CN103074236B - Camptotheca endophytic fungi for producing camptothecin and application thereof - Google Patents
Camptotheca endophytic fungi for producing camptothecin and application thereof Download PDFInfo
- Publication number
- CN103074236B CN103074236B CN201210590518.6A CN201210590518A CN103074236B CN 103074236 B CN103074236 B CN 103074236B CN 201210590518 A CN201210590518 A CN 201210590518A CN 103074236 B CN103074236 B CN 103074236B
- Authority
- CN
- China
- Prior art keywords
- camptothecine
- dark green
- green trichoderma
- camptothecin
- bacterial strain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses camptotheca endophytic fungi for producing camptothecin and an application thereof in the preparation of the camptothecin. Trichoderma atroviride LY357 is the endophytic fungi separated from the organ tissue of camptotheca, the nyssaceae plant, and has been preserved in the China General Microbiological Culture Collection Center, wherein the preservation date is Nov. 19, 2012 and the preservation number is CGMCC6858. The strain employing general liquid fermentation cultural method can be applied to preparing the camptothecin, and the obtained camptothecin mainly exists in fermentation liquid extract. The method for obtaining the trichoderma atroviride LY357 separated from the camptotheca plant material is simple and easy to operate, the method for obtaining the camptothecin by fermental cultivation of the trichoderma atroviride LY357 is also simple and easy to operate, and the obtained camptothecin is high in productivity.
Description
Technical field
The present invention relates to a kind of endogenetic fungus and application thereof, particularly relate to a kind of camplotheca acuminata endogenetic fungus and the application in preparation camptothecine thereof, belong to microbial fungi and the material technology field by its manufacture or acquisition.
Background technology
Camptothecine (CPT) belongs to terpene indole alkaloid, is a kind of natural compounds of bringing into play anti-tumor activity by suppressing topoisomerase I, its antitumor mechanism uniqueness.Camptothecine series derivates as 10-hydroxycamptothecine, irinotecan, topotecan etc. be the high antitumor drug of added value, all effective to the cancerous lesion of multiple organ-tissue, become the principal item on antitumor drug market, the world.Camptothecine is separated and obtains in 1966 by people such as Wall the earliest from the peculiar Nyssaceae plant camptotheca acuminata of China (Camptotheca acuminata) bark, finds successively again afterwards in the plants such as the wooden GOUYAHUA in sea (Ervatamia heyneana), foetid nothapodytes herb (Nothapodytes foetida) and short and small Herba ophiorrhizae japonicae (Ophiorrhiza pumila).The camptothecine market requirement is large, simple by extract demand (the world market annual camptothecine demand 3000kg that camptothecine cannot meet people from camplotheca acuminata, but only 600kg of global camptothecine annual production), also can cause the waste of resource and the destruction of environment simultaneously.Therefore, carry out the separation of camplotheca acuminata endogenetic fungus and the research of meta-bolites thereof, utilize microbial fermentation technology to synthesize camptothecine, improve camptothecine output and become the important channel that camptothecine is obtained.
Summary of the invention
Object of the present invention is just to provide a kind of camplotheca acuminata endogenetic fungal bacterial strain and the application method in camptothecine preparation thereof.This bacterial strain separates and obtains from camplotheca acuminata vegetable material, can obtain camptothecine, and output is higher by fermentation culture.
For achieving the above object, the invention provides one separates and obtains endogenetic fungus LY357 from Nyssaceae plant camptotheca acuminata, belong to dark green trichoderma (Trichoderma atroviride), be preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center, preservation date on November 19th, 2012, deposit number CGMCC6858.
From camplotheca acuminata, separate and obtain the ITS of endogenetic fungus LY357 and 5.8S rDNA base sequence and be depicted as SEQ ID NO.1:
TCCGTAGGTGAACCTGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACCATACCAAACTGTTGCCTCGGCGGGGTCACGCCCCGGGTGCGTCGCAGCCCCGGAACCAGGCGCCCGCCGGAGGGACCAACCAAACTCTTTTCTGTAGTCCCCTCGCGGACGTTATTTCTTACAGCTCTGAGCAAAAATTCAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGACCTCGGGAGCCCCTAAGACGGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACAACTCGCACCGGGAGCGCGGCGCGTCCACGTCCGTAAAACACCCAACTTTCTGGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA
Sequencing result SEQ ID NO.1 submits http://blast.ncbi.nlm.nih.gov/Blast and compares, reach a conclusion according to BLAST result combining form feature, confirming this bacterial strain is dark green trichoderma, the dark green trichoderma LY357 of called after (Trichoderma atroviride LY357).
A kind of method that separates dark green trichoderma LY357 from camplotheca acuminata: camplotheca acuminata vegetable material is inoculated into 5% water Solid agar culture after according to routine operation segment, cleaning, sterilization, 28 DEG C ± 2 DEG C constant temperature culture 2～3 weeks, treat that vegetable material grows mycelia, picking mycelia moves to sabouraud's agar solid medium and continues to cultivate, finally by obtaining the dark green trichoderma LY357 of endogenetic fungus after purifying.According to the general operation method of inoculation, first cut off before inoculation through the camplotheca acuminata vegetable material of segment, cleaning, sterilization, and new tangent plane is inoculated into 5% water Solid agar culture.
Above-mentioned dark green trichoderma LY357 adopts conventional liquid fermentation culturing method to can be applicable to prepare camptothecine.
Utilize dark green trichoderma LY357 to obtain a method for camptothecine, comprise dark green trichoderma LY357 strain fermentation culturing step, camptothecine extraction step; It is characterized in that: in described fermentation culture step, by dark green trichoderma LY357 inoculation to Sharpe liquid nutrient medium, shaking table 160 ± 20rpm, 28 ± 2 DEG C, fermentation culture 8～15d, obtains fermenting mixture; In described camptothecine extraction step, fermenting mixture, through the centrifugal 15min of 4000rpm, is filtered, collect respectively filtrate and mycelium; Described filtrate is through chloroform-methanol (V/V=4:1) mixed extractant solvent, and organic phase is evaporated to the dry fermentation broth extract that obtains in 40 DEG C; Described mycelium grinds broken, methyl alcohol soaked overnight, and equal-volume chloroform-methanol (V/V=4:1) mixed extractant solvent, 40 DEG C of concentrating under reduced pressure of organic phase obtain mycelium extract; Fermentation broth extract or mycelium extract add chloroform-methanol (V/V=4:1) to dissolve, and filter and obtain camptothecine crude extract through syringe filters.
The method of above-mentioned acquisition camptothecine, needs first to prepare seed liquor according to routine operation if desired, comprises actication of culture and seed culture.In actication of culture, activation medium is Sharpe solid medium, 28 ± 2 DEG C, and incubation time 5～7d; In seed culture, substratum is Sharpe liquid nutrient medium, and 28 ± 2 DEG C, shaking table 160 ± 20rpm cultivates 2～3d.
The composition analysis demonstration of the fermentation broth extract that dark green trichoderma LY357 makes through fermentation culture or mycelium extract, camptothecine is mainly present in fermentation broth extract, only contains trace camptothecine in mycelium extract.
Compared with prior art, the invention has the beneficial effects as follows: (1) separates the dark green trichoderma LY357 of the camplotheca acuminata endogenetic fungus making new advances from camplotheca acuminata plant; (2) dark green trichoderma LY357 has the camptothecine of producing characteristic, can be applied to preparation camptothecine; (3) dark green trichoderma LY357 possesses higher camptothecine output (in table 1) through fermentation culture; (4) dark green trichoderma LY357 separation method is simple and easy to control; (5) utilize the method for dark green trichoderma LY357 acquisition camptothecine simple and easy to control.
The comparison of the dark green trichoderma LY357 of table 1 and existing product camptothecine strain bacterium output
Reference: endogenetic fungus produces the progress of camptothecine and analogue thereof, modern biomedical progress, 2010, Vol.10NO.17
Brief description of the drawings
Figure 1A, camptothecine standard substance (I) are schemed with the HPLC-DAD of dark green trichoderma LY357 fermentation broth extract (II), are camptothecine;
Figure 1B, camptothecine standard substance (I) and dark green trichoderma LY357 fermentation broth extract (II) the ultraviolet waves spectrogram of the camptothecine of producing (II);
Fig. 2, the mass spectrum of camptothecine standard substance (I) and dark green trichoderma LY357 camptothecine that fermentation broth extract produces (II).
Fig. 3, the PDA solid culture (A) of dark green trichoderma LY357, SBA solid culture (B), SBA liquid seeds are cultivated (C), SBA liquid fermentation and culture (D) figure.
Fig. 4, the phylogenetic tree of dark green trichoderma LY357.
Embodiment
Below in conjunction with accompanying drawing, the preferred embodiments of the present invention are further described.
Embodiment mono-
From camplotheca acuminata, separate endogenetic fungal bacterial strain LY357.
1, test materials
1.1 vegetable materials:
Choose the camplotheca acuminata organ or tissue of normal health growth as vegetable material, as positions such as tree root, bark, fruit, leaf, branches.
Herborization material is according to routine operation segment, cleaning, sterilization.Present embodiment adopts tap water cleaning down to remove the foreign material such as dust, vegetable material is cut into 10mm × 10mm fritter with aseptic operation cutter, be successively 75% alcohol immersion 5min by concentration, 10% chlorine bleach liquor soaks 5min, 1%Triton soaks 5min, aseptic water washing 5 times, each 1min, finally absorb the surface-moisture of the each tissue site of camplotheca acuminata with aseptic filter paper, stand-by.
1.2 substratum:
5% water Solid agar culture: agar content is 5% (W/W), water preparation, does not add any nutritive ingredient.
Sabouraud's agar solid medium (SBA solid medium): peptone 10g/l, glucose 40g/l, pH5.6,121 DEG C of autoclaving 30min.
2, vegetable material inoculation culture
By ready vegetable material aseptic technique method routinely inoculation culture.
Ready camplotheca acuminata vegetable material is cut along axis, new tangent plane is inoculated on 5% water Solid agar culture, 28 DEG C ± 2 DEG C constant temperature culture 2～3 weeks; Grow after mycelia until the new tangent plane of vegetable material, picking mycelia moves on SBA substratum and continues to cultivate, 28 DEG C ± 2 DEG C constant temperature culture of condition; Finally by obtaining endogenetic fungal bacterial strain LY357 after purifying.
Bacterial strain LY357 is preserved on SBA solid slant culture base.
Embodiment bis-
Utilize camplotheca acuminata endogenetic fungal bacterial strain LY357 to obtain camptothecine.
1, substratum and extraction solvent
Substratum: Sharpe liquid nutrient medium (SBA liquid nutrient medium), component is with SBA solid medium in embodiment mono-, but do not add agar.
Extraction solvent: chloroform-methanol mixed solvent (V/V=4:1)
2, camptothecine extracting method
2.1 fermentation culture
The bacterial strain LY357 of preservation in embodiment mono-is prepared to seed liquor according to ordinary method.50ml seed liquor is inoculated in 500ml SBA liquid nutrient medium, and 28 ± 2 DEG C, shaking table 160 ± 20rpm, cultivates 8～15d, obtains fermenting mixture.
2.2 prepare fermented product extract
Fermenting mixture, through the centrifugal 15min of 4000rpm, is filtered, collect respectively filtrate and mycelium.
Gained filtrate is used equal-volume chloroform-methanol mixed extractant solvent, and organic phase obtains fermentation broth extract in 40 DEG C of concentrating under reduced pressure; Add a certain amount of extraction solvent to dissolve, filter and obtain camptothecine crude extract through syringe needle filter.
Gained mycelium is dried and is ground fragmentation, methyl alcohol soaked overnight, and equal-volume chloroform-methanol mixed extractant solvent, organic phase obtains mycelium extract in 40 DEG C of concentrating under reduced pressure; Add a certain amount of extraction solvent to dissolve, filter and obtain camptothecine crude extract through syringe needle filter.
Embodiment tri-
Utilize camplotheca acuminata endogenetic fungal bacterial strain LY357 to obtain camptothecine, itself and embodiment bis-something in common no longer repeat, and its difference is before fermentation culture, to increase seed liquor preparation process, comprises actication of culture and seed culture.
Actication of culture: by activating on the bacterial strain LY357 inoculation SBA solid medium of preservation in embodiment mono-, cultivate 5～7d, obtain activated spawn;
Seed culture: by activated bacterial classification access 50ml SBA liquid nutrient medium, 28 ± 2 DEG C, shaking table 160 ± 20rpm, cultivates 2～3d, makes seed liquor.
Test example one
The HPLC-DAD of bacterial strain LY357 fermented product detects.
Adopt HPLC-DAD to detect respectively fermentation broth extract and mycelium extract that embodiment bis-or embodiment tri-obtain.
HPLC-DAD analyzing and testing condition: Altima column C18 post (5 μ m, 250mm × 4.6mm), mobile phase A: methyl alcohol, Mobile phase B: water+0.1% formic acid, column temperature: 35 DEG C, flow velocity: 1ml/min; Sample size: 20 μ l; Detector: diode array (DAD); Detect wavelength: 254nm, 266nm, 373nm; Gradient elution program is as shown in table 2:
Table 2HPLC-DAD condition of gradient elution
| Time (min) | 0 | 12 | 30 | 39 | 45 |
| Mobile phase A % | 5 | 50 | 80 | 98 | 98 |
| Mobile phase B % | 95 | 50 | 20 | 2 | 2 |
Under these conditions, the retention time of camptothecine standard substance is: 25.39min; In endophytic bacterial controlled effect LY357 fermentation broth extract, the retention time of camptothecine is: 25.37min.Figure 1A is depicted as camptothecine standard substance (I) to scheme with the HPLC-DAD of LY357 strain fermentation liquid extract (II); Figure 1B be depicted as camptothecine standard substance (I) and dark green trichoderma LY357 fermentation broth extract (II) the ultraviolet waves spectrogram of the camptothecine of producing (II).HPLC-DAD result shows, only contains trace camptothecine in mycelium extract.
Test example two
Produce the HPLC-DAD-MS confirmation of camptothecine endophyte bacterial strain LY357.
The fermentation broth extract consistent with camptothecine standard substance retention time and ultraviolet waves spectrogram that contain of verifying through test example one carried out to LC-MS analysis, and confirming this product is camptothecine.Figure 2 shows that camptothecine standard substance (I) and the HPLC-DAD-MS of endophytic bacterial controlled effect camptothecine that LY357 produces (II) scheme.
Test example three
Produce the taxonomy qualification of camptothecine endogenetic fungal bacterial strain LY357, Morphological Identification part.
(1) solid medium culture condition morphological feature
Endophytic bacterial controlled effect LY357 is inoculated into respectively to SBA substratum, potato agar solid medium, and 28 ± 2 DEG C of cultivations, observe colonial morphology.
Bacterial strain LY357 grows rapidly on SBA substratum, the flat board of bacterium colony covering diameter 80mm in 3d, radially, and surface porosity, smooth, mycelia is white in color thread, has coconut smell (Fig. 3 A); The 5d cultivating on potato agar solid medium obviously has Sporulation as seen, is initially light green, increases gradually later, presents deep green, and gonimoblast bundle is arranged in concentric wheel line (Fig. 3 B);
(2) liquid nutrient medium culture condition morphological feature
Endophytic bacterial controlled effect LY357 is inoculated into Sharpe liquid nutrient medium, and 28 ± 2 DEG C, 160 ± 20rpm shaking table is cultivated, and observes colonial morphology.
Cultivating 1～2d has a little 1-2mm white hypha ball to occur, nutrient solution clarification; While cultivating 3～4d, mycelium pellet diameter increases to 3～4mm, nutrient solution clarification (Fig. 3 C); Cultivate 5～8d, bacterium nodule number amount increases, and white bacterium sphere diameter is 4～5mm, nutrient solution clarification (Fig. 3 D).
Test example four
Produce the taxonomy qualification of camptothecine endogenetic fungal bacterial strain LY357, molecular biology identification part.
As described in embodiment bis-or three, make bacterial strain LY357 fermented liquid, fermenting mixture, through the centrifugal 15min of 4000rpm, is filtered, collect mycelium; With sterilizing deionized water rinsing mycelium 2 times, the centrifugal supernatant liquor that goes; Carry out the extracting genome DNA of bacterial strain LY357 according to the operation instructions of fungal genomic DNA extraction agent box (E.Z.N.A.TM BacterialDNA Kit); Genomic dna quality and concentration detect with UV-1100D ultraviolet spectrophotometer (MAPADA, China), and OD260/280 is that 1.9, DNA quality is good.
Taking obtain bacterial strain LY357 genomic dna as template, ITS1:5 '-TCCGTAGGTGAACCTGCGG-3 ' is forward primer, ITS4:5 '-TCCTCCGCTTATTGATATGC-3 ' is reverse primer; PCR reaction system and reaction conditions: 25 μ l2 × Master Mix, ddH
2o20 μ l, forward, the each 2 μ l of reverse primer, DNA profiling 1 μ l; Reaction conditions is classified 94 DEG C as according to test kit, after 3min sex change, enters circulation, and loop parameter is: 94 DEG C, and 30sec; 55 DEG C, 30sec; 65 DEG C, 1min; After 35 circulations, extend again 5min in 65 DEG C, carry out pcr amplification, obtain ITS and 5.8S rRNA amplified production.
PCR product is carried out on 1% sepharose to electrophoretic separation, near 600bp, occur obvious object amplified fragments, show that success obtains ITSrDNA from the amplification of LY357 bacterial strain.Adopt sepharose to reclaim test kit (DP209, day root, China) and reclaim this object fragment of purifying; Adopt pGM-T clone test kit (day root, China), according to operation instruction, the object fragment of recovery is connected with pGM-T carrier; Connection product is transformed and enters E.coli DH5 α; Carry out blue hickie screening; Select mono-clonal and cultivate in the liquid LB substratum that is added with ammonia benzyl resistance 37 DEG C, 180rpm overnight incubation; Extract plasmid, detected through gel electrophoresis, PCR verify that correct fragment serves Hai Meiji biological medicine Science and Technology Ltd. and check order, and base sequence the results are shown in SEQ ID NO.1.
The ITS rDNA sequence of bacterial strain LY357 is applied in ncbi database (http://blast.ncbi.nlm.nih.gov/Blast) to BLAST analysis and carried out homology comparison, the high sequence similarity of sequence similarity that this bacterial strain ITS rDNA sequence and homology relatively obtain has all reached more than 99%, adjacent method phylogenetic tree construction in application MEGA4.0 software, as shown in Figure 4.Determine thus the classification position of LY357 bacterial strain, determine that endogenetic fungus LY357 is dark green trichoderma (Trichoderma atroviride LY357).
Claims (5)
1. one kind separates the endogenetic fungus LY357 obtaining from Nyssaceae plant camptotheca acuminata, belong to dark green trichoderma (Trichoderma atroviride), be preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center, preservation date on November 19th, 2012, deposit number CGMCC6858.
2. endogenetic fungus according to claim 1, is characterized in that: ITS and 5.8S rDNA fragment 608bp, and as shown in SEQ ID NO.1.
3. the dark green trichoderma LY357 of endogenetic fungus according to claim 1 is applied to the purposes of preparation camptothecine.
4. utilize the dark green trichoderma LY357 of Nyssaceae plant camptotheca acuminata endogenetic fungus described in claim 1 to obtain a method for camptothecine, comprise dark green trichoderma LY357 strain fermentation culturing step, camptothecine extraction step; It is characterized in that:
In described fermentation culture step, make dark green trichoderma LY357 bacterial strain seed liquor according to ordinary method, seed liquor is inoculated into Sharpe liquid nutrient medium, 28 ± 2 DEG C, shaking table 160 ± 20rpm, cultivates 8～15d, obtains fermenting mixture;
In described camptothecine extraction step, fermenting mixture, through the centrifugal 15min of 4000rpm, is filtered, collect respectively filtrate and mycelium; Described filtrate is through 4:1 (V/V) chloroform-methanol mixed extractant solvent, organic phase is evaporated to the dry fermentation broth extract that obtains in 40 DEG C, add 4:1 (V/V) chloroform-methanol mixed solvent to dissolve, filter and obtain camptothecine crude extract through syringe needle filter; Described mycelium grinds broken, methyl alcohol soaked overnight, equal-volume 4:1 (V/V) chloroform-methanol mixed extractant solvent, 40 DEG C of organic phases are evaporated to the dry mycelium extract that obtains, add 4:1 (V/V) chloroform-methanol to dissolve, filter and obtain camptothecine crude extract through syringe filters.
5. method according to claim 4, it is characterized in that: before dark green trichoderma LY357 strain fermentation culturing step, have dark green trichoderma LY357 bacterial strain seed liquor preparation process, described dark green trichoderma LY357 bacterial strain seed liquor preparation method is: bacterial strain LY357 is seeded to sabouraud's agar solid medium, cultivate 5～7d, obtain activated spawn; Again activated bacterial classification is seeded to Sharpe liquid nutrient medium, 28 ± 2 DEG C, shaking table 160 ± 20rpm, cultivates 2～3d, makes seed liquor.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210590518.6A CN103074236B (en) | 2012-12-31 | 2012-12-31 | Camptotheca endophytic fungi for producing camptothecin and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210590518.6A CN103074236B (en) | 2012-12-31 | 2012-12-31 | Camptotheca endophytic fungi for producing camptothecin and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103074236A CN103074236A (en) | 2013-05-01 |
| CN103074236B true CN103074236B (en) | 2014-10-08 |
Family
ID=48150935
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210590518.6A Expired - Fee Related CN103074236B (en) | 2012-12-31 | 2012-12-31 | Camptotheca endophytic fungi for producing camptothecin and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103074236B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106047715A (en) * | 2016-05-13 | 2016-10-26 | 贵州大学 | Nothapodytes pittosporoides endophyte trichoderma sp. strain and method thereof for extracting camptothecin |
| CN112195105B (en) * | 2020-10-21 | 2021-12-03 | 上海师范大学 | Aspergillus tiannasensis and application thereof |
| CN113278533B (en) * | 2021-05-27 | 2022-07-15 | 浙江中医药大学 | High-yield camptothecin endophytic strain and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102417883A (en) * | 2010-09-27 | 2012-04-18 | 中国科学院过程工程研究所 | Screening of new strain capable of producing camptothecin and method for preparing camptothecin |
-
2012
- 2012-12-31 CN CN201210590518.6A patent/CN103074236B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102417883A (en) * | 2010-09-27 | 2012-04-18 | 中国科学院过程工程研究所 | Screening of new strain capable of producing camptothecin and method for preparing camptothecin |
Non-Patent Citations (2)
| Title |
|---|
| 内生真菌产生喜树碱及其类似物的研究进展;潘学武等;《现代生物医学进展》;20100930;第10卷(第17期);3366-3368 * |
| 潘学武等.内生真菌产生喜树碱及其类似物的研究进展.《现代生物医学进展》.2010,第10卷(第17期),3366-3368. |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103074236A (en) | 2013-05-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108048334B (en) | Establishment method of symbiotic system of gloeosporium fungi for promoting germination of cymbidium and cattleya seeds | |
| CN107371812B (en) | Hericium erinaceus cultivation method taking eucalyptus wood chips as main cultivation material | |
| CN101974438B (en) | Eucalyptus endophyte and application thereof | |
| CN106399132B (en) | One plant of Irpex lacteus and its application | |
| CN111109009B (en) | Armillaria mellea SWFU-09 and application thereof | |
| US20220369648A1 (en) | Endophytic falciphora oryzae fo-r20 and its application | |
| CN103074236B (en) | Camptotheca endophytic fungi for producing camptothecin and application thereof | |
| CN113956983B (en) | Endophytic fungus of bighead atractylodes rhizome, fermentation product and application thereof | |
| CN103667072B (en) | A kind of Huperzia serrata endogenetic epiphyte and the application at preparation 8 α, 15 α-epoxidation selagine thereof | |
| CN112195105B (en) | Aspergillus tiannasensis and application thereof | |
| CN103146614B (en) | Camptotheca endophytic bacterium LY214 for producing camptothecin and application thereof | |
| CN105483020A (en) | Application of sophora tonkinensis endophytic fungus TRXY-34-1 in prevention and treatment of panax notoginseng root rot | |
| CN105462850A (en) | Application of sophora tonkinensis endophytic fungus SDTE-P in preventing and controlling panax notoginseng root rot | |
| CN108719336B (en) | Method for promoting growth of orchids by using basidiomycetes fungi | |
| Hao et al. | Isolation and identification of swainsonine-producing fungi found in locoweeds and their rhizosphere soil | |
| CN103937684B (en) | A kind of from Eucalypt soil screening press down grass fungus | |
| CN105462854A (en) | Application of sophora tonkinensis endophytic fungus SDTE-P in preventing and controlling panax notoginseng anthracnose | |
| CN106797801B (en) | Artificial culture method of cordyceps sobolifera | |
| CN101353628B (en) | Rapid identification method of Chinese caterpillar fungus fertile bacterial strain | |
| CN114292759A (en) | Fusarium oxysporum with effect of preventing and treating continuous cropping obstacle of tobacco | |
| CN105238697A (en) | Peony endophytic fungi and process for producing paeonol with peony endophytic fungi | |
| CN106416487B (en) | A kind of soil improvement method of bird king tea | |
| CN104946543A (en) | Plant rhizosphere trichoderma separation method | |
| CN112410226B (en) | Golden stropharia rugoso-annulata strain | |
| CN103250552B (en) | A kind of high yield resistance straw mushroom bacterial utilizing Banana Leaf to produce |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20141008 Termination date: 20211231 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |