating human lung cancer | |
| CN112143754B (en) | Porcine Galta virus infectious clone and construction method and application thereof | |
| CN103497241B (en) | Prawn anti-viral Argonaute protein, as well as encoding cDNA (complementary deoxyribonucleic acid) and application thereof | |
| CN111518812B (en) | sgRNA for editing sheep FGF5 gene to realize alternative splicing, complete nucleic acid molecule and application | |
| CN109022436A (en) | The special shRNA construction of recombinant vector for inhibiting 3 β-HSD gene expressions and application | |
| CN105039268A (en) | Recombinant duck plague virus of expressing duck tembusu virus E protein as well as construction method and application of recombinant duck plague virus | |
| CN115820638B (en) | Exogenous artificial miRNA for inhibiting replication of waterfowl-derived avian reovirus and application thereof | |
| CN108866099A (en) | Specificity inhibits the recombined lentivirus vector and its construction method of lung adenocarcinoma cell miRNA-21-5p expression | |
| CN108517335B (en) | A kind of Lentiviral and its construction method of liver cell miR-199b low expression | |
| CN103589693B (en) | A kind of expression IBDV VP2 and bursa of Fabricius bursin chimeric protein recombinant herpesvirus of turkeys | |
| CN101906417A (en) | shRNA for hepatitis B virus and recombinant adeno-associated virus vector treating vector carrying same | |
| CN112063620A (en) | shRNA for inhibiting expression of porcine epidemic diarrhea virus M gene | |
| CN102260672A (en) | siRNA (small interfering RNA) for inhibiting expression of porcine Somatostatin receptor 2 | |
| CN101058819A (en) | FNAi carrier and application thereof | |
| CN108424926A (en) | A kind of nucleic acid vaccine for preventing HPV infection | |
| CN102643860A (en) | Recombinant lentiviral vector aiming at hUHRF1 gene RNA (Ribonucleic Acid) interference and preparation thereof | |
| CN111789957B (en) | Application of combination of knockdown lncBCAS1-4_1 cell line and active vitamin D in preparation of antitumor drugs | |
| CN107586778B (en) | shRNA sequence for inhibiting influenza A virus replication and application thereof | |
| CN116059371B (en) | Application of preparation for activating VASH gene expression of pig in preparation of medicine for resisting pseudorabies virus infection of pig |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |