CN103045600B - Serum IgG antibody aptamer of tuberculosis patients and preparation method thereof - Google Patents
Serum IgG antibody aptamer of tuberculosis patients and preparation method thereof Download PDFInfo
- Publication number
- CN103045600B CN103045600B CN201110305110.5A CN201110305110A CN103045600B CN 103045600 B CN103045600 B CN 103045600B CN 201110305110 A CN201110305110 A CN 201110305110A CN 103045600 B CN103045600 B CN 103045600B
- Authority
- CN
- China
- Prior art keywords
- aptamer
- selex
- igg antibody
- tubercular
- buffer liquid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a serum IgG antibody aptamer of tuberculosis patients and a preparation method thereof, and the aptamer has a nucleotide sequence shown as SEQIDNO. 1, SEQIDNO. 2 or SEQIDNO. 3. The DNA aptamer of the serum IgG antibody of the tuberculosis patients is high in affinity and specificity, can substantially improve positive detection rate of the tuberculosis patients when applied in serology detection, and can rapidly and simply diagnose the tuberculosis of human and animals, and provide a favorable basis for laboratory diagnosis of the tuberculosis.
Description
Technical field
The invention belongs to infected by microbes immunity and inspection field, relate to aptamer of a kind of serum IgG (immunoglobulin G) antibody and preparation method thereof, particularly relate to a kind of tubercular's serum IgG antibody aptamer and preparation method thereof.
Background technology
Mycobacterium tuberculosis (Mycobacterium Tuberculosis) infects the chronic infectious disease that tuberculosis that human body causes is a kind of serious harm people's health.Tuberculosis is one of morbidity and the highest disease of mortality ratio in history.Since the fifties in last century, to be lungyly popularly under control to a certain extent.China is tuberculosis high burden country, and State Council has determined that tuberculosis is one of large keypoint control transmissible disease of China three.Therefore, strengthen R&D intensity lungy, urgently development of new antituberculosis drug, effectively to treat this disease and to prevent, there is very large researching value and social benefit.
The topmost problem that current Tubercufosis control exists is that Patient Detection rate is low, curative ratio is low.In diagnosis, existing inspection method all also exists certain limitation, is difficult to reach diagnosis of tuberculosis fast and accurately.In treatment, conventional chemotherapeutics is faced with huge challenge, and existing medicine has been difficult to the Drug-fast case clinical strains that reply constantly occurs, and curative ratio is difficult to improve.Over nearly more than 40 years, there is no new Effective Anti tubercular drugs and come out.Therefore, strengthen the fundamental research of mycobacterium tuberculosis, find quick, sensitive, easy, practical diagnosis of tuberculosis novel method, improve the recall rate of tuberculosis patient, and find new methods for the treatment of or develop new antitubercular agent, be that current tuberculosis research needs the urgent problem solved.
But modern tuberculosis symptoms intersects, hidden, cause failing to pinpoint a disease in diagnosis, mistaken diagnosis occur now and then.Clinical in phthisical diagnostic method proposition requirements at the higher level.
The acid-fast stain spectroscopy acid-fast bacilli positive rate of ordinary method is low, though cultivation results is reliable, length consuming time, need 3 ~ 8 weeks, and positive rate is also low.The influence factor of tuberculin test is more, there is the problems such as false negative.
Active tuberculosis Patient cells immunity impairment and humoral immunization is hyperfunction, in blood and other body fluid, tuberculosis antibody (mainly IgG) raises, and detects that tuberculosis antibody contributes to diagnosis lungy.Determination of tuberculosis antibody has higher practical value to active tuberculosis diagnosis.Therefore, tuberculosis IgG antibody as the screening target spot of new antitubercular agent, will can likely become new antitubercular agent with the molecule of its specific binding.
Oligonucleotide aptamer technology is a kind of novel Protocols in Molecular Biology of development in recent years, adopt phyletic evolution technology (systematic evolution of ligands by exponential enrichment, the SELEX) screening of exponential enrichment part to obtain.SELEX technology is a kind of new combinatorial chemistry technique of early 1990s development, ultimate principle uses jumbo random oligonucleotide library, and the outer pcr amplification technology of combination, with the oligonucleotide of index concentration and target molecule specific combination, and the outer pcr amplification technology of combination, with the oligonucleotide of index concentration and target molecule specific combination, through multi-turns screen, or obtain the oligonucleotide aptamer (aptamers) of high-affinity, high specificity, have that storage capacity is large, target molecule scope wide, avidity advantages of higher, operation strategies is very extensive.Successful utilization is in the screening of many target molecules, comprises metal ion, organic dye, protein, medicine, amino acid and various cytokines etc.Existing research by SELEX technology screening to the aptamer of respective target material as antagonist, vascular endothelial growth factor when being applicable to tumor growth, the thrombus generation factor, some toxin proteins and somatomedin etc., reach therapeutic purpose.In microorganism detection, particularly to the pathogenic bacteria of some the unknowns or the research of virus, although do not know the epi-position of its internal structure, function and these materials, but it can be used as target material, aptamer is corresponding thereto screened by SELEX process, detect target material, become the research and probe focus in this field.
Summary of the invention
In order to solve above-mentioned the problems of the prior art, the object of this invention is to provide DNA aptamer of a kind of tubercular's serum immunoglobulin G antibody and preparation method thereof.
Another object of the present invention there is provided the method that the above-mentioned aptamer of application detects tubercular's serum.
In order to realize object of the present invention, a kind of tubercular's serum immunoglobulin G antibody aptamer of the present invention, its sequence is SEQ ID NO.1, SEQ ID NO.2 or the nucleotide sequence shown in SEQ ID NO.3.
SEQ ID NO.1:GGGAGCTCAGAATAAACGCTCAA-CGCATTTCGCA
ACACGACTTGGCCAACGTACCTGG -TTCGACATGAGGCCCGGATC
SEQ ID NO.2:GGGAGCTCAGAATAAACGCTCAA-GACCTGGACGT
CTTGCGCATAGTGCGGTGGCCCGC -TTCGACATGAGGCCCGGATC
SEQ ID NO.3:GGGAGCTCAGAATAAACGCTCAA-CGGTCAACTCGTG
TA-TTCGACATGAGGCCCGGATC
The preparation method of above-mentioned tubercular's serum immunoglobulin G antibody aptamer, comprises the following steps:
Step 1, builds random single chain oligonucleotide library, the random single-stranded DNA banks of design and synthesis 78 base pair:
5 '-GGGAGCTCAGAATAAACGCTCAA-N
35-TTCGACATGAGGCCCGGATC-3 ', wherein N represents any one in base A, G, C, T, and capacity is 10
14-10
15, and obtain the SELEX technology screening of strand ssDNA library for IgG antibody aptamer of purifying further;
Step 2, utilizes aptamer technology screening immunoglobulin g antibody aptamer: be buffered liquid with bag and be coated in microwell plate by IgG aptamer, establishes blank anti-sieve aperture and the anti-sieve aperture of Healthy Human Serum simultaneously; First hatch with the anti-sieve aperture of blank after ssDNA library and the mixing of SELEX binding buffer liquid; Then transfer to IgG antibody bag to be hatched by hole, SELEX dcq buffer liquid washs, the ssDNA that SELEX elution buffer wash-out is combined with IgG antibody is added after drying, product is through phenol chloroform, alcohol settling purifying, after pcr amplification, carry out 10 and take turns screening, the saturated library after screening, through cloning and sequencing, obtain single aptamer.
In a preferred embodiment of the present invention, in step 1, also comprise the purifying to immunoglobulin g antibody.
In another preferred embodiment of the present invention, described purifying comprises crosses chromatography column by tubercular's serum according to a conventional method, and uses potassium sulfocyanate wash-out.
In another preferred embodiment of the present invention, SELEX binding buffer liquid in step 2, is used to be: 20mmol/LHepes, 120mmol/LNaCl, 5mmol/LKCl, 1mmol/LCaCl
2, 1mmol/LMgCl, the pH value of described SELEX binding buffer liquid is 7.35.
In another preferred embodiment of the present invention, SELEX dcq buffer liquid in step 2, is used to be: the mixing solutions of described SELEX binding buffer liquid and 0.05% Tween 20 solution.
In another preferred embodiment of the present invention, SELEX elution buffer in step 2, is used to be: 20 mmol/L Tris-HCl, 4 mol/L guanidinium isothiocyanates, 1mmol/L DTT, described SELEX elution buffer pH value is 8.3.
Tubercular's serum IgG antibody DNA aptamer affinity of the present invention, specificity are high, and preparation method is easy; It can significantly improve tuberculosis patient positive rate for Serologic detection, can be used for people and animal quick, easy diagnosis lungy, can be that laboratory diagnosis lungy and antituberculosis therapy assessment improve favourable foundation.
Accompanying drawing explanation
Fig. 1 is the secondary structure collection of illustrative plates of the IgG antibody DNA aptamer of SEQ ID NO.1;
Fig. 2 is the secondary structure collection of illustrative plates of the IgG antibody DNA aptamer of SEQ ID NO.1;
Fig. 3 is the secondary structure collection of illustrative plates of the IgG antibody DNA aptamer of SEQ ID NO.1.
Embodiment
A kind of tubercular's serum immunoglobulin G (IgG) antibody aptamer, it has SEQ ID NO.1, SEQ ID NO.2 or the nucleotide sequence shown in SEQ ID NO.3.
A preparation method for the DNA aptamer of tubercular's serum immunoglobulin G antibody, comprises the following steps:
Step 1, builds random single chain oligonucleotide library: the random single-stranded DNA banks of design and synthesis 78 base pair:
5 '-GGGAGCTCAGAATAAACGCTCAA-N
35-TTCGACATGAGGCCCGGATC-3 ', wherein N represents any one in base AGCT, and capacity is 10
14-10
15, and obtain the SELEX technology screening of strand ssDNA library for IgG antibody aptamer of purifying further;
Step 2, is that separating medium utilizes aptamer technology screening immunoglobulin g antibody aptamer with microwell plate: be buffered liquid with bag and be coated in microwell plate by IgG aptamer, establishes blank anti-sieve aperture and the anti-sieve aperture of Healthy Human Serum simultaneously; First hatch with the anti-sieve aperture of blank after ssDNA library and the mixing of SELEX binding buffer liquid; Then transfer to IgG antibody bag to be hatched by hole, SELEX dcq buffer liquid washs, the ssDNA that SELEX elution buffer wash-out is combined with IgG antibody is added after drying, product is through phenol chloroform, alcohol settling purifying, after pcr amplification, carry out 10 and take turns screening, the saturated library after screening, through cloning and sequencing, obtain single aptamer.
The present invention, by the research field of LESEX technology introduction mycobacterium tuberculosis, take IgG as target material, and screening obtains the aptamer of IgG, for the diagnoses and treatment utilizing aptamer technology to carry out mycobacterium tuberculosis further provides foundation.
Apply the method for the DNA aptamer diagnosis of tuberculosis of above-mentioned tubercular's serum immunoglobulin G antibody, select IgG aptamer or aptamer combination to build oligonucleotidase connection immune detecting system.
The present invention, after acquisition IgG aptamer, builds oligonucleotidase connection immune detecting system by selecting IgG aptamer or aptamer combination and carries out tubercular's Serologic detection.Reach object that is quick, Accurate Diagnosis.
In one embodiment of the invention, a kind of preparation method of DNA aptamer of tubercular's serum IgG antibody, comprises
Step 1, the purifying of (1) tubercular's serum IgG antibody:
With the binding buffer liquid (0.1mol/LNaHCO of 5 times of volumes
3, 0.5mol/LNaCl, pH value is 8.3) wash chromatography column; The serum controlling patient at the beginning of 10 parts of tuberculosis crosses chromatography column 2 times, crosses post speed slightly slow; The binding buffer liquid washing of 10 times of volumes; 1mlKSCN (potassium sulfocyanate 10 column volume, 3mol/L, pH value 6.1) wash-out; Post washed by the washing of pillar binding buffer liquid, distillation washing post, 20% alcohol; Post is recycled in 1ml dactylethrae, 4 DEG C of preservations; The IgG antibody reclaimed in eluting fraction carries out SDS-PAGE glue, Bradford standard measure antibody concentration; It is stand-by that the IgG antibody reclaimed puts-20 DEG C of preservations.
(2) build random single chain oligonucleotide library and obtain the single-stranded DNA banks of purifying:
Build random single chain oligonucleotide library: the random single-stranded DNA banks of design and synthesis 78 base pair:
5 '-GGGAGCTCAGAATAAACGCTCAA-N
35-TTCGACATGAGGCCCGGATC-3 ', wherein N represents any one in base AGCT, and capacity is 10
14-10
15; Build upstream primer: 5 '-GGGAGCTCAGAATAAACGCTCAA-3 ', build downstream primer 5 '-TTCGACATGAG
GCCCGGATC-3’。And obtain the SELEX technology screening of strand ssDNA library for IgG antibody aptamer of purifying further.
Designing and obtain the single-stranded DNA banks of purifying can by general PCR(polymerase chain reaction) amplification, asymmetric PCR method and phenol chloroform method purifying obtain.
Step 2, utilizes aptamer technology screening immunoglobulin G (IgG) antibody aptamer:
Being buffered liquid (0.05mol/L carbonate buffer solution, pH value 9.6) with bag is coated in microwell plate by IgG aptamer, establishes blank anti-sieve aperture and the anti-sieve aperture of Healthy Human Serum simultaneously; IgG antibody bag is all closed with 5% BSA (bovine serum albumin) by hole and anti-sieve aperture; First hatch at 37 DEG C with the anti-sieve aperture of blank after ssDNA library and the mixing of SELEX binding buffer liquid, remove the ssDNA be combined with BSA and microwell plate; Then transfer to IgG antibody bag to be hatched at 37 DEG C by hole, SELEX dcq buffer liquid washs, SELEX elution buffer is added in 80 DEG C of effect 10min after drying, the ssDNA that wash-out is combined with IgG antibody, product is through phenol chloroform, alcohol settling purifying, after pcr amplification, carry out next round screening.Carry out 10 altogether and take turns screening.Take turns the 5th, 7,8,9,10 and carry out with Healthy Human Serum being the anti-sieve of background.
Saturated library after screening, through cloning and sequencing, obtains single aptamer.This aptamer is the DNA aptamer that can be combined with IgG antibody, and its sequence is sequence 1, sequence 2 and sequence 3, and carries out the secondary structure collection of illustrative plates (see Fig. 1 to Fig. 3) that structural analysis obtains this aptamer.
Embodiments of the invention SELEX binding buffer liquid used is: 20mmol/L Hepes, 120mmol/L NaCl, 5 mmol/L KCl, 1mmol/LCaCl
2, 1mmol/LMgCl, binding buffer liquid pH value is 7.35; SELEX dcq buffer liquid is: SELEX binding buffer liquid+0.05% Tween 20; SELEX elution buffer is: 20 mmol/L Tris-HCl, 4 mol/L guanidinium isothiocyanates, 1mmol/L DTT, and the pH value of elution buffer is 8.3.
The DNA aptamer applying IgG antibody of the present invention carries out the method for Virus monitory, comprising:
Select there is the IgG antibody aptamer of high-affinity or aptamer combination builds oligonucleotidase connection immune detecting system (enzyme-linked oligonucleotide sorbent assay, ELOSA) for Serologic detection lungy.
Aptamer spectrophotometric measures concentration, and through 99 DEG C of sex change 5min, ice bath 10min carries out pre-treatment; Coating buffer (0.05mol/L carbonate buffer solution, the pH value 9.6) dilution of aptamer after process, according to the concentration bag of every hole 0.1 μ g by elisa plate, wrap and be 37 DEG C by process and hatch 2h, 4 DEG C are spent the night; Then 5% BSA(bovine serum albumin) close 1h at 37 DEG C;
The dilution proportion of serum sample diluting liquid according to 1:25 is added, hatches 30min for 37 DEG C; The goat-anti people two adding horseradish peroxidase-labeled resists, and hatches 30min for 37 DEG C; Add PBST and wash 3 times, 3min/ time;
Colouring reagents A and colouring reagents B mix according to the ratio of 1:1 and add, and hatch 10min for 37 DEG C, add stop buffer color development stopping; Add PBST and wash 3 times, 3min/ time;
Microplate reader dual wavelength (450nm and 620nm) is utilized to detect the absorbance (A450, A620) of sample.
Result judges: the OD value of carrying out result judgement should be the difference of OD450nm and OD630nm.OD value >=0.5, positive control every hole; Negative control OD value≤0.1, otherwise test is false.Threshold value (Cutoff) calculates: the average OD value of negative control+0.06(remarks: negative control OD value, lower than 0.05, calculates with 0.05, higher than 0.05 by calculated with actual values).
Result is explained: sample OD value >=threshold value is that tuberculosis antibody is positive; Sample OD value < threshold value is that tuberculosis antibody is negative.
IgG antibody DNA aptamer of the present invention is used for Serologic detection can significantly improve tuberculosis patient positive rate, can be used for people and animal quick, easy diagnosis lungy, can be that laboratory diagnosis lungy and antituberculosis therapy assessment improve favourable foundation.
Be described in detail specific embodiments of the invention above, but it is just as example, the present invention is not restricted to specific embodiment described above.To those skilled in the art, any equivalent modifications that the present invention is carried out and substituting also all among category of the present invention.Therefore, equalization conversion done without departing from the spirit and scope of the invention and amendment, all should contain within the scope of the invention.
SEQUENCE LISTING
<110> Shanghai Pulmonary Hospital
<120> tubercular serum IgG antibody aptamer and preparation method thereof
<160> 3
<170> PatentIn version 3.5
<210> 1
<211> 78
<212> DNA
<213> artificial sequence
<220>
<223> primer
<400> 1
gggagctcag aataaacgct caacgcattt cgcaacacga cttggccaac gtacctggtt 60
cgacatgagg cccggatc 78
<210> 2
<211> 78
<212> DNA
<213> artificial sequence
<220>
<223> primer
<400> 2
gggagctcag aataaacgct caagacctgg acgtcttgcg catagtgcgg tggcccgctt 60
cgacatgagg cccggatc 78
<210> 3
<211> 58
<212> DNA
<213> artificial sequence
<220>
<223> primer
<400> 3
gggagctcag aataaacgct caacggtcaa ctcgtgtatt cgacatgagg cccggatc 58
Claims (3)
1. a preparation method for tubercular's serum IgG antibody aptamer, is characterized in that, comprises the following steps:
Step 1, builds random single chain oligonucleotide library, the random single-stranded DNA banks of following 78 base pairs of design and synthesis:
5’-GGGAGCTCAGAATAAACGCTCAA-N
35-TTCGACATGAGGCCCGGATC-3’,
Wherein N represents any one in base A, G, C, T, and capacity is 10
14-10
15;
Step 2, utilizes aptamer technology screening immunoglobulin g antibody aptamer, and wherein, screening process uses SELEX binding buffer liquid, SELEX dcq buffer liquid, SELEX elution buffer, wherein,
SELEX binding buffer liquid consists of: 20mmol/L Hepes, 120mmol/L NaCl, 5mmol/L KCl, 1mmol/LCaCl
2, 1mmol/LMgCl
2, the pH value of described SELEX binding buffer liquid is 7.35;
SELEX dcq buffer liquid consists of: the mixing solutions of described SELEX binding buffer liquid and 0.05%Tween 20 solution;
SELEX elution buffer consists of: 20mmol/L Tris-HCl, 4mol/L guanidinium isothiocyanate, 1mmol/L DTT, and described SELEX elution buffer pH value is 8.3.
2. the preparation method of tubercular's serum IgG antibody aptamer as claimed in claim 1, is characterized in that, also comprise the purifying to immunoglobulin g antibody in step 1.
3. the preparation method of tubercular's serum IgG antibody aptamer as claimed in claim 2, it is characterized in that, described purifying comprises crosses chromatography column by tubercular's serum according to a conventional method, and uses potassium sulfocyanate wash-out.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201110305110.5A CN103045600B (en) | 2011-10-11 | 2011-10-11 | Serum IgG antibody aptamer of tuberculosis patients and preparation method thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201110305110.5A CN103045600B (en) | 2011-10-11 | 2011-10-11 | Serum IgG antibody aptamer of tuberculosis patients and preparation method thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN103045600A CN103045600A (en) | 2013-04-17 |
CN103045600B true CN103045600B (en) | 2014-12-17 |
Family
ID=48058463
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201110305110.5A Active CN103045600B (en) | 2011-10-11 | 2011-10-11 | Serum IgG antibody aptamer of tuberculosis patients and preparation method thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN103045600B (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN106645050B (en) * | 2016-10-13 | 2019-07-26 | 南京大学 | It is a kind of for detecting the aptamers and its application of lactoferrin content |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102010866A (en) * | 2010-09-29 | 2011-04-13 | 江南大学 | Nucleic acid aptamer capable of specifically recognizing shigella, screening method and application thereof |
CN102010865A (en) * | 2010-09-29 | 2011-04-13 | 江南大学 | Nucleic acid aptamer capable of specifically recognizing Listeria monocytogenes, screening method and application thereof |
-
2011
- 2011-10-11 CN CN201110305110.5A patent/CN103045600B/en active Active
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102010866A (en) * | 2010-09-29 | 2011-04-13 | 江南大学 | Nucleic acid aptamer capable of specifically recognizing shigella, screening method and application thereof |
CN102010865A (en) * | 2010-09-29 | 2011-04-13 | 江南大学 | Nucleic acid aptamer capable of specifically recognizing Listeria monocytogenes, screening method and application thereof |
Non-Patent Citations (2)
Title |
---|
Conformation plasticity of RNA for target recognition as revealed by the 2.15A crystal structure of a human IgG-aptamer complex;Nomura等;《Nucleic Acids Research》;20100730;第38卷(第21期);摘要和图1 * |
马占忠等.结核分枝杆菌ESAT-6抗原适体的筛选与亲和性分析.《中华临床医师杂志(电子版)》.2007,第1卷(第5期),全文. * |
Also Published As
Publication number | Publication date |
---|---|
CN103045600A (en) | 2013-04-17 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Karash et al. | Rapid detection of avian influenza virus H5N1 in chicken tracheal samples using an impedance aptasensor with gold nanoparticles for signal amplification | |
CN111693712B (en) | Method for detecting SARS-CoV-2N protein of new coronavirus by using nucleic acid aptamer | |
Gorelik et al. | Anti‐JC virus antibodies: implications for PML risk stratification | |
Rong et al. | COVID-19 diagnostic methods and detection techniques | |
CN110305871B (en) | High-expression gene in schistosoma japonicum schistosomulum and coding protein and application thereof | |
CN112080506B (en) | High-expression gene in schistosoma japonicum schistosomulum and coding protein and application thereof | |
Venkatesh et al. | Clinical detection of Hepatitis C viral infection by yeast-secreted HCV-core: Gold-binding-peptide | |
WO2020148589A1 (en) | Early biomarkers for cardiac patients | |
CN107344968A (en) | A kind of time-resolved fluorescence immunoassay method for being used to detect avian influenza virus H7N9 | |
Martínez-Roque et al. | DNA aptamer selection for SARS-CoV-2 spike glycoprotein detection | |
Yoshida et al. | Quantitative and sensitive protein detection strategies based on aptamers | |
Rasmussen et al. | Caspase‐1 inflammasome activity in patients with Staphylococcus aureus bacteremia | |
WO2024120133A1 (en) | Hydrophobic disruptor, preparation method therefor, and use thereof | |
CN103045600B (en) | Serum IgG antibody aptamer of tuberculosis patients and preparation method thereof | |
US20130337434A1 (en) | Method of Preparing Magnetic Bead Type Nasopharyngeal Enzyme Immunoassay Reagents by Polymerase Chain Reaction | |
CN111999503B (en) | Marker for predicting acute viral respiratory infectious disease severity and application and kit thereof | |
WO2017125007A1 (en) | Method and kit for diagnosis of active tuberculosis | |
CN104911187B (en) | Mycobacterium tuberculosis type strain H37DNA aptamer of Rv and preparation method thereof | |
CN104946655A (en) | DNA aptamer of mycobacterium tuberculosis standard strain H37Rv and preparation method thereof | |
CN102181566A (en) | Real-time fluorescence quantitative PCR (Polymerase Chain Reaction) kit for detecting candida tropicalis | |
CN106636105B (en) | The aptamer C203 and its screening technique of staphylococcus aureus enterotoxin C 2 and application | |
WO2022198790A1 (en) | Oligonucleotide aptamer of cardiac troponin and uses thereof | |
CN113862274B (en) | Oligonucleotide aptamer APT-D1 for high-specificity recognition of APE1 and preparation method and application thereof | |
CN105483132B (en) | The aptamer of affine viral hepatitis type C core antigen and its application | |
CN114381460B (en) | Aptamer for detecting mumps virus, kit and application |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant |