CN106645050B - It is a kind of for detecting the aptamers and its application of lactoferrin content - Google Patents
It is a kind of for detecting the aptamers and its application of lactoferrin content Download PDFInfo
- Publication number
- CN106645050B CN106645050B CN201610894671.6A CN201610894671A CN106645050B CN 106645050 B CN106645050 B CN 106645050B CN 201610894671 A CN201610894671 A CN 201610894671A CN 106645050 B CN106645050 B CN 106645050B
- Authority
- CN
- China
- Prior art keywords
- lactoferrin
- aptamers
- seq
- fluorescence polarization
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
- G01N21/6445—Measuring fluorescence polarisation
Landscapes
- Health & Medical Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Physics & Mathematics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Physics & Mathematics (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Investigating, Analyzing Materials By Fluorescence Or Luminescence (AREA)
- Investigating Or Analysing Materials By The Use Of Chemical Reactions (AREA)
Abstract
The invention discloses a kind of for detecting the aptamers of lactoferrin content, and the nucleotide sequence of the aptamers is as shown in NO.5~65 SEQ ID.The invention also discloses the method using above-mentioned aptamers detection lactoferrin, this method makes fluorescence polarization signal change using the aptamers of fluorescent marker as probe molecule, by the specific binding of aptamers and lactoferrin.There are linear relationships between fluorescence polarization signal and lactoferrin concentration to realize the quantitative detection to lactoferrin.The method high sensitivity, specificity is good, and the range of linearity of detection is 0.78~50 μ g/mL.This method is able to achieve the measurement to object in complex sample, such as the measurement of lactoferrin in milk.In addition, this method directly scans 96 orifice plates using BioTeK microplate reader, quick, high pass measurement requirement is reached, multiple samples effectively can have been measured simultaneously.
Description
Technical field
The invention belongs to technical field of biological, and in particular to a kind of to be examined using fluorescence polarization method to lactoferrin
The aptamers and its application of survey.
Background technique
Fluorescence polarization technology, can be based on the molecular mass of fluorophor as a kind of simple and reliable signal transduction means
Variation information about molecularly oriented, migration and mechanism is provided.Fluorescence Polarization assay is with many advantages: the
One, it is a kind of homogeneous analysis method and high sensitivity, without complex operations such as separation, as a result favorable reproducibility；Second, when response
Between it is fast, intermolecular interaction can be monitored in real time；It is high that automation can may be implemented with the Instrument crosslinkings such as microplate reader in third
Flux measurement；4th, ratio of the fluorescence polarization dependent on the fluorescence intensity in two vertical direction, with fluorescence absolute intensity without
It closes, fluorescence polarization value is insensitive to the fluctuation of fluorescence and photobleaching, to become the homogeneous determination target in complex biological sample
The ideal analysis method of molecule.Therefore, fluorescence polarization technology is in fluorescence sense application by extensive research concern.
Lactoferrin is a kind of functional protein of great broad mass market prospect, it is primarily present in the milk of mammal
In, the kind of content and animal is closely bound up, using human milk, cow's milk as Typical Representative.Studies have shown that lactoferrin is with a variety of
Biological activity.It has participate in iron metabolism, antitumor, anti-oxidant, antibacterial, block oxygen radical, immunological regulation and anti-inflammatory,
Promote cell to increase, reduce the multiple functions such as interior fat.And since lactoferrin is that one kind can be by baby's intake, safe pole
High natural milk composition is approved for food additives in Japan, is included into the U.S. it is generally acknowledged that among safe material.Add
It, the deep great attention by domestic and international food relevant enterprise of the extensive biological function of lactoferrin, the GB 14880-in China
In 2012 " food enrichments use standard ", lactoferrin be also listed in a kind of novel nourishing hardening agent and define its
Content standard in related dairy products.Thus, fast and accurately lactoferrin detection technique can be established, food safety is come
It says most important.Currently, be suitble to different type biological sample in lactoferrin detection technique mainly have spectrophotometry, efficiently
Liquid chromatography, enzyme linked immunosorbent assay, high-effective affinity chromatography method, high performance capillary electrophoresis method and surface plasma resonance
The detection techniques such as technology, but these methods still remain the spies such as pretreatment process is complicated, the actual sample rate of recovery is low, stability is poor
Point, therefore establish out and a kind of can realize that full-automatic lactoferrin accurate, quick, without carrying out pre-treatment to sample is examined comprehensively
Survey method is particularly significant and urgent.
Summary of the invention
Technical problem to be solved by the invention is to provide a kind of for detecting the aptamers of lactoferrin content.
The present invention also technical problems to be solved are to provide application of the above-mentioned aptamers in detection lactoferrin.
In order to solve the above technical problems, The technical solution adopted by the invention is as follows:
It is a kind of for detecting the aptamers of lactoferrin content, the nucleotide sequence of the aptamers such as SEQ ID NO.5 ~
Shown in 65, the preferred SEQ ID NO.6 of the aptamers, SEQ ID NO.18, SEQ ID NO.20, SEQ ID NO.35.
Above-mentioned application of the aptamers in detection lactoferrin for detecting lactoferrin content.
A kind of method of fluorescence polarization method measurement negative proteins content, includes the following steps:
(1) standard curve is drawn: to 10 μ L, the adaptation liquid solution of the nM marked by fluorescein isothiocyanate of 40 nM ~ 4000
The middle negative proteins standard sample that 100 μ L various concentrations are added, mixes, and the nucleotides sequence of the aptamers is classified as SEQ ID
Any one of NO.1 ~ 61 are reacted 5~120min at 25 DEG C ~ 40 DEG C, are detected with microplate reader, excitation wavelength 480nm, emit
Wavelength is 528nm, draws standard curve；
(2) sample detection: the aptamers of marked by fluorescein isothiocyanate are mixed with sample to be tested, according to step (1)
Condition detection.
Wherein, the concentration of the aptamers of the marked by fluorescein isothiocyanate is the nM of 40 nM ~ 4000；
Wherein, the concentration of the sample to be tested is 0.78 ~ 50 μ g/mL.
Wherein, the negative proteins are lactoferrin, α-lactalbumin, beta lactoglobulin, BSA, preferably lactoferrin.
The utility model has the advantages that
The aptamers that the present invention is marked using FITC keep fluorescence inclined as probe, by the specific binding of lactoferrin and probe
Vibration signal changes, and lactoferrin concentration logarithm is changed linearly with fluorescence polarization signal, to realize to newborn iron egg
White quantitative detection.This kind of fluorescence polarization method high sensitivity, anti-interference is very strong, it is possible to prevente effectively from false positive signal, real
Now to the measurement of object in complex sample, such as the measurement of lactoferrin in milk, the range of linearity of this method detection is 0.78 ~
50 μg/mL。
Detailed description of the invention
Fig. 1 fluorescence polarization method reaction time optimizes figure.
Fig. 2 various concentration lactoferrin and fluorescence polarization signal relational graph.
Fig. 3 fluorescence polarization method is to lactoferrin specific detection figure.
Fig. 4 fluorescence polarization method detects linear graph to lactoferrin.
Other aptamers of Fig. 5 detect linear graph to lactoferrin fluorescence polarization.
Specific embodiment
According to following embodiments, the present invention may be better understood.However, as it will be easily appreciated by one skilled in the art that real
It applies content described in example and is merely to illustrate the present invention, without sheet described in detail in claims should will not be limited
Invention.
Embodiment 1: lactoferrin aptamers screening
The specific steps of lactoferrin aptamers screening, including the detailed mistake such as chip preparation, positive and negative sieved journey, PCR amplification
Journey, it is described in detail below, in which:
Library: 5 '-TAMRA-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3 '
The forward direction primer of TARMA modification: 5 '-TARMA-GACAGGCAGGACACCGTAAC-3 '
Biotinylated backward primer: 5 ' Biotin-GAAGAGGAGGGAGGTAGCAG-3 '
(1) prepared by chip: the technology production microfluidic channel template that benefit mask sharp first is combined with chemical attack
Grinding tool is manufactured as the channel PDMS；Aggressiveness is sufficiently mixed with curing agent before weighing the PDMS that mass ratio is 10:1 afterwards, after vacuumizing
Be poured onto it is cured in microfluidic channel template after obtain PDMS microfluidic channel；It is in glass substrate point concentration using point sample instrument
The lactoferrin and negative proteins microarray of 5 mg/mL, and to the glass substrate after PDMS and point sample simultaneously plasma treatment,
It is fitted closely later collectively as screening chip, for next every wheel screening；Screening prepares: the sieve that step (1) is obtained
Chip is selected to be put into constant water bath box incubation 2 h of albumen at 37 DEG C；It is passed through 20 mg/ml BSA and 0.01 mM stochastic ordering again
It arranges short chain ssDNA (20 nt) and closes 1 h under the conditions of 37 DEG C；Positive and negative sieve is cleaned with 150 μ L, 1 × PBST solution later
Channel；
(2) first round screens: by 0.5 nmol, 125 μ L primary libraries are in 95 DEG C of 5 min of heating, and immediately on ice
Freeze 10 s；Library is input into positive sieve channel with 2.5 μ L/min flow velocitys with syringe pump again, reacts 50 under normal temperature conditions
min；150 μ L, 1 × PBS buffer solutions are passed through with 15 μ L/min flow velocitys later to remove and be not associated in positive sieve channel
SsDNA sequence；PDMS layer is gently torn, scans chip using Luxscan ~ 10K/A microarray scanner；Finally existed with DPEC water
The ssDNA sequence that 5 min elution lactoferrin combines is heated at 95 DEG C, acquired solution High Purity Nitrogen under the conditions of 50 DEG C is dried up to body
Product is 69 μ L；
(3) PCR amplification process: being divided into 3 parts of same solutions that volume is 23 μ L for step (2) acquired solution, and every part
Sequentially add 25 μ L, 2 × Taq polymerases, the forward direction primer and 1 μ L of 1 μ L, 20 μM of TAMRA label, 20 μM of lifes
The backward primer of object element, carries out PCR amplification after mixing；The Thermal Cycling of PCR is as follows: 94 DEG C of 5 min；Circulation
94 DEG C of 30 s, 60.5 DEG C of 30 s, 72 DEG C of 30 s process 10 are taken turns, and 72 DEG C of 5 min terminates reaction；What the step obtained
It is expanded again after 10 times of product dilution as template: PCR product and 25 μ L, 2 × SYBR after taking 5 μ L to dilute
Premix Ex TaqTMEnzyme, the forward direction primer of 1 μ L, 20 μM of TAMRA label, 1 μ L, 20 μM biotinylated backward
Primer and 18 μ L DPEC water are sufficiently mixed uniformly, and PCR amplification is every to be carried out taking 10 μ L samples to use into microwell plate once wheel
BioTek detects its fluorescence signal, and fluorescence signal soprano expands the wheel number as best wheel number, resultant product；
(4) it isolates and purifies: PCR product and 600 μ L Promega magnetic beads that step (4) obtains being mixed well, are being shaken
Supernatant is removed after quickly shaking 1 h on bed；Add pair that 25 5 min of μ L, 50 mM NaOH vortex will be connected on magnetic bead
Chain dissociation；It draws supernatant liquor and sequentially adds 12.5 μ L 100 mM HCl, 25 μ L H2In O, 62.5 2 × PBSM of μ L
With the secondary library that resulting solution is screened as next round, content is about 40 pmol；
(5) second wheel screenings: library is input into negative sieve channel with 2.5 μ L/min flow velocitys with pump, under normal temperature conditions instead
Answer 50 min；Library is input into positive sieve channel with 2.5 μ L/min flow velocitys with pump again, reacts 50 min under normal temperature conditions；
Then 150 μ L 1 × PBS buffer solutions are passed through with 15 μ L/min flow velocitys and remove unreacted chain in positive sieve channel；Gently tear
Fall PDMS layer, scans chip using Luxscan ~ 10K/A microarray scanner；5 min are finally heated at 95 DEG C with seedless water
Protein bound chain is eluted, acquired solution is 92 μ L in 60 DEG C of dryings to volume, gives over to PCR amplification;
(6) step (4), (5), (6) to the 8th wheel screening are repeated；
(7) the five, the six of screening, seven wheel pcr amplification products are sent to the raw work sequencing in Shanghai, every wheel randomly selects 120
Sequencing, then secondary structure analysis is carried out to obtained chain with IDT software, finally obtain optimal aptamers.
Embodiment 2: fluorescence polarization method detects lactoferrin standard sample:
(1) in 10 μ L, 250 nM FITC(fluorescein isothiocynates) label aptamers N2(base sequence: AGGC
AGGACACCGTAACCGGTGCATCTATGGCTACTAGCTTTTCCTGCCT it is 25 μ g/mL that 100 μ L concentration) are added in solution
Lactoferrin standard sample, mix well.
(2) mixed liquor of step (1) is placed in 96 microwell plates and reacts 15 min under the conditions of 37 DEG C, with BioTeK enzyme mark
Instrument directly scans, and excitation wavelength is 480 nm, and launch wavelength is 528 nm.
Embodiment 3: fluorescence polarization method reaction time optimization
(1) in 10 μ L, 250 nM FITC(fluorescein isothiocynates) label aptamers N2(base sequence: AGGC
AGGACACCGTAACCGGTGCATCTATGGCTACTAGCTTTTCCTGCCT it is 25 μ g/mL that 100 μ L concentration) are added in solution
Lactoferrin standard sample, mix well.
(2) mixed liquor of step (1) is placed in 96 microwell plates under the conditions of 37 DEG C react respectively 5 min, 10 min,
15 min, 20 min, 25 min, 30 min, 35 min, 40 min, 45 min, 50 min, 55 min, 60min, use BioTeK
Microplate reader directly scans, and excitation wavelength is 480 nm, and launch wavelength is 528 nm.
Fig. 1 is fluorescence polarization signal and fluorescence polarization signal figure in blank solution under the conditions of different time.
Embodiment 4: various concentration lactoferrin and fluorescence polarization signal relationship
(1) in 10 μ L, 250 nM FITC(fluorescein isothiocynates) label aptamers N2(base sequence: CGGT
GCATCTATGGCTACTAGCTTTTCCTGCCTATACTAC it is 0.19 μ g/mL that 100 μ L concentration) are separately added into solution,
0.39 μg/mL 0.78 μg/mL , 1.56 μg/mL , 3.12μg/mL , 6.25 μg/mL 、12.5 μg/mL、 25μ
The lactoferrin standard sample of g/mL, 50 μ g/mL, mix well.
(2) mixed liquor of step (1) is placed in 96 microwell plates under the conditions of 37 DEG C and reacts 15min, with BioTeK enzyme mark
Instrument directly scans, and excitation wavelength is 480 nm, and launch wavelength is 528 nm.
(3) by analysis, discovery analysis of fluorescence polarization signal is changed linearly with the logarithm of lactoferrin concentration, is obtained
The concentration of lactoferrin in sample is calculated by standard curve for standard curve.
Fig. 2 is the fluorescence polarization value figure that various concentration lactoferrin is added.
Embodiment 5: fluorescence polarization method is to lactoferrin specific detection
(1) in five part of 10 μ L, 250 nM FITC(fluorescein isothiocynates) label aptamers N2(base sequence:
CGGTGCATCTATGGCTACTAGCTTTTCCTGCCTATACTAC the cream of 100 μ L, 25 μ g/mL) will be added in solution respectively
Ferritin, 100 μ L, 500 μ g/mL α-lactalbumin, 100 μ L, 500 μ g/mL beta lactoglobulin, 100 μ L, 500 μ g/
ML BSA and 100 μ L PBS solutions, mix well.
(2) mixed liquor of step (1) is placed in 96 microwell plates and reacts 15 min under the conditions of 37 DEG C, with BioTeK enzyme
Mark instrument directly scans, and excitation wavelength is 480 nm, and launch wavelength is 528 nm.
Fig. 3 is this kind of fluorescence polarization method to lactoferrin, α-lactalbumin, the specific detection of beta lactoglobulin, BSA
Figure.
Embodiment 6: the method for detecting lactoferrin content
(1) in 10 μ L, 250 nM FITC(fluorescein isothiocynates) label aptamers N2(base sequence: AGGC
AGGACACCGTAACCGGTGCATCTATGGCTACTAGCTTTTCCTGCCT the milk sample of 25-100 times of dilution) is added in solution
Product mix well.
(2) mixed liquor of step (1) is placed in 96 microwell plates and reacts 15 min under the conditions of 37 DEG C, with BioTeK enzyme
Mark instrument directly scans, and excitation wavelength is 480 nm, and launch wavelength is 528 nm.
(3) contrast standard curve obtains the concentration of lactoferrin in milk sample, is specifically shown in Fig. 4.
Embodiment 7: the method for detecting lactoferrin content
(1) in 10 μ L, 250 nM FITC(fluorescein isothiocynates) label aptamers N6(base sequence: AGGC
AGGACACCGTAACCGGTGCATCTATGGCTACTAGCTTTTCCTGCCT the milk sample of 25-100 times of dilution) is added in solution
Product mix well.
(2) mixed liquor of step (1) is placed in 96 microwell plates and reacts 15 min under the conditions of 37 DEG C, with BioTeK enzyme
Mark instrument directly scans, and excitation wavelength is 480 nm, and launch wavelength is 528 nm.
(3) contrast standard curve obtains the concentration of lactoferrin in milk sample, is specifically shown in Fig. 5 (a).
Embodiment 8: the method for detecting lactoferrin content
(1) in 10 μ L, 250 nM FITC(fluorescein isothiocynates) label aptamers N14(base sequence: AGG
CAGGACACCGTAACCGGTGCATCTATGGCTACTAGCTTTTCCTGCCT the milk of 25-100 times of dilution) is added in solution
Sample mixes well.
(2) mixed liquor of step (1) is placed in 96 microwell plates and reacts 15 min under the conditions of 37 DEG C, with BioTeK enzyme
Mark instrument directly scans, and excitation wavelength is 480 nm, and launch wavelength is 528 nm.
(3) contrast standard curve obtains the concentration of lactoferrin in milk sample, is specifically shown in Fig. 5 (b).
Embodiment 9: the method for detecting lactoferrin content
(1) in 10 μ L, 250 nM FITC(fluorescein isothiocynates) label aptamers N16(base sequence: AGG
CAGGACACCGTAACCGGTGCATCTATGGCTACTAGCTTTTCCTGCCT the milk of 25-100 times of dilution) is added in solution
Sample mixes well.
(2) mixed liquor of step (1) is placed in 96 microwell plates and reacts 15 min under the conditions of 37 DEG C, with BioTeK enzyme
Mark instrument directly scans, and excitation wavelength is 480 nm, and launch wavelength is 528 nm.
(3) contrast standard curve obtains the concentration of lactoferrin in milk sample, is specifically shown in Fig. 5 (c).
Embodiment 10: the method for detecting lactoferrin content
(1) in 10 μ L, 250 nM FITC(fluorescein isothiocynates) label aptamers N31(base sequence: AGG
CAGGACACCGTAACCGGTGCATCTATGGCTACTAGCTTTTCCTGCCT the milk of 25-100 times of dilution) is added in solution
Sample mixes well.
(2) mixed liquor of step (1) is placed in 96 microwell plates and reacts 15 min under the conditions of 37 DEG C, with BioTeK enzyme
Mark instrument directly scans, and excitation wavelength is 480 nm, and launch wavelength is 528 nm.
(3) contrast standard curve obtains the concentration of lactoferrin in milk sample, is specifically shown in Fig. 5 (d).
Fluorescence polarization method is applied in the analysis detection of lactoferrin by the present invention, when the concentration of lactoferrin is 0.78
Between the μ of μ g/mL ~ 50 g/mL, there is good correlation, phase between fluorescence polarization signal intensity and the logarithm of lactoferrin concentration
Relationship number is 0.988.Meanwhile energy fast high-flux of the present invention detects lactoferrin, it not only can be to avoid the production of false positive signal
Interference that is raw and can preventing external environment, signal acquisition mode are simple and quick.
Claims (6)
1. a kind of for detecting the aptamers of lactoferrin content, which is characterized in that the nucleotide sequence of the aptamers is such as
SEQ ID NO.6, SEQ ID NO.18, SEQ ID NO.20, shown in SEQ ID NO.35.
2. for detecting application of the aptamers of lactoferrin content in detection lactoferrin described in claim 1.
3. a kind of method of fluorescence polarization method measurement negative proteins content, which comprises the steps of:
(1) draw standard curve: by 10 μ L, the nM marked by fluorescein isothiocyanate of 40 nM ~ 4000 adaptation liquid solution in plus
Enter the negative proteins standard sample of 100 μ L various concentrations, mix, the nucleotides sequence of the aptamers be classified as SEQ ID NO.6,
Any one of SEQ ID NO.18, SEQ ID NO.20, SEQ ID NO.35 react 5~120min at 25 DEG C ~ 40 DEG C, use
Microplate reader detection, excitation wavelength 480nm, launch wavelength 528nm draw standard curve；
(2) sample detection: the aptamers of marked by fluorescein isothiocyanate are mixed with sample to be tested, according to the condition of step (1)
Detection.
4. the method for fluorescence polarization method measurement negative proteins content according to claim 3, which is characterized in that the different sulphur
The concentration of the fluorescein-labeled aptamers of cyanic acid is the nM of 40 nM ~ 4000；
5. the method for fluorescence polarization method measurement negative proteins content according to claim 3, which is characterized in that described to be measured
The concentration of sample is 0.78 ~ 50 μ g/mL.
6. the method for fluorescence polarization method measurement negative proteins content according to claim 3, which is characterized in that the yin
Property albumen be lactoferrin, α-lactalbumin, beta lactoglobulin, BSA.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610894671.6A CN106645050B (en) | 2016-10-13 | 2016-10-13 | It is a kind of for detecting the aptamers and its application of lactoferrin content |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610894671.6A CN106645050B (en) | 2016-10-13 | 2016-10-13 | It is a kind of for detecting the aptamers and its application of lactoferrin content |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106645050A CN106645050A (en) | 2017-05-10 |
| CN106645050B true CN106645050B (en) | 2019-07-26 |
Family
ID=58855204
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610894671.6A Active CN106645050B (en) | 2016-10-13 | 2016-10-13 | It is a kind of for detecting the aptamers and its application of lactoferrin content |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106645050B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107607722B (en) * | 2017-07-21 | 2019-07-26 | 南京医科大学 | A kind of method of beta lactoglobulin in quantitative detection milk powder |
| CN109706153A (en) * | 2018-12-27 | 2019-05-03 | 南京祥中生物科技有限公司 | For detecting the ELONA aptamers and its application of lactoferrin |
| CN110554080B (en) * | 2019-09-29 | 2022-08-09 | 陕西科技大学 | Gel electrophoresis detection method and kit for lactoferrin content |
| CN111172166B (en) * | 2020-02-15 | 2021-10-15 | 江南大学 | Nucleic acid aptamer for specifically recognizing beta-lactoglobulin and application thereof |
| CN112114074B (en) * | 2020-08-14 | 2022-06-28 | 北京农业质量标准与检测技术研究中心 | Lactoferrin aptamer affinity column and preparation method and application thereof |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2004277312A (en) * | 2003-03-14 | 2004-10-07 | National Institute Of Advanced Industrial & Technology | Fluorescent labeled steroid compound and method for producing the same |
| CN101832935A (en) * | 2009-03-10 | 2010-09-15 | 苏州市长三角系统生物交叉科学研究院有限公司 | Target molecule detection method based on nanometer-gold and nucleic acid structure and kit thereof |
| CN103045600B (en) * | 2011-10-11 | 2014-12-17 | 上海市肺科医院 | Serum IgG antibody aptamer of tuberculosis patients and preparation method thereof |
| CN103525927A (en) * | 2013-10-11 | 2014-01-22 | 南京师范大学 | Method for detecting ochratoxin A |
| CN104152552B (en) * | 2014-07-18 | 2016-05-04 | 山东大学 | The fit sensor that triggers chain type hybridization reaction based on colocalization detects adenosine |
-
2016
- 2016-10-13 CN CN201610894671.6A patent/CN106645050B/en active Active
Non-Patent Citations (1)
| Title |
|---|
| 蛋白质微阵列芯片技术及其在抗体筛选中的应用;何为等;《分析化学(FENX IHUAXUE) 研究报告》;20050131;37-40页 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106645050A (en) | 2017-05-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106645050B (en) | It is a kind of for detecting the aptamers and its application of lactoferrin content | |
| CN107119054B (en) | Biosensor probe kit for specifically detecting sulfadiazine based on aptamer and application thereof | |
| CN107446929B (en) | Aptamer for specifically recognizing ochratoxin A and preparation method thereof | |
| Huang et al. | Selection, identification and application of a DNA aptamer against Staphylococcus aureus enterotoxin A | |
| CN105886512B (en) | Oligonucleotide aptamer group for high-specificity recognition of clenbuterol hydrochloride, salbutamol and ractopamine | |
| CN111172166B (en) | Nucleic acid aptamer for specifically recognizing beta-lactoglobulin and application thereof | |
| CN107541516A (en) | The aptamer of one group of specific recognition, three kinds of ocean toxin | |
| CN107254550B (en) | SPR sensor for detecting HIV related gene and preparation and application thereof | |
| CN104946795B (en) | Primer, probe and kit for Site Detection various serotype foot and mouth disease virus | |
| Yang et al. | Selection and identification of a DNA aptamer for ultrasensitive and selective detection of λ-cyhalothrin residue in food | |
| US11091757B2 (en) | Lactoferrin aptamers and use thereof | |
| Li et al. | Surface plasmon resonance biosensor for label-free and highly sensitive detection of point mutation using polymerization extension reaction | |
| CN111122847B (en) | Method for rapidly detecting aflatoxin B1 on site based on aptamer | |
| CN113265447B (en) | Rolling circle amplification-gold tetrahedron colorimetric detection method and kit for detecting creatine kinase isozyme | |
| CN111876412A (en) | Fluorescent aptamer probe and detection method and application thereof | |
| CN104911186A (en) | Single chain DNA oligonucleotide aptamer capable of specifically recognizing aflatoxin B1 | |
| CN112080551B (en) | Ampicillin detection aptamer sensor for amplifying double-enzyme mediated cascade signal | |
| CN108866060A (en) | A kind of aptamer, kit and detection method specifically binding shell-fish arginine kinase | |
| CN113552104B (en) | DNA three-way junction-silver cluster ratio type fluorescent sensor and method for detecting chloramphenicol | |
| CN110055336B (en) | Kit for rapidly identifying whether yak milk is adulterated or not | |
| CN111979247B (en) | Aptamer of beclomethasone as well as screening method and application thereof | |
| CN109810980B (en) | Nucleic acid aptamer for specifically recognizing tyramine and application thereof | |
| CN105018607B (en) | A method of based on Oil content and Protein content in DNA Quality Identification milk | |
| Kurbanov et al. | Immune-enzyme methods of food safety analysis | |
| CN112961859B (en) | Aptamer for specifically recognizing amantadine and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information | ||
| CB02 | Change of applicant information |
Address after: 210008 Hankou Road, Drum Tower District, Nanjing, Jiangsu Province, No. 22 Applicant after: Nanjing University Address before: 210046 Nanjing University, 163 Xianlin Avenue, Qixia District, Nanjing City, Jiangsu Province Applicant before: Nanjing University |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |