CN103074236A - Camptotheca endophytic fungi for producing camptothecin and application thereof - Google Patents
Camptotheca endophytic fungi for producing camptothecin and application thereof Download PDFInfo
- Publication number
- CN103074236A CN103074236A CN2012105905186A CN201210590518A CN103074236A CN 103074236 A CN103074236 A CN 103074236A CN 2012105905186 A CN2012105905186 A CN 2012105905186A CN 201210590518 A CN201210590518 A CN 201210590518A CN 103074236 A CN103074236 A CN 103074236A
- Authority
- CN
- China
- Prior art keywords
- camptothecine
- dark green
- green trichoderma
- culture
- camptothecin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses camptotheca endophytic fungi for producing camptothecin and an application thereof in the preparation of the camptothecin. Trichoderma atroviride LY357 is the endophytic fungi separated from the organ tissue of camptotheca, the nyssaceae plant, and has been preserved in the China General Microbiological Culture Collection Center, wherein the preservation date is Nov. 19, 2012 and the preservation number is CGMCC6858. The strain employing general liquid fermentation cultural method can be applied to preparing the camptothecin, and the obtained camptothecin mainly exists in fermentation liquid extract. The method for obtaining the trichoderma atroviride LY357 separated from the camptotheca plant material is simple and easy to operate, the method for obtaining the camptothecin by fermental cultivation of the trichoderma atroviride LY357 is also simple and easy to operate, and the obtained camptothecin is high in productivity.
Description
Technical field
The present invention relates to a kind of endogenetic fungus and application thereof, particularly relate to a kind of camplotheca acuminata endogenetic fungus and in the application of preparation in the camptothecine, belong to microbial fungi and by the material technology field of its manufacturing or acquisition.
Background technology
Camptothecine (CPT) belongs to terpene indole alkaloid, is a kind of natural compounds of bringing into play anti-tumor activity by suppressing topoisomerase I, and its antitumor mechanism is unique.Camptothecine series derivates such as 10-hydroxycamptothecine, irinotecan, topotecan etc. are the high antitumor drugs of added value, and be all effective to the cancerous lesion of multiple organ-tissue, become the principal item on the antitumor drug market, the world.Camptothecine is separated acquisition by people such as Wall in 1966 from China the earliest peculiar Nyssaceae plant camptotheca acuminata (Camptotheca acuminata) bark, found in the plants such as the wooden GOUYAHUA in sea (Ervatamia heyneana), foetid nothapodytes herb (Nothapodytesfoetida) and short and small Herba ophiorrhizae japonicae (Ophiorrhizapumila) successively again afterwards.The camptothecine market requirement is large, simple demand (the world market annual camptothecine demand 3000kg that can't satisfy people by from camplotheca acuminata, extracting camptothecine, but global camptothecine annual production is 600kg only), also can cause the waste of resource and the destruction of environment simultaneously.Therefore, carry out the separation of camplotheca acuminata endogenetic fungus and the research of meta-bolites thereof, utilize microbial fermentation technology to synthesize camptothecine, improve camptothecine output and become the important channel that camptothecine is obtained.
Summary of the invention
Purpose of the present invention just provides a kind of camplotheca acuminata endogenetic fungal bacterial strain and the application method in the camptothecine preparation thereof.This bacterial strain separates from the camplotheca acuminata vegetable material and obtains, and can obtain camptothecine by fermentation culture, and output is higher.
For achieving the above object, the invention provides and obtain endogenetic fungus LY357 a kind of from the Nyssaceae plant camptotheca acuminata, the separation, belong to dark green trichoderma (Trichoderma atroviride), be preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center, preservation date on November 19th, 2012, deposit number CGMCC6858.
Separating the ITS obtain endogenetic fungus LY357 and 5.8S rDNA base sequence such as SEQ ID NO.1 from camplotheca acuminata is depicted as:
TCCGTAGGTGAACCTGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACCATACCAAACTGTTGCCTCGGCGGGGTCACGCCCCGGGTGCGTCGCAGCCCCGGAACCAGGCGCCCGCCGGAGGGACCAACCAAACTCTTTTCTGTAGTCCCCTCGCGGACGTTATTTCTTACAGCTCTGAGCAAAAATTCAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGACCTCGGGAGCCCCTAAGACGGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACAACTCGCACCGGGAGCGCGGCGCGTCCACGTCCGTAAAACACCCAACTTTCTGGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA
Sequencing result SEQ ID NO.1 submits http://blast.ncbi.nlm.nih.gov/Blast and compares, reach a conclusion according to BLAST result and combining form feature, proving conclusively this bacterial strain is dark green trichoderma, the dark green trichoderma LY357(Trichoderma of called after atroviride LY357).
A kind of method of from camplotheca acuminata, separating dark green trichoderma LY357: the camplotheca acuminata vegetable material is inoculated into 5% water Solid agar culture after according to routine operation segment, cleaning, sterilization, 28 ℃ ± 2 ℃ 2～3 weeks of constant temperature culture, treat that vegetable material grows mycelia, the picking mycelia moves to the sabouraud's agar solid medium and continues to cultivate, finally by obtaining the dark green trichoderma LY357 of endogenetic fungus behind the purifying.According to the general operation method of inoculation, cut off first before inoculation through the camplotheca acuminata vegetable material of segment, cleaning, sterilization, and new tangent plane is inoculated into 5% water Solid agar culture.
Above-mentioned dark green trichoderma LY357 adopts conventional liquid fermentation culturing method to can be applicable to prepare camptothecine.
A kind of method of utilizing dark green trichoderma LY357 to obtain camptothecine comprises dark green trichoderma LY357 strain fermentation culturing step, camptothecine extraction step; It is characterized in that: in described fermentation culture step, dark green trichoderma LY357 inoculation is arrived the sabouraud's agar liquid nutrient medium, shaking table 160 ± 20rpm, 28 ± 2 ℃, fermentation culture 8～15d obtains fermenting mixture; In described camptothecine extraction step, fermenting mixture through the centrifugal 15min of 4000rpm, is filtered, collect respectively filtrate and mycelium; Described filtrate is through chloroform-methanol (V/V=4:1) mixed extractant solvent, and organic phase is evaporated to the dried fermentation broth extract that obtains in 40 ℃; Described mycelium grinds broken, the methyl alcohol soaked overnight, and equal-volume chloroform-methanol (V/V=4:1) mixed extractant solvent, 40 ℃ of concentrating under reduced pressure of organic phase obtain mycelium extract; Fermentation broth extract or mycelium extract add chloroform-methanol (V/V=4:1) dissolving, filter through syringe filters and obtain the camptothecine crude extract.
The method of above-mentioned acquisition camptothecine needs to prepare first seed liquor according to routine operation in case of necessity, comprises actication of culture and seed culture.In the actication of culture, activation medium is the Sha Shi solid medium, 28 ± 2 ℃, and incubation time 5～7d; In the seed culture, substratum is the Sha Shi liquid nutrient medium, and 28 ± 2 ℃, shaking table 160 ± 20rpm cultivates 2～3d.
The fermentation broth extract that dark green trichoderma LY357 makes through fermentation culture or the composition analysis of mycelium extract show, camptothecine mainly is present in the fermentation broth extract, only contains the trace camptothecine in the mycelium extract.
Compared with prior art, the invention has the beneficial effects as follows: (1) separates the dark green trichoderma LY357 of the camplotheca acuminata endogenetic fungus that makes new advances from the camplotheca acuminata plant; (2) dark green trichoderma LY357 has the camptothecine of producing characteristic, can be applied to prepare camptothecine; (3) dark green trichoderma LY357 possesses higher camptothecine output (seeing Table 1) through fermentation culture; (4) dark green trichoderma LY357 separation method is simple and easy to control; (5) utilize the method for dark green trichoderma LY357 acquisition camptothecine simple and easy to control.
The dark green trichoderma LY357 of table 1 and existing comparison of producing camptothecine strain bacterium output
The dark green trichoderma LY357 of camplotheca acuminata endogenetic fungus preservation information: dark green trichoderma LY357(Trichoderma atroviride LY357) be preserved in (address: Datun Road, Chaoyang District, Beijing City, China Committee for Culture Collection of Microorganisms common micro-organisms center, Institute of Microorganism, Academia Sinica, postcode 100101), preservation date on November 19th, 2012, deposit number CGMCC6858.
Reference: endogenetic fungus produces the progress of camptothecine and analogue thereof, modern biomedical progress, 2010, Vol.10NO.17
Description of drawings
Figure 1A, the HPLC-DAD figure of camptothecine standard substance (I) and dark green trichoderma LY357 fermentation broth extract (II) is camptothecine;
Figure 1B, camptothecine standard substance (I) and dark green trichoderma LY357 fermentation broth extract (II) the ultraviolet waves spectrogram of the camptothecine of producing (II);
Fig. 2, the mass spectrum of camptothecine standard substance (I) and dark green trichoderma LY357 camptothecine that fermentation broth extract produces (II).
Fig. 3, the PDA solid culture (A) of dark green trichoderma LY357, SBA solid culture (B), SBA liquid seeds cultivate (C), SBA liquid fermentation and culture (D) figure.
Fig. 4, the phylogenetic tree of dark green trichoderma LY357.
Embodiment
Below in conjunction with accompanying drawing, the preferred embodiments of the present invention are further described.
Embodiment one
From camplotheca acuminata, separate endogenetic fungal bacterial strain LY357.
1, test materials
1.1 vegetable material:
Choose the camplotheca acuminata organ or tissue of normal health growth as vegetable material, such as positions such as tree root, bark, fruit, leaf, branches.
The herborization material is according to routine operation segment, cleaning, sterilization.Present embodiment adopts the tap water cleaning down to remove the foreign material such as dust, with the aseptic operation cutter vegetable material is cut into 10mm * 10mm fritter, be 75% alcohol immersion 5min with concentration successively, 10% chlorine bleach liquor soaks 5min, 1%Triton soaks 5min, aseptic water washing 5 times, each 1min, absorb at last the surface-moisture of each tissue site of camplotheca acuminata with aseptic filter paper, stand-by.
1.2 substratum:
5% water Solid agar culture: agar content is 5%(W/W), any nutritive ingredient is not added in the water preparation.
Sabouraud's agar solid medium (SBA solid medium): peptone 10g/l, glucose 40g/l, pH5.6,121 ℃ of autoclaving 30min.
2, vegetable material inoculation culture
With routinely aseptic technique method of ready vegetable material inoculation culture.
Ready camplotheca acuminata vegetable material is cut along axis, new tangent plane is inoculated on the 5% water Solid agar culture, 28 ℃ ± 2 ℃ 2～3 weeks of constant temperature culture; After the new tangent plane of vegetable material grew mycelia, the picking mycelia moved to and continues on the SBA substratum to cultivate 28 ℃ ± 2 ℃ constant temperature culture of condition; Finally by obtaining endogenetic fungal bacterial strain LY357 behind the purifying.
Bacterial strain LY357 is preserved on the SBA solid slant culture base.
Embodiment two
Utilize camplotheca acuminata endogenetic fungal bacterial strain LY357 to obtain camptothecine.
1, substratum and extraction solvent
Substratum: Sha Shi liquid nutrient medium (SBA liquid nutrient medium), component be with SBA solid medium among the embodiment one, but do not add agar.
Extraction solvent: chloroform-methanol mixed solvent (V/V=4:1)
2, camptothecine extracting method
2.1 fermentation culture
The bacterial strain LY357 of preservation among the embodiment one is prepared seed liquor according to ordinary method.The 50ml seed liquor is inoculated in the 500ml SBA liquid nutrient medium, and 28 ± 2 ℃, shaking table 160 ± 20rpm cultivates 8～15d, obtains fermenting mixture.
2.2 preparation fermented product extract
Fermenting mixture through the centrifugal 15min of 4000rpm, is filtered, collect respectively filtrate and mycelium.
Gained filtrate is used equal-volume chloroform-methanol mixed extractant solvent, and organic phase obtains fermentation broth extract in 40 ℃ of concentrating under reduced pressure; Add a certain amount of extraction solvent dissolving, filter through the syringe needle filter and obtain the camptothecine crude extract.
The oven dry of gained mycelium is ground broken, the methyl alcohol soaked overnight, and equal-volume chloroform-methanol mixed extractant solvent, organic phase obtains mycelium extract in 40 ℃ of concentrating under reduced pressure; Add a certain amount of extraction solvent dissolving, filter through the syringe needle filter and obtain the camptothecine crude extract.
Embodiment three
Utilize camplotheca acuminata endogenetic fungal bacterial strain LY357 to obtain camptothecine, it no longer repeats with embodiment two identical parts, and its difference is to increase the seed liquor preparation process before fermentation culture, comprises actication of culture and seed culture.
Actication of culture: activate on the bacterial strain LY357 inoculation SBA solid medium with preservation among the embodiment one, cultivate 5～7d, get activated spawn;
Seed culture: in activated bacterial classification access 50ml SBA liquid nutrient medium, 28 ± 2 ℃, shaking table 160 ± 20rpm cultivates 2～3d, makes seed liquor.
Test example one
The HPLC-DAD of bacterial strain LY357 fermented product detects.
Adopt HPLC-DAD to detect respectively fermentation broth extract and mycelium extract that embodiment two or embodiment three obtain.
HPLC-DAD analyzing and testing condition: Altima column C18 post (5 μ m, 250mm * 4.6mm), and mobile phase A: methyl alcohol, Mobile phase B: water+0.1% formic acid, column temperature: 35 ℃, flow velocity: 1ml/min; Sample size: 20 μ l; Detector: diode array (DAD); Detect wavelength: 254nm, 266nm, 373nm; The gradient elution program is as shown in table 2:
Table 2HPLC-DAD condition of gradient elution
| Time (min) | 0 | 12 | 30 | 39 | 45 |
| Mobile phase A % | 5 | 50 | 80 | 98 | 98 |
| Mobile phase B % | 95 | 50 | 20 | 2 | 2 |
[0058]Under these conditions, the retention time of camptothecine standard substance is: 25.39min; The retention time of camptothecine is in the endophytic bacterial controlled effect LY357 fermentation broth extract: 25.37min.Figure 1A is depicted as the HPLC-DAD figure of camptothecine standard substance (I) and LY357 strain fermentation liquid extract (II); Figure 1B be depicted as camptothecine standard substance (I) and dark green trichoderma LY357 fermentation broth extract (II) the ultraviolet waves spectrogram of the camptothecine of producing (II).HPLC-DAD result shows, only contains the trace camptothecine in the mycelium extract.
Test example two
Produce the HPLC-DAD-MS conclusive evidence of camptothecine endophyte bacterial strain LY357.
To carry out the LC-MS analysis through the fermentation broth extract consistent with camptothecine standard substance retention time and ultraviolet waves spectrogram that contain of test example one checking, proving conclusively this product is camptothecine.Figure 2 shows that the HPLC-DAD-MS figure of camptothecine standard substance (I) and endophytic bacterial controlled effect camptothecine that LY357 produces (II).
Test example three
Produce the taxonomy of camptothecine endogenetic fungal bacterial strain LY357 and identify the Morphological Identification part.
(1) solid medium culture condition morphological feature
Endophytic bacterial controlled effect LY357 is inoculated into respectively SBA substratum, potato agar solid medium, and colonial morphology is observed in 28 ± 2 ℃ of cultivations.
Bacterial strain LY357 is rapid in the growth of SBA substratum, the flat board of bacterium colony covering diameter 80mm in 3d, radially, and surface porosity, smooth, mycelia is white in color thread, and coconut smell (Fig. 3 A) is arranged; As seen the 5d that cultivates at the potato agar solid medium obviously has Sporulation, is initially light green, increases gradually later on, presents deep green, and the gonimoblast bundle is arranged in concentric wheel line (Fig. 3 B);
(2) liquid nutrient medium culture condition morphological feature
Endophytic bacterial controlled effect LY357 is inoculated into the Sha Shi liquid nutrient medium, and 28 ± 2 ℃, 160 ± 20rpm shaking table is cultivated, and observes colonial morphology.
Cultivating 1～2d has a little 1-2mm white hypha ball to occur, the nutrient solution clarification; The mycelium pellet diameter increases to 3～4mm when cultivating 3～4d, nutrient solution clarification (Fig. 3 C); Cultivate 5～8d, bacterium nodule number amount increases, and white bacterium sphere diameter is 4～5mm, nutrient solution clarification (Fig. 3 D).
Test example four
Produce the taxonomy of camptothecine endogenetic fungal bacterial strain LY357 and identify the molecular biology identification part.
As described in embodiment two or three, make bacterial strain LY357 fermented liquid, fermenting mixture through the centrifugal 15min of 4000rpm, is filtered, collect mycelium; With sterilization deionized water rinsing mycelium 2 times, the centrifugal supernatant liquor that goes; Carry out the extracting genome DNA of bacterial strain LY357 according to the operation instructions of fungal genomic DNA extraction agent box (E.Z.N.A.TM Bacterial DNA Kit); Genomic dna quality and concentration detect with UV-1100D ultraviolet spectrophotometer (MAPADA, China), and OD260/280 is that 1.9, DNA quality is good.
Take the bacterial strain LY357 genomic dna that obtains as template, ITS1:5 '-TCCGTAGGTGAACCTGCGG-3 ' is forward primer, and ITS4:5 '-TCCTCCGCTTATTGATATGC-3 ' is reverse primer; PCR reaction system and reaction conditions: 25 μ l2 * Master Mix, ddH
2O20 μ l, forward, each 2 μ l of reverse primer, dna profiling 1 μ l; Reaction conditions is classified 94 ℃ as according to test kit, enters circulation after the 3min sex change, and loop parameter is: 94 ℃, and 30sec; 55 ℃, 30sec; 65 ℃, 1min; Extend again 5min in 65 ℃ after 35 circulations, carry out pcr amplification, obtain ITS and 5.8S rRNA amplified production.
The PCR product is carried out electrophoretic separation at 1% sepharose, obvious purpose amplified fragments near 600bp, occurs, show successfully to obtain ITSrDNA from the amplification of LY357 bacterial strain.Adopt sepharose to reclaim test kit (DP209, day root, China) and reclaim this purpose fragment of purifying; Adopt pGM-T clone test kit (day root, China), according to operation instruction the purpose fragment that reclaims is connected with the pGM-T carrier; To connect the product conversion and enter E.coli DH5 α; Carry out blue hickie screening; Select mono-clonal and cultivate in being added with the liquid LB substratum of ammonia benzyl resistance 37 ℃, the 180rpm overnight incubation; Extract plasmid, detected through gel electrophoresis, the correct fragment of PCR checking are served Hai Meiji biological medicine Science and Technology Ltd. and are checked order, and base sequence the results are shown in SEQ ID NO.1.
The ITS rDNA sequence of bacterial strain LY357 is used the BLAST analysis carry out homology relatively in ncbi database (http://blast.ncbi.nlm.nih.gov/Blast), the sequence similarity that the sequence similarity that this bacterial strain ITS rDNA sequence and homology relatively obtain is high has all reached more than 99%, use adjacent method phylogenetic tree construction in the MEGA4.0 software, as shown in Figure 4.Determine thus the classification position of LY357 bacterial strain, determine that endogenetic fungus LY357 is dark green trichoderma (Trichoderma atroviride LY357).
Claims (7)
1. one kind is separated from the Nyssaceae plant camptotheca acuminata and obtains endogenetic fungus LY357, belongs to dark green trichoderma, has been preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center, preservation date on November 19th, 2012, deposit number CGMCC6858.
2. endogenetic fungus according to claim 1 is characterized in that: ITS and 5.8S rDNA fragment 608bp, and shown in SEQ ID NO.1.
3. endogenetic fungus according to claim 1 is applied to prepare camptothecine.
4. one kind is separated the method that obtains the dark green trichoderma LY357 of endogenetic fungus from the Nyssaceae plant camptotheca acuminata, it is characterized in that: the camplotheca acuminata vegetable material is inoculated into 5% water Solid agar culture after according to routine operation segment, cleaning, sterilization, 28 ℃ ± 2 ℃ 2～3 weeks of constant temperature culture, treat that vegetable material grows mycelia, the picking mycelia moves to the sabouraud's agar solid medium and continues to cultivate, finally by obtaining the dark green trichoderma LY357 of endogenetic fungus behind the purifying.
5. method according to claim 4, it is characterized in that: described camplotheca acuminata vegetable material is camplotheca acuminata tree root or bark or fruit or leaf or branch.
6. a method of utilizing the dark green trichoderma LY357 of Nyssaceae plant camptotheca acuminata endogenetic fungus to obtain camptothecine comprises dark green trichoderma LY357 strain fermentation culturing step, camptothecine crude extract step; It is characterized in that:
In described fermentation culture step, make dark green trichoderma LY357 bacterial strain seed liquor according to ordinary method, seed liquor is inoculated into the sabouraud's agar liquid nutrient medium, 28 ± 2 ℃, shaking table 160 ± 20rpm cultivates 8～15d, obtains fermenting mixture;
In described camptothecine extraction step, fermenting mixture through the centrifugal 15min of 4000rpm, is filtered, collect respectively filtrate and mycelium; Described filtrate is through 4:1(V/V) the chloroform-methanol mixed extractant solvent, organic phase is evaporated to the dried fermentation broth extract that obtains, adding 4:1(V/V in 40 ℃) dissolving of chloroform-methanol mixed solvent, obtain the camptothecine crude extract through the filtration of syringe needle filter; Described mycelium grinds broken, methyl alcohol soaked overnight, equal-volume 4:1(V/V) chloroform-methanol mixed extractant solvent, 40 ℃ of organic phases are evaporated to the dried mycelium extract that obtains, add 4:1(V/V) the chloroform-methanol dissolving, obtain the camptothecine crude extract through the syringe filters filtration.
7. method according to claim 6, it is characterized in that: before dark green trichoderma LY357 strain fermentation culturing step, dark green trichoderma LY357 bacterial strain seed liquor preparation process is arranged, described dark green trichoderma LY357 bacterial strain seed liquor preparation method is: bacterial strain LY357 is seeded to the sabouraud's agar solid medium, cultivate 5～7d, get activated spawn; Again with activated bacterial classification inoculation to the sabouraud's agar liquid nutrient medium, 28 ± 2 ℃, shaking table 160 ± 20rpm cultivates 2～3d, makes seed liquor.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210590518.6A CN103074236B (en) | 2012-12-31 | 2012-12-31 | Camptotheca endophytic fungi for producing camptothecin and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210590518.6A CN103074236B (en) | 2012-12-31 | 2012-12-31 | Camptotheca endophytic fungi for producing camptothecin and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103074236A true CN103074236A (en) | 2013-05-01 |
| CN103074236B CN103074236B (en) | 2014-10-08 |
Family
ID=48150935
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210590518.6A Expired - Fee Related CN103074236B (en) | 2012-12-31 | 2012-12-31 | Camptotheca endophytic fungi for producing camptothecin and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103074236B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106047715A (en) * | 2016-05-13 | 2016-10-26 | 贵州大学 | Nothapodytes pittosporoides endophyte trichoderma sp. strain and method thereof for extracting camptothecin |
| CN112195105A (en) * | 2020-10-21 | 2021-01-08 | 上海师范大学 | Aspergillus tiannasensis and application thereof |
| CN113278533A (en) * | 2021-05-27 | 2021-08-20 | 浙江中医药大学 | High-yield camptothecin endophytic strain and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102417883A (en) * | 2010-09-27 | 2012-04-18 | 中国科学院过程工程研究所 | Screening of new strain capable of producing camptothecin and method for preparing camptothecin |
-
2012
- 2012-12-31 CN CN201210590518.6A patent/CN103074236B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102417883A (en) * | 2010-09-27 | 2012-04-18 | 中国科学院过程工程研究所 | Screening of new strain capable of producing camptothecin and method for preparing camptothecin |
Non-Patent Citations (1)
| Title |
|---|
| 潘学武等: "内生真菌产生喜树碱及其类似物的研究进展", 《现代生物医学进展》, vol. 10, no. 17, 30 September 2010 (2010-09-30), pages 3366 - 3368 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106047715A (en) * | 2016-05-13 | 2016-10-26 | 贵州大学 | Nothapodytes pittosporoides endophyte trichoderma sp. strain and method thereof for extracting camptothecin |
| CN112195105A (en) * | 2020-10-21 | 2021-01-08 | 上海师范大学 | Aspergillus tiannasensis and application thereof |
| CN113278533A (en) * | 2021-05-27 | 2021-08-20 | 浙江中医药大学 | High-yield camptothecin endophytic strain and application thereof |
| CN113278533B (en) * | 2021-05-27 | 2022-07-15 | 浙江中医药大学 | High-yield camptothecin endophytic strain and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103074236B (en) | 2014-10-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101974438B (en) | Eucalyptus endophyte and application thereof | |
| CN111109009B (en) | Armillaria mellea SWFU-09 and application thereof | |
| CN106399132B (en) | One plant of Irpex lacteus and its application | |
| US20220369648A1 (en) | Endophytic falciphora oryzae fo-r20 and its application | |
| CN113481106B (en) | Deep sea source penicillium mycoides and obtained compound | |
| CN106010980B (en) | A kind of endogenetic fungus Brazil class shell roundlet spore bacterial strain and its application | |
| CN103074236B (en) | Camptotheca endophytic fungi for producing camptothecin and application thereof | |
| CN103667072B (en) | A kind of Huperzia serrata endogenetic epiphyte and the application at preparation 8 α, 15 α-epoxidation selagine thereof | |
| CN113956983B (en) | Endophytic fungus of bighead atractylodes rhizome, fermentation product and application thereof | |
| CN112195105B (en) | Aspergillus tiannasensis and application thereof | |
| CN103146614B (en) | Camptotheca endophytic bacterium LY214 for producing camptothecin and application thereof | |
| CN105462850A (en) | Application of sophora tonkinensis endophytic fungus SDTE-P in preventing and controlling panax notoginseng root rot | |
| CN105483020A (en) | Application of sophora tonkinensis endophytic fungus TRXY-34-1 in prevention and treatment of panax notoginseng root rot | |
| Sun et al. | Slippery scar: a new mushroom disease in Auricularia polytricha | |
| CN102417883A (en) | Screening of new strain capable of producing camptothecin and method for preparing camptothecin | |
| Hao et al. | Isolation and identification of swainsonine-producing fungi found in locoweeds and their rhizosphere soil | |
| CN108719336B (en) | Method for promoting growth of orchids by using basidiomycetes fungi | |
| CN115386497B (en) | Podosporium cranbergii strain, cultivation method and application thereof | |
| CN107312720B (en) | Cochinchinensis endophytic fungus for efficiently converting ginsenoside Rb1 into Rd and application thereof | |
| CN105567607B (en) | One plant of high temperature resistant garden waste decomposer ST3 and its application | |
| CN102417884B (en) | Aspergillus niger strain and application thereof in enrichment and extraction of 1-deoxynojirimycin (1-DNJ) from white mulberry root-bark | |
| CN116004392B (en) | Antrodia camphorata symbiotic fungus YAFEF009 and separation method thereof | |
| Pham et al. | Monokaryotic characteristics and mating types of phoenix mushroom (Pleurotus pulmonarius) cultivars in the South Vietnam. | |
| CN112410226B (en) | Golden stropharia rugoso-annulata strain | |
| CN114342741B (en) | Novel strain of Clostridia tubificans and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20141008 Termination date: 20211231 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |