CN103053876A - Biodegradation method of ginkgolic acid - Google Patents
Biodegradation method of ginkgolic acid Download PDFInfo
- Publication number
- CN103053876A CN103053876A CN2012105520484A CN201210552048A CN103053876A CN 103053876 A CN103053876 A CN 103053876A CN 2012105520484 A CN2012105520484 A CN 2012105520484A CN 201210552048 A CN201210552048 A CN 201210552048A CN 103053876 A CN103053876 A CN 103053876A
- Authority
- CN
- China
- Prior art keywords
- laccase
- lacc
- behind
- ginkgolic acid
- enzyme
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Enzymes And Modification Thereof (AREA)
Abstract
The invention discloses a biodegradation method of ginkgolic acid. Laccase LacC is utilized; and according to the proportion, when the ginkgolic acid with a certain concentration is contained in a degradation system, the concentration of the added Laccase LacC is 0.004 U/mL to 0.006 U/mL, the pH of the degradation system is 4.0-6.0, the degradation temperature is 45 DEG C to 60 DEG C, and the degrading treatment time lasts for 10-24 hours. When only the laccase is used for degrading the ginkgolic acid, the degradation efficiency is less than 30%; and after a mediator is added, and especially after ABTS is added, the degradation efficiency is highest to 100%.
Description
Technical field
The present invention is intended to set up a kind of method of laccase biodegradation ginkgolic acid, relates to enzyme engineering and field of food.
Background technology
The main component of ginkgo biloba p.e (EGB) is flavones and lactone compound, has the effect of anti-oxidant, antiplatelet activity factor (PAF) and the effect of antagonism PAF specific receptor.A large amount of pharmacology analysis and clinical trial confirm that ginkgo biloba p.e has significant prevention and result for the treatment of to the disease relevant with the cardiovascular and cerebrovascular circulation such as coronary heart disease, hypertension, angina pectoris, artery sclerosis, Aging, senile dementia, Senile Memory Deficits, aging.Ginkgo biloba p.e is widely used in medicine, health products, the food and cosmetics, and the state such as moral, method every year is a large amount of import ginkgo leaves of several countries (mainly being Korea S, China) from East Asia, as pharmaceutical raw material, and the sale of finished goods whole world.But ginkgolic acid is present in gingko episperm, ginkgo leaf and the ginkgo nut, and content is the highest in exosper.Its structure can regard that the salicylic acid molecule has the series compound of longer side chain in phenyl ring C6 position as, this long-chain divides alkyl and thiazolinyl two large classes, generally formed by 13-17 carbon atom, belong to cytotoxin, may with induce body sudden change and carcinogenic relevant, can cause that the allergic inflammation that skin, mucous membrane etc. are located reacts.Therefore, ginkgolic acid (Ginkgolic acids) is limit index crucial in the ginkgo biloba p.e.But in extracting ginko leaves flavone and lactone compound isoreactivity substance process, ginkgolic acid also can immersed putting forward of while.Its content is different and different with extraction process, purifying process.But ginkgolic acid severe overweight in domestic most ginkgo biloba p.e, people's health in serious harm.At present, in the world to the strict control of ginkgolic acid content in the ginkgo biloba p.e, promoted the research dynamics of people to selectively removing separating Ginkgo phenolic acids material.At present, the method for reporting mainly is to improve extraction process, reinforcement purification link.Reduce undoubtedly the yield of active material, increased preparation cost.
Laccase is a kind of polyphenol oxidase of cupric, and this enzyme ubiquity in whiterot fungi also produces in minority lower fungus and the plant, mostly is secreting type glycoprotein.Because laccase is a kind of oxidoreducing enzyme, its effect mainly is the catalytic oxidation-reduction reaction, oxidation reaction that can a lot of phenol type of catalysis compound, but because its redox potential is lower, non-phenols structural compounds but can not be degraded in direct oxidation, or not high to many phenol type degradation efficient.If under some little molecular oxidation reducing medium helped, the substrate scope of laccase effect can further enlarge, organic compound that can the non-phenol type of oxidation also can improve the degradation efficiency of phenol type compound significantly.Laccase redox mediator system (LMS) refers to that laccase carries out the process of living things catalysis in the presence of amboceptor and oxygen.Amboceptor can form active height and the intermediate of certain stability is arranged under the effect of enzyme, these reactive intermediates can pass to substrate by electron gain from oxygen molecule, thereby make degradation of substrates.Laccase/redox mediator system more and more receives concern both domestic and external as a kind of system with very large potential using value.
In view of ginkgolic acid severe overweight in domestic most ginkgo biloba p.es, people's health in serious harm.At present, the method for reporting mainly is to improve extraction process, reinforcement purification link.Not only reduced the yield of active material, increased preparation cost, and effect is obvious not, be difficult to reach in the world the limit standard to ginkgolic acid content in the ginkgo biloba p.e.And up to the present, utilize laccase or laccase mediators system that ginkgolic acid is carried out biodegradation and yet there are no the research report at home and abroad.
Summary of the invention
The technical problem that solves:
The objective of the invention is to set up a kind of method of biodegradation ginkgolic acid, be intended to some ginkgo goods are removed ginkgolic acid effectively after through the laccase degraded.
Technical scheme:
A kind of biodegradation method of ginkgolic acid utilizes laccase LacC, and the concentration of laccase LacC is 0.004U/mL-0.006U/mL in the degraded system, the pH4.0-6.0 of degraded system, and degradation temperature is 45 ℃～60 ℃, the degradation treatment time is 10～24 hours.Be added with 2 of final concentration 0.1～1mM in the degraded system, 2 '-Lian nitrogen-two (3-ethyl-benzothiazole-6-sulfonic acid) di-ammonium salts (ABTS), I-hydroxybenzotriazole (HOBT), murexide (VA) or guaiacol.
Described laccase LacC is made by following method: cultivate bolt bacterium (Trametes versicolor), culture medium is: wheat bran 20g/L, glucose 5g/L, ammonium tartrate 120mmol/L, 200mmol/L pH 5.0 citrate buffer solutions, the 1mmol/L guaiacol, 0.1mL Tween 80,0.3mmol/L Cu
2+, condition of culture is 28 ℃ and cultivates 5d; 1L has been cultivated zymotic fluid places 4 ℃ of lower centrifugal 10min collection supernatants of refrigerated centrifuge of 10000rpm to be the laccase crude enzyme liquid; Then adding final concentration in supernatant is the ammonium sulfate of 80%wt, places 4 ℃ of lower centrifugal 30min in the refrigerated centrifuge that 24h are placed on 10000rpm down at 4 ℃, and precipitation is with 20mM pH 7.5Tris-HCl buffer dissolving dialysis; The enzyme liquid that dialysis treatment is crossed carries out DEAESepharose
TMThe CL-6B ion-exchange chromatography, adopt equilibrium liquid: 20mM pH 7.5Tris-HCl buffer, elution buffer: 20mM pH 7.0Tris-HCl buffer, the concentration gradient of NaCl is 0-0.6mol/L, elution volume is 800mL, and elution speed: 1.5mL/min, every 4mL collect a pipe and detect laccase activity, detect three protein peaks by the Protein Detection instrument, that last peak is collected is laccase LacC.
Described laccase LacC also can be made by following method:
(1) cultivation of bolt bacterium (Trametes versicolor): culture medium is PDA: glucose 20g/L, and potato juice 20%wt inoculates fresh bolt bacterium mycelia, and 28 ℃ of lower 180rpm cultivate to filter in 3-4 days and collect mycelium;
(2) extraction of the total RNA of bolt bacterium: after the mycelium that gets the bolt bacterium of collection cleans with PBS cushioning liquid, under liquid nitrogen, grind mycelium to Powdered, collect in the 2mL centrifuge tube, concuss behind the adding 1mL Trizol, shift supernatant behind 4 ℃ of centrifugal 10min of lower 12000g to the 2mL centrifuge tube, add behind the 200 μ L chloroforms concussions 15s mixing and hatch 2-3min under 30 ℃, 4 ℃ of centrifugal 10min of lower 12000g get the upper strata stillness of night, 4 ℃ of centrifugal 10min of lower 12000g behind the isopropyl alcohol mixing of 0.8 times of volume of adding supernatant, remove behind the supernatant clean 2 times with the 75%wt ethanol water after 4 ℃ of centrifugal 5min of lower 7500g be precipitated, after making it natural drying, add the water-soluble solution of DEPC RNA precipitation, as template ribonucleic acid ,-20 ℃ of lower preservations;
(3) bolt bacterium cDNA's is synthetic: take the total RNA of bolt bacterium as template, utilize reverse transcription to synthesize cDNA the first chain:
Preparation following template ribonucleic acid/Primer reactant liquor in microcentrifugal tube:
50μM Oligo dT 1μL，
10mM dNTP Mixture 1μL，
Total RNA 1 μ g,
DEPC-H
2O 7μL；
Place 1min on ice behind 65 ℃ of lower insulation 5min behind the mixing;
The following cDNA synthesis reaction solution of preparation in above-mentioned microcentrifugal tube:
Above-mentioned RNA/Primer mixed liquor 10 μ L,
5×PrimeScript Buffer 4μL，
40U/μL RNase Inhibiter 0.5μL，
200U/μL PrimeScript RTase 1μL
RNase free H
2O 4.5μL;
Under 50 ℃, be incubated 1h behind the above-mentioned reactant liquor mixing, cooled on ice behind 70 ℃ of lower insulation 15min, the reactant liquor that obtains is used for synthesizing of cDNA the second chain immediately;
(4) bolt bacterium gene cloning: design LacC primer, carrier is pPICZ α B:
P9:GGG
GAATTCATGGGCAAGTTTCACTCTTTTGTGAA；
P10:GGG
TCTAGATCAGAGGTCGGACGAGTCCAAA；
The clone of gene LacC utilizes primer P9 and P10, and reaction condition is 94 ℃, 5min; Time out adds Ex Taq polymerase, adds the sealing of 40 μ L paraffin oils; 30 circulations (94 ℃, 30s; 58 ℃, 30s; 72 ℃, 90s); 72 ℃, 10min; Reaction stops, 4 ℃ of insulations; Obtain gene LacC, use EcoR I, Xba I enzyme is cut, simultaneously expression vector also with identical enzyme respectively enzyme cut, gene LacC connects respectively with carrier after enzyme is connected and spends the night, the conversion Escherichia coli obtain recombinant plasmid pPICZ alpha B-LacC;
(5) preparation of restructuring laccase LacC: after recombinant plasmid pPICZ alpha B-LacC linearisation, electricity transforms Pichia pastoris and obtains recombinant bacterium, recombinant yeast lined on the YPD flat board activate, cultivated 2 days for 28 ℃, after growing single bacterium colony, be inoculated in the 10mL BMGY fluid nutrient medium, in 30 ℃, the 200r/min shaking table is cultivated 48h, OD
600Reach the centrifugal 5min of 2 ~ 6,3000rpm and collect thalline, abandon supernatant, wash thalline 1 ~ 2 time with sterile purified water; Thalline is diluted to OD with the BMMY inducing culture
600=1, replace cotton plug with 4 layers of gauze, in 28 ℃, the 180r/min shaking table is cultivated, and adding methyl alcohol to final concentration every day is 0.6% (V/V); Place 4 ℃ of lower centrifugal 10min of refrigerated centrifuge of 10000rpm to collect supernatant cultured culture medium and be the laccase crude enzyme liquid; At first ultrafiltration apparatus is concentrated to the laccase crude enzyme liquid; Then adding final concentration in concentrate is the ammonium sulfate of 80%wt, places 4 ℃ of lower centrifugal 30min in the refrigerated centrifuge that 24h are placed on 10000rpm down at 4 ℃, and precipitation is with 20mM pH 7.0Tris-HCl buffer dissolving dialysis; The enzyme liquid that dialysis treatment is crossed carries out DEAE Sepharose
TMThe CL-6B ion-exchange chromatography, adopt equilibrium liquid: 20mM pH 7.0Tris-HCl buffer, elution buffer: contain 0.4,0.6, the 20mM pH 7.0Tris-HCl buffer of 1.0M, elution speed: 0.5mL/min, every 6min collects a pipe, detect laccase activity, laccase LacC obtains recombinating.
Described degradation temperature is 50 ℃.
Described 2, the concentration of 2 '-Lian nitrogen-two (3-ethyl-benzothiazole-6-sulfonic acid) di-ammonium salts is 0.6mM.
The degradation reaction time is 12h.
The application of laccase LacC in the degraded ginkgolic acid.
The concrete scheme content is: the method for a kind of ginkgolic acid of degrading that the present invention sets up is with laccase it to be carried out biodegradation, in order to improve degradation efficiency, adds amboceptor, consists of laccase-mediator system, the ginkgolic acid of can degrading efficiently.
PH4.5 citrate buffer solution+laccase that degraded system of the present invention is ginkgolic acid+100mM+amboceptor, altogether 5mL.50 ℃ of reaction temperatures, shaking bath rotating speed 100rmp, 12 hours reaction time.Reaction system after the degraded n-hexane extraction of 10mL, coextraction three times is drawn supernatant 1mL in small test tube at every turn, merges three extracts (3mL) and uses N
2Dry up, add the chromatogram methyl alcohol of 1mL, excessively be HPLC behind the organic filter membrane of 0.45 μ m.The condition of HPLC is: Agilent 1260, Eclipse XDB-C18 chromatographic column (4.6 * 250mm, 5 μ m), mobile phase is V(methyl alcohol): the V(3% glacial acetic acid)=92:8, column temperature is 40 ℃, the detection wavelength is 310nm, flow velocity is 1.5mL/min, sample size 20 μ L, running time 10min.
The assay method of laccase activity of the present invention is: measure with ultraviolet specrophotometer, the detection wavelength is 420nm, buffer solution is the citrate buffer solution of the pH4.5 of 100mM, reaction system is: 1980 μ L buffer solutions+1mL1mMABTS+20 μ L laccase, the preheating 5min in 50 ℃ of water-baths of elder generation after buffer solution and ABTS add, timing 3min(comprises the enzyme-added rear 30s that vibrates behind the enzyme-added liquid in water-bath), per minute is write down the A value, and computing formula is: laccase activity (U/L)={ [(A
3-A
1)/2] * 5000/12} * extension rate.
Beneficial effect: simple degrades to ginkgolic acid with laccase, and its degradation efficiency is less than 30%, add the amboceptor material after, particularly add ABTS after, its degradation efficiency reaches as high as 100%.
Description of drawings
Fig. 1 is the result of different restructuring Isozymes of Laccase degraded ginkgolic acids;
Fig. 2 is for adding different little molecule amboceptors to laccase LacC degraded ginkgol effect of acid;
Fig. 3 is that different ABTS concentration is to laccase LacC degraded ginkgol effect of acid;
Fig. 4 is that different enzyme dosage is to laccase LacC degraded ginkgol effect of acid;
Fig. 5 is that different pH values are to laccase LacC degraded ginkgol effect of acid;
Fig. 6 is that temperature is to laccase LacC degraded ginkgol effect of acid.
The specific embodiment
The present invention is described in more detail below in conjunction with specific embodiment, and listed embodiment only is the present invention is described and does not limit the present invention.
The preparation of embodiment 1 laccase
1.1 the preparation of Coriolus Versicolor (Coriolus versicolor) restructuring laccase Lcc1 and Lcc2
1.1.1 the cultivation of Coriolus Versicolor (Coriolus versicolor)
Coriolus Versicolor (Coriolus versicolor, this microorganism can obtain from the occurring in nature screening, also can buy from commercial channels and obtain (for example can available from Chinese industrial microorganism fungus kind preservation administrative center)) culture medium be PDA: glucose 20g/L, potato juice 20%wt, inoculate fresh Coriolus Versicolor mycelia, 28 ℃ of lower 180rpm cultivate to filter in 3-4 days and collect mycelium.
1.1.2 the extraction of the total RNA of Coriolus Versicolor (Coriolus versicolor)
After the mycelium that gets the Coriolus Versicolor (Coriolus versicolor) of collection cleans once with PBS cushioning liquid, under liquid nitrogen, grind mycelium to Powdered, collect in the 2mL centrifuge tube, concuss behind the adding 1mL Trizol, shift supernatant behind 4 ℃ of centrifugal 10min of lower 12000g to the 2mL centrifuge tube, add behind the 200 μ L chloroforms concussions 15s mixing and hatch 2-3min under 30 ℃, 4 ℃ of centrifugal 10min of lower 12000g get the upper strata stillness of night, 4 ℃ of centrifugal 10min of lower 12000g behind the isopropyl alcohol mixing of 0.8 times of volume of adding supernatant, (DEPC processed with the 75%wt ethanol water after removing supernatant, removed the mRNA enzyme) clean 2 times after 4 ℃ of centrifugal 5min of lower 7500g be precipitated, after making it natural drying, add the water-soluble solution of DEPC RNA precipitation, as template ribonucleic acid ,-20 ℃ of lower preservations.
1.1.3 Coriolus Versicolor (Coriolus versicolor) cDNA's is synthetic
Take the total RNA of Coriolus Versicolor (Coriolus versicolor) as template, utilize reverse transcription to synthesize cDNA the first chain (following each reverse transcription agents useful for same all comes from kit " PrimeScriptTM1stStrand cDNA Synthesis Kit ", available from Takara company).
Preparation following template ribonucleic acid/Primer reactant liquor in microcentrifugal tube:
50μM Oligo dT 1μL，
10mM dNTP Mixture 1μL，
Total RNA 1 μ g,
DEPC-H
2O 7μL；
Place 1min on ice behind 65 ℃ of lower insulation 5min behind the mixing
The following cDNA synthesis reaction solution of preparation in above-mentioned microcentrifugal tube:
Above-mentioned RNA/Primer mixed liquor 10 μ L,
5×PrimeScript Buffer 4μL，
40U/μL RNase Inhibiter 0.5μL，
200U/μL PrimeScript RTase 1μL
RNase free H
2O 4.5μL;
Under 50 ℃, be incubated 1h behind the above-mentioned reactant liquor mixing, cooled on ice behind 70 ℃ of lower insulation 15min, the reactant liquor that obtains is used for synthesizing of cDNA the second chain immediately.
1.1.4 Coriolus Versicolor (Coriolus versicolor) gene cloning
Coriolus Versicolor (Coriolus versicolor) the laccase gene sequence (Lcc1:HM137002 and Lcc2:D84235) of announcing according to NCBI designs respectively primer:
P1:GC
GGAATTCGCTATCGGGCCTGTGACC, underscore represent EcoR I site;
P2:GGG
TCTAGATTAGAGGTCGGATGAGTC, underscore represent Xba I site;
P3:CCC
ATCGATAGCCATTGGGCCCGTC, underscore represent Cla I site;
P4:CCC
TCTAGATCAGAGGTCGGACGAG, underscore represent Xba I site.
The clone of gene Lcc1 utilizes primer P1 and P2, and the clone of gene Lcc2 utilizes primer P3 and P4.Reaction condition is 94 ℃, 5min; Time out adds Ex Taq polymerase, adds the sealing of 40 μ L paraffin oils; 35 circulations (94 ℃, 50s; 55 ℃, 90s; 72 ℃, 80s); 72 ℃, 10min; Reaction stops, 4 ℃ of insulations.Obtain gene Lcc1 and Lcc2, use respectively EcoR I, XbaI and Cla I and Xba I enzyme are cut, simultaneously expression vector pPICZ α A also with identical enzyme respectively enzyme cut, gene Lcc1, Lcc2 connects respectively with carrier pPICZ α A after enzyme is connected and spends the night, and transforms Escherichia coli, obtains recombinant plasmid pPICZ alpha A-Lcc1 and pPICZ α A-Lcc2.
1.1.5 the preparation of restructuring laccase
After recombinant plasmid pPICZ alpha A-Lcc1 linearisation, electricity transforms Pichia pastoris and obtains recombinant bacterium, recombinant yeast is lined on the YPD flat board activate, cultivated 2 days, and after growing single bacterium colony, be inoculated in the 10mL BMGY fluid nutrient medium, in 30 ℃ for 28 ℃, the 200r/min shaking table is cultivated 48h, OD
600Reach the centrifugal 5min of 2 ~ 6,3000rpm and collect thalline, abandon supernatant, wash thalline 1 ~ 2 time with sterile purified water.Thalline is diluted to OD with the BMMY inducing culture
600=1, replace cotton plug with 4 layers of gauze, in 28 ℃, the 180r/min shaking table is cultivated, and adding methyl alcohol to final concentration every day is 0.6% (V/V).
The culture medium that to cultivate (being cultured to the 13rd day for best) places 4 ℃ of lower centrifugal 10min of refrigerated centrifuge of 10000rpm to collect supernatant and is the laccase crude enzyme liquid.At first ultrafiltration apparatus is concentrated to the laccase crude enzyme liquid; Then adding final concentration in concentrate is the ammonium sulfate of 80%wt, places 4 ℃ of lower centrifugal 30min in the refrigerated centrifuge that 24h are placed on 10000rpm down at 4 ℃, and precipitation is with 20mM Tris-HCl buffer(pH 7.0) the dissolving dialysis; The enzyme liquid that dialysis treatment is crossed carries out DEAE Sepharose
TMThe CL-6B ion-exchange chromatography, adopt equilibrium liquid: 20mM Tris-HCl buffer(pH 7.0), elution buffer: contain 0.4,0.6, the 20mM Tris-HCl buffer(pH 7.0 of 1.0M), elution speed: 0.5mL/min, every 6min collects a pipe, detect laccase activity, laccase Lcc1 obtains recombinating.
With above-mentioned same method, laccase Lcc2 obtains recombinating.
1.2 prepare laccase LacA and LacB and LacC with the direct cultivation and fermentation of original bacterium bolt bacterium (Trametes versicolor)
Cultivate bolt bacterium (Trametes versicolor), culture medium is: wheat bran 20g/L, glucose 5g/L, ammonium tartrate 120mmol/L, citrate buffer solution (200mmol/L, pH 5.0), 1mmol/L guaiacol, 0.1mL Tween 80,0.3mmol/L Cu
2+, condition of culture is 28 ℃ and cultivates 5d.To cultivate zymotic fluid (1L) places 4 ℃ of lower centrifugal 10min collection supernatants of refrigerated centrifuge of 10000rpm to be the laccase crude enzyme liquid.Then adding final concentration in supernatant is the ammonium sulfate of 80%wt, places 4 ℃ of lower centrifugal 30min in the refrigerated centrifuge that 24h are placed on 10000rpm down at 4 ℃, and precipitation is with 20mMTris-HCl buffer(pH 7.5) the dissolving dialysis; The enzyme liquid that dialysis treatment is crossed carries out DEAE Sepharose
TMThe CL-6B ion-exchange chromatography, adopt equilibrium liquid: 20mM Tris-HCl buffer(pH 7.5), elution buffer: 20mM Tris-HCl buffer(pH 7.0), the concentration gradient of NaCl is 0-0.6mol/L, and elution volume is 800mL, elution speed: 1.5mL/min, every 4mL collects a pipe and detects laccase activity, detect three protein peak figure by the Protein Detection instrument, collect respectively three kinds of laccases, and called after laccase LacA and LacB and LacC.
1.3 the preparation of bolt bacterium Trametes versicolor restructuring laccase LacA, LacB and LacC
1.3.1 the cultivation of bolt bacterium Trametes versicolor
This microorganism of bolt bacterium Trametes versicolor can screen from occurring in nature, mutagenic obtained, also can buy from commercial channels and obtain (for example can available from Chinese industrial microorganism fungus kind preservation administrative center), the same 1.1.1 of cultural method.
1.3.2 the extraction of the total RNA of bolt bacterium Trametes versicolor
The same 1.1.2 of method.
1d3.3 bolt bacterium Trametes versicolor cDNA's is synthetic
The same 1.1.3 of method.
1.3.4 bolt bacterium Trametes versicolor gene cloning
Bolt bacterium Trametes versicolor laccase gene sequence (LccA:AB212732 according to the NCBI announcement; LccB:AB212722; LccC:AB212734) design respectively primer:
LacA primer: (carrier pPICZ α B)
P5:GGG
GAATTCATGGGTCTGCAGCGATT; Underscore represents EcoR I site
P6:GGG
TCTAGATCACTGGTTAGCCTCGCTCA; Underscore represents Xba I site
LacB primer: (carrier pPICZ α C)
P7:GGG
GAATTCATGGGCAGGGTCTCATCTCTCTG；
P8:GGG
TCTAGATTAGAGGTCGGATGAGTCAAGAGCG；
LacC primer: (carrier pPICZ α B)
P9:GGG
GAATTCATGGGCAAGTTTCACTCTTTTGTGAA；
P10:GGG
TCTAGATCAGAGGTCGGACGAGTCCAAA；
Reaction condition is 94 ℃, 5min; Time out adds Ex Taq polymerase, adds the sealing of 40 μ L paraffin oils; 30 circulations (94 ℃, 30s; 58 ℃, 30s; 72 ℃, 90s); 72 ℃, 10min; Reaction stops, 4 ℃ of insulations.Obtain gene LacA, LacB and LacC, all use EcoR I, Xba I enzyme is cut, simultaneously expression vector also with identical enzyme respectively enzyme cut, gene LacA, LacB and LacC connect respectively with carrier after enzyme is connected and spend the night, transform Escherichia coli, obtain recombinant plasmid pPICZ alpha B-LacA, pPICZ α C-LacB and pPICZ α B-LacC.
1.3.5 the preparation of restructuring laccase LacA, LacB and LacC
The same 1.1.5 of method, the pure enzyme of obtain recombinating laccase LacA, LacB and LacC.
The result of embodiment 2 different restructuring Isozymes of Laccase degraded ginkgolic acids
As substrate, in containing the reaction system of this substrate, add respectively five kinds of laccases to 0.5U/mL with the 0.02%wt ginkgolic acid; Regulate pH to 4.5 with citrate buffer solution, the control temperature is at 50 ℃; In shaking bath to detect the residual quantity of ginkgolic acid behind the reaction 12h under the rotating speed of 100rpm.
The detection method of ginkgolic acid is as follows: at first to the reaction system of 5mL, the n-hexane that adds 2 times of volumes carries out liquid-liquid extraction, each sample extraction three times, to guarantee that the ginkgolic acid in the reaction system extracts fully, leave standstill 30min and get respectively upper strata hexane solution 1mL after the complete layering of solution, Nitrogen evaporator dries up rear with 1mL methyl alcohol dissolution process sample.Ginkgolic acid residual quantity in the above-mentioned reaction system is carried out analyzing and testing with HPLC.Liquid chromatograph is Agilent 1260, and Eclipse XDB-C18 chromatographic column (4.6 * 250mm, 5 μ m), mobile phase is V(methyl alcohol): the V(3% glacial acetic acid))=92:8, flow velocity is 1.5mL/min, sample size 20 μ L, running time 10min.
The computing formula of ginkgolic acid degradation rate of the present invention is:
Degradation rate (%)=[(initial concentration-residual concentration)/initial concentration] * 100%.
Concrete outcome has carried out behind the 12h five kinds of laccase LacA, LacB, LacC, Lcc1 and Lcc2 in reaction the degradation rate of ginkgolic acid has been respectively 15.5%, 8.7%, 27.0%, 11.7%, 4.1% as shown in Figure 1.Show that these five kinds of laccases of independent usefulness degrade to ginkgolic acid, degradation effect is laccase LacC relatively preferably.
As substrate, in containing the reaction system of this substrate, add laccase LacC to 0.5U/mL with the 0.02%wt ginkgolic acid, add respectively small molecular mediator ABTS, guaiacol, HOBT and VA to 1mM; Regulate pH to 4.5 with citrate buffer solution, the control temperature is at 50 ℃; In shaking bath to detect the residual quantity of ginkgolic acid behind the reaction 12h under the rotating speed of 100rpm.Concrete outcome as shown in Figure 2, the laccase that has carried out adding behind the 12h ABTS, guaiacol, HOBT and VA in reaction is respectively 100%, 86.6%, 54.4%, 57.7% to the degradation rate of ginkgolic acid.Show to add that the degradation effect of ginkgolic acid significantly improves behind the small molecular mediator, the degradation effect that adds ABTS is best, reaches 100%, secondly is guaiacol, and HOBT and VA's is relative low.
With the 0.02%wt ginkgolic acid as substrate, adopt the citric acid-sodium citrate buffer solution of pH 4.5, add ABTS to concentration be 0.2mM, add respectively laccase LacC to concentration be 0.002U/mL, 0.004U/mL, 0.006U/mL, 0.008U/mL, 0.01U/mL, 0.025U/mL, 0.05U/mL, 0.075U/mL, 0.1U/mL, 0.125U/mL, the control temperature is at 50 ℃, in shaking bath to detect the residual quantity of ginkgolic acid behind the reaction 12h under the rotating speed of 100rpm.Specifically result of the test as shown in Figure 3: the degradation rate corresponding to enzyme amount that can get above-mentioned concentration is respectively 49.4%, 58.1%, 63.4%, 63.5%, 64.5%, 64.0%, 61.3%, 59.2%, 59.9%, 57.7%.Enzyme dosage is more suitable at 0.004U/mL-0.006U/mL.
With the 0.02%wt ginkgolic acid as substrate, add ABTS to concentration be 0.2mM, adding laccase to concentration is 0.01U/mL, with the pH of citrate buffer solution conditioned reaction system respectively to 3.0,4.0,4.5,5.0,5.5,6.0, the control temperature is at 50 ℃, in shaking bath to detect the residual quantity of ginkgolic acid behind the reaction 12h under the rotating speed of 100rpm.Specifically result of the test as shown in Figure 4: reaction has good degradation effect at pH4.0-6.0.
With the 0.02%wt ginkgolic acid as substrate, adopt the citric acid-sodium citrate buffer solution of pH 4.5, add ABTS to concentration be 0.2mM, adding laccase to concentration is 0.01U/mL, the control temperature is respectively 30 ℃, 35 ℃, 40 ℃, 45 ℃, 50 ℃, 55 ℃, 60 ℃, in shaking bath to detect the concentration of ginkgolic acid behind the reaction 12h under the rotating speed of 100rpm.Specifically result of the test as shown in Figure 5: laccase has preferably degradation effect to ginkgolic acid under 45 ℃～60 ℃ condition, wherein the degradation efficiency of ginkgolic acid is best under 50 ℃ of conditions.
Embodiment 7 studies different ABTS concentration to laccase LacC degraded ginkgol effect of acid
With the 0.02%wt ginkgolic acid as substrate, adopt the citric acid-sodium citrate buffer solution of pH 4.5, add laccase LacC to concentration be 0.5U/mL, add respectively ABTS to concentration be 0.1,0.2,0.3,0.4,0.5,0.6mM, the control temperature is at 50 ℃, in shaking bath to detect the residual quantity of ginkgolic acid behind the reaction 12h under the rotating speed of 100rpm.Specifically result of the test as shown in Figure 6: the degradation rate of ginkgolic acid was respectively 55.3%, 58.7%, 73.2%, 88.1%, 96.8%, 99.7% when the concentration of ABTS was 0.1～0.6mM, as seen along with the increase of amboceptor ABTS concentration, the ginkgolic acid degradation rate increases thereupon, just has the degraded of being close to fully during 0.6mM.
SEQUENCE LISTING
＜110〉Nanjing Forestry University
＜120〉a kind of biodegradation method of ginkgolic acid
<130>
<160> 10
<170> PatentIn version 3.3
<210> 1
<211> 27
<212> DNA
＜213〉artificial sequence
<400> 1
gcggaattcg ctatcgggcc tgtgacc 27
<210> 2
<211> 27
<212> DNA
＜213〉artificial sequence
<400> 2
gggtctagat tagaggtcgg atgagtc 27
<210> 3
<211> 25
<212> DNA
＜213〉artificial sequence
<400> 3
cccatcgata gccattgggc ccgtc 25
<210> 4
<211> 25
<212> DNA
＜213〉artificial sequence
<400> 4
ccctctagat cagaggtcgg acgag 25
<210> 5
<211> 26
<212> DNA
＜213〉artificial sequence
<400> 5
ggggaattca tgggtctgca gcgatt 26
<210> 6
<211> 29
<212> DNA
＜213〉artificial sequence
<400> 6
gggtctagat cactggttag cctcgctca 29
<210> 7
<211> 32
<212> DNA
＜213〉artificial sequence
<400> 7
ggggaattca tgggcagggt ctcatctctc tg 32
<210> 8
<211> 34
<212> DNA
＜213〉artificial sequence
<400> 8
gggtctagat tagaggtcgg atgagtcaag agcg 34
<210> 9
<211> 35
<212> DNA
＜213〉artificial sequence
<400> 9
ggggaattca tgggcaagtt tcactctttt gtgaa 35
<210> 10
<211> 31
<212> DNA
＜213〉artificial sequence
<400> 10
gggtctagat cagaggtcgg acgagtccaa a 31
Claims (8)
1. the biodegradation method of a ginkgolic acid, it is characterized in that utilizing laccase LacC, the concentration of laccase LacC is 0.004U/mL-0.006U/mL in the degraded system, the pH4.0-6.0 of degraded system, degradation temperature is 45 ℃～60 ℃, and the degradation treatment time is 10～24 hours.
2. the biodegradation method of ginkgolic acid according to claim 1, it is characterized in that being added with in the degraded system 2 of final concentration 0.1～1mM, 2 '-Lian nitrogen-two (3-ethyl-benzothiazole-6-sulfonic acid) di-ammonium salts (ABTS), I-hydroxybenzotriazole (HOBT), murexide (VA) or guaiacol.
3. the biodegradation method of ginkgolic acid according to claim 1, it is characterized in that described laccase LacC is made by following method: cultivate bolt bacterium (Trametes versicolor), culture medium is: wheat bran 20g/L, glucose 5g/L, ammonium tartrate 120mmol/L, 200mmol/L pH 5.0 citrate buffer solutions, 1mmol/L guaiacol, 0.1mL Tween 80,0.3mmol/LCu
2+, condition of culture is 28 ℃ and cultivates 5d; 1L has been cultivated zymotic fluid places 4 ℃ of lower centrifugal 10min collection supernatants of refrigerated centrifuge of 10000rpm to be the laccase crude enzyme liquid; Then adding final concentration in supernatant is the ammonium sulfate of 80%wt, places 4 ℃ of lower centrifugal 30min in the refrigerated centrifuge that 24h are placed on 10000rpm down at 4 ℃, and precipitation is with 20mM pH 7.5Tris-HCl buffer dissolving dialysis; The enzyme liquid that dialysis treatment is crossed carries out DEAE Sepharose
TMThe CL-6B ion-exchange chromatography, adopt equilibrium liquid: 20mM pH 7.5Tris-HCl buffer, elution buffer: 20mM pH 7.0Tris-HCl buffer, the concentration gradient of NaCl is 0-0.6mol/L, elution volume is 800mL, and elution speed: 1.5mL/min, every 4mL collect a pipe and detect laccase activity, detect three protein peaks by the Protein Detection instrument, that last peak is collected is laccase LacC.
4. the biodegradation method of ginkgolic acid according to claim 1 is characterized in that described laccase LacC also can be made by following method:
(1) cultivation of bolt bacterium (Trametes versicolor): culture medium is PDA: glucose 20g/L, and potato juice 20%wt inoculates fresh bolt bacterium mycelia, and 28 ℃ of lower 180rpm cultivate to filter in 3-4 days and collect mycelium;
(2) extraction of the total RNA of bolt bacterium: after the mycelium that gets the bolt bacterium of collection cleans with PBS cushioning liquid, under liquid nitrogen, grind mycelium to Powdered, collect in the 2mL centrifuge tube, concuss behind the adding 1mL Trizol, shift supernatant behind 4 ℃ of centrifugal 10min of lower 12000g to the 2mL centrifuge tube, add behind the 200 μ L chloroforms concussions 15s mixing and hatch 2-3min under 30 ℃, 4 ℃ of centrifugal 10min of lower 12000g get the upper strata stillness of night, 4 ℃ of centrifugal 10min of lower 12000g behind the isopropyl alcohol mixing of 0.8 times of volume of adding supernatant, remove behind the supernatant clean 2 times with the 75%wt ethanol water after 4 ℃ of centrifugal 5min of lower 7500g be precipitated, after making it natural drying, add the water-soluble solution of DEPC RNA precipitation, as template ribonucleic acid ,-20 ℃ of lower preservations;
(3) bolt bacterium cDNA's is synthetic: take the total RNA of bolt bacterium as template, utilize reverse transcription to synthesize cDNA the first chain:
Preparation following template ribonucleic acid/Primer reactant liquor in microcentrifugal tube:
50μM Oligo dT 1μL，
10mM dNTP Mixture 1μL，
Total RNA 1 μ g,
DEPC-H
2O 7μL；
Place 1min on ice behind 65 ℃ of lower insulation 5min behind the mixing;
The following cDNA synthesis reaction solution of preparation in above-mentioned microcentrifugal tube:
Above-mentioned RNA/Primer mixed liquor 10 μ L,
5×PrimeScript Buffer 4μL，
40U/μL RNase Inhibiter 0.5μL，
200U/μL PrimeScript RTase 1μL
RNase free H
2O 4.5μL;
Under 50 ℃, be incubated 1h behind the above-mentioned reactant liquor mixing, cooled on ice behind 70 ℃ of lower insulation 15min, the reactant liquor that obtains is used for synthesizing of cDNA the second chain immediately;
(4) bolt bacterium gene cloning: design LacC primer, carrier is pPICZ α B:
P9:GGG
GAATTCATGGGCAAGTTTCACTCTTTTGTGAA；
P10:GGG
TCTAGATCAGAGGTCGGACGAGTCCAAA；
The clone of gene LacC utilizes primer P9 and P10, and reaction condition is 94 ℃, 5min; Time out adds Ex Taq polymerase, adds the sealing of 40 μ L paraffin oils; 30 circulations (94 ℃, 30s; 58 ℃, 30s; 72 ℃, 90s); 72 ℃, 10min; Reaction stops, 4 ℃ of insulations; Obtain gene LacC, use EcoR I, XbaI enzyme cutting, simultaneously expression vector also with identical enzyme respectively enzyme cut, gene LacC connects respectively with carrier after enzyme is connected and spends the night, the conversion Escherichia coli obtain recombinant plasmid pPICZ alpha B-LacC;
(5) preparation of restructuring laccase LacC: after recombinant plasmid pPICZ alpha B-LacC linearisation, electricity transforms Pichia pastoris and obtains recombinant bacterium, recombinant yeast lined on the YPD flat board activate, cultivated 2 days for 28 ℃, after growing single bacterium colony, be inoculated in the 10mL BMGY fluid nutrient medium, in 30 ℃, the 200r/min shaking table is cultivated 48h, OD
600Reach the centrifugal 5min of 2 ~ 6,3000rpm and collect thalline, abandon supernatant, wash thalline 1 ~ 2 time with sterile purified water; Thalline is diluted to OD with the BMMY inducing culture
600=1, replace cotton plug with 4 layers of gauze, in 28 ℃, the 180r/min shaking table is cultivated, and adding methyl alcohol to final concentration every day is 0.6% (V/V); Place 4 ℃ of lower centrifugal 10min of refrigerated centrifuge of 10000rpm to collect supernatant cultured culture medium and be the laccase crude enzyme liquid; At first ultrafiltration apparatus is concentrated to the laccase crude enzyme liquid; Then adding final concentration in concentrate is the ammonium sulfate of 80%wt, places 4 ℃ of lower centrifugal 30min in the refrigerated centrifuge that 24h are placed on 10000rpm down at 4 ℃, and precipitation is with 20mM pH 7.0Tris-HCl buffer dissolving dialysis; The enzyme liquid that dialysis treatment is crossed carries out DEAE Sepharose
TMThe CL-6B ion-exchange chromatography, adopt equilibrium liquid: 20mM pH 7.0Tris-HCl buffer, elution buffer: contain 0.4,0.6, the 20mM pH 7.0Tris-HCl buffer of 1.0M, elution speed: 0.5mL/min, every 6min collects a pipe, detect laccase activity, laccase LacC obtains recombinating.
5. the biodegradation method of ginkgolic acid according to claim 1 is characterized in that described degradation temperature is 50 ℃.
6. the biodegradation method of ginkgolic acid according to claim 1 is characterized in that describedly 2, and the concentration of 2 '-Lian nitrogen-two (3-ethyl-benzothiazole-6-sulfonic acid) di-ammonium salts is 0.6mM.
7. the biodegradation method of ginkgolic acid according to claim 1 is characterized in that the described degradation reaction time is 12h.
8. the application of laccase LacC in the degraded ginkgolic acid.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210552048.4A CN103053876B (en) | 2012-12-17 | 2012-12-17 | Biodegradation method of ginkgolic acid |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210552048.4A CN103053876B (en) | 2012-12-17 | 2012-12-17 | Biodegradation method of ginkgolic acid |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103053876A true CN103053876A (en) | 2013-04-24 |
| CN103053876B CN103053876B (en) | 2014-11-05 |
Family
ID=48097022
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210552048.4A Active CN103053876B (en) | 2012-12-17 | 2012-12-17 | Biodegradation method of ginkgolic acid |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103053876B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103960555A (en) * | 2014-04-11 | 2014-08-06 | 天津科技大学 | Method for removing ginkgolic acid in gingko biloba seeds |
| CN104770624A (en) * | 2015-02-02 | 2015-07-15 | 天津科技大学 | Application of salicylate decarboxylase in degradation of ginkgoic acid |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1374300A (en) * | 2002-03-26 | 2002-10-16 | 贵州省生化工程中心 | Resin process of eliminating ginkgolic acid from gingko leaf extractive |
| CN101280277A (en) * | 2008-04-14 | 2008-10-08 | 山东大学 | Trametes gallica, culture method and application thereof |
| CN102329008A (en) * | 2011-08-26 | 2012-01-25 | 湖南大学 | Method for removing phenol pollutants in water body by using immobilized laccase based on magnetic mesoporous carbon |
-
2012
- 2012-12-17 CN CN201210552048.4A patent/CN103053876B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1374300A (en) * | 2002-03-26 | 2002-10-16 | 贵州省生化工程中心 | Resin process of eliminating ginkgolic acid from gingko leaf extractive |
| CN101280277A (en) * | 2008-04-14 | 2008-10-08 | 山东大学 | Trametes gallica, culture method and application thereof |
| CN102329008A (en) * | 2011-08-26 | 2012-01-25 | 湖南大学 | Method for removing phenol pollutants in water body by using immobilized laccase based on magnetic mesoporous carbon |
Non-Patent Citations (4)
| Title |
|---|
| 关艳丽等: "毛栓菌漆酶的分离纯化及酶学性质研究", 《微生物学杂志》 * |
| 周宏敏等: "栓菌漆酶在毕赤酵母高效表达及重组酶的性质", 《生物工程学报》 * |
| 王宜磊: "毛栓菌漆酶诱导及部分特性研究", 《生物技术》 * |
| 王宜磊等: "漆酶高产菌株的筛选及产酶条件研究", 《生态学杂志》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103960555A (en) * | 2014-04-11 | 2014-08-06 | 天津科技大学 | Method for removing ginkgolic acid in gingko biloba seeds |
| CN104770624A (en) * | 2015-02-02 | 2015-07-15 | 天津科技大学 | Application of salicylate decarboxylase in degradation of ginkgoic acid |
| CN104770624B (en) * | 2015-02-02 | 2017-12-12 | 天津科技大学 | A kind of application of bigcatkin willow acid decarboxylase degraded ginkgoic acid |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103053876B (en) | 2014-11-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Hatvani et al. | Production of laccase and manganese peroxidase by Lentinus edodes on malt-containing by-product of the brewing process | |
| Bertrand et al. | Fungal laccases: induction and production | |
| Rodríguez-Durán et al. | Novel strategies for upstream and downstream processing of tannin acyl hydrolase | |
| Khoufi et al. | Enzymatic hydrolysis of olive wastewater for hydroxytyrosol enrichment | |
| Maitan-Alfenas et al. | Hydrolysis of soybean isoflavones by Debaryomyces hansenii UFV-1 immobilised cells and free β-glucosidase | |
| CN103053876B (en) | Biodegradation method of ginkgolic acid | |
| CN102977172B (en) | A kind of method extracting cordycepin | |
| Dhiman et al. | Fungal tannase: recent advances and industrial applications | |
| Huang et al. | Optimization of ellagic acid production from ellagitannins by co-culture and correlation between its yield and activities of relevant enzymes | |
| CN101830881B (en) | Enzyme-induced method for efficiently extracting toxifolin from larch processing leftover | |
| CN101654677A (en) | Gene for highly expressing nuclease P1 and its application | |
| CN102786411B (en) | Fungal laccase inducted active compound, fermentation preparation method and application | |
| CN102286565B (en) | Preparation method of theaflavin monomer | |
| CN103834695B (en) | A kind of fungal laccase induced activity compound and fermentation preparation and application | |
| Shashidhar et al. | Antioxidant and cholesterol esterase inhibitory properties of supplementation with coconut water in submerged cultivation of the medicinal Chinese caterpillar mushroom, Ophiocordyceps sinensis CS1197 (Ascomycetes) | |
| JP5503631B2 (en) | Method for producing antioxidant | |
| CN108795773A (en) | Moschus trichoderma strain and its fragrance of preparation | |
| CN108117558A (en) | The method that Taide promise A and Taide promise B is split from fermented tea | |
| KR102111969B1 (en) | A method for acquiring quercetin from extract of Morus alba L by treating viscozyme L | |
| Wagh | Bioconversion of tannic acid to gallic acid by using fungal tannase | |
| CN102212570B (en) | Method for catalytically synthesizing vitamin C conjugated linoleate with yeast display lipase | |
| CN102212572B (en) | Method for catalytically synthesizing L-ascorbyl oleate with yeast display lipase | |
| CN103145671B (en) | Application of aspergillus awamori in preparation of quercetin by fermenting lichee peel | |
| Sutaoney et al. | Tannase production using green biotechnology and its applications: A review | |
| CN103740667A (en) | Extraction method of corn SOD enzyme through ionic liquid |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |