CN103045600A

CN103045600A - Serum IgG antibody aptamer of tuberculosis patients and preparation method thereof

Info

Publication number: CN103045600A
Application number: CN2011103051105A
Authority: CN
Inventors: 秦莲花; 胡忠义; 杨华; 刘忠华; 蔡江丽
Original assignee: Shanghai Pulmonary Hospital
Current assignee: Shanghai Pulmonary Hospital
Priority date: 2011-10-11
Filing date: 2011-10-11
Publication date: 2013-04-17
Anticipated expiration: 2031-10-11
Also published as: CN103045600B

Abstract

The invention provides a serum IgG antibody aptamer of tuberculosis patients and a preparation method thereof, and the aptamer has a nucleotide sequence shown as SEQIDNO. 1, SEQIDNO. 2 or SEQIDNO. 3. The DNA aptamer of the serum IgG antibody of the tuberculosis patients is high in affinity and specificity, can substantially improve positive detection rate of the tuberculosis patients when applied in serology detection, and can rapidly and simply diagnose the tuberculosis of human and animals, and provide a favorable basis for laboratory diagnosis of the tuberculosis.

Description

Tubercular's serum IgG antibody aptamer and preparation method thereof

Technical field

The invention belongs to infected by microbes immunity and check field, relate to aptamer of a kind of serum IgG (immunoglobulin G) antibody and preparation method thereof, relate in particular to a kind of tubercular's serum IgG antibody aptamer and preparation method thereof.

Background technology

The tuberculosis that mycobacterium tuberculosis (Mycobacterium Tuberculosis) infection human body causes is a kind of chronic infectious disease of serious harm people's health.Tuberculosis is one of disease that morbidity and mortality ratio are the highest in history.Since the fifties in last century, lungy popularly be under control to a certain extent.China is the high burden of tuberculosis country, and State Council has determined that tuberculosis is one of China's three large keypoint control transmissible diseases.Therefore, strengthen R﹠D intensity lungy is demanded urgently the development of new antituberculosis drug, in order to this disease is effectively treated and prevented, have very large researching value and social benefit.

The topmost problem that at present tuberculosis control exists is that patient's discovery rate is low, curative ratio is low.Aspect diagnosis, existing inspection method all exists certain limitation, is difficult to reach fast and accurately diagnosis of tuberculosis.Aspect treatment, conventional chemotherapeutics is faced with huge challenge, and existing medicine has been difficult to the anti-multiple medicines clinical strains that reply constantly occurs, and curative ratio is difficult to improve.Over nearly more than 40 years, there is no new efficient antitubercular agent and come out.Therefore, strengthen the fundamental research of mycobacterium tuberculosis, seek quick, sensitive, easy, practical diagnosis of tuberculosis novel method, improve the recall rate of tuberculosis patient, and seek new methods for the treatment of or develop new antitubercular agent, be that present tuberculosis research needs the urgent problem that solves.

But modern tuberculosis symptom intersects, hidden, cause failing to pinpoint a disease in diagnosis, mistaken diagnosis occurs now and then.Clinical in phthisical diagnostic method proposition requirements at the higher level.

The acid-fast stain spectroscopy acid-fast bacilli positive rate of ordinary method is low, though cultivation results is reliable, length consuming time needed for 3～8 weeks, and positive rate is also low.The influence factor of tuberculin test is more, has the problems such as false negative.

Active tuberculosis patient's cellular immunization impairment and humoral immunization is hyperfunction, tuberculosis antibody in blood and other body fluid (mainly being IgG) raises, and detects tuberculosis antibody and helps diagnosis lungy.Diagnosis has higher practical value to determination of tuberculosis antibody to active tuberculosis.Therefore, tuberculosis IgG antibody can be used as the screening target spot of new antitubercular agent, might become new antitubercular agent with the molecule of its specific binding.

The oligonucleotide aptamer technology is a kind of novel Protocols in Molecular Biology of development in recent years, to adopt phyletic evolution technology (systematic evolution of ligands by exponential enrichment, the SELEX) screening of exponential enrichment part to obtain.The SELEX technology is a kind of new combinatorial chemistry technique of early 1990s development, ultimate principle is to use jumbo random oligonucleotide library, and the outer pcr amplification technology of combination, oligonucleotide with index concentration and target molecule specific combination, and the outer pcr amplification technology of combination, oligonucleotide with index concentration and target molecule specific combination, through multi-turns screen, or the oligonucleotide aptamer (aptamers) of high-affinity, high specificity, have that storage capacity is large, the target molecule scope wide, the avidity advantages of higher, the utilization scope is very extensive.Successfully apply to the screening of many target molecules, comprise metal ion, organic dye, protein, medicine, amino acid and various cytokines etc.Existing research by the SELEX technology screening to the aptamer of respective target material as antagonist, the vascular endothelial growth factor when being applicable to tumor growth, thrombus generate the factor, some toxin proteins and somatomedin etc., have reached therapeutic purpose.Aspect microorganism detection, particularly to some unknown pathogenic bacterias or viral research, although do not know the epi-position of its internal structure, function and these materials, but with it as the target material, screen the aptamer corresponding with it by the SELEX process, detect the target material, become the research and probe focus in this field.

Summary of the invention

In order to solve above-mentioned the problems of the prior art, the purpose of this invention is to provide DNA aptamer of a kind of tubercular's serum immunoglobulin G antibody and preparation method thereof.

Another object of the present invention has provided the method that above-mentioned aptamer detects tubercular's serum of using.

In order to realize purpose of the present invention, a kind of tubercular's serum immunoglobulin G antibody aptamer of the present invention, its sequence is the nucleotide sequence shown in SEQ ID NO.1, SEQ ID NO.2 or the SEQ ID NO.3.

SEQ ID NO.1：GGGAGCTCAGAATAAACGCTCAA-CGCATTTCGCA

ACACGACTTGGCCAACGTACCTGG -TTCGACATGAGGCCCGGATC

SEQ ID NO.2：GGGAGCTCAGAATAAACGCTCAA-GACCTGGACGT

CTTGCGCATAGTGCGGTGGCCCGC -TTCGACATGAGGCCCGGATC

SEQ ID NO.3：GGGAGCTCAGAATAAACGCTCAA-CGGTCAACTCGTG

TA-TTCGACATGAGGCCCGGATC

The preparation method of above-mentioned tubercular's serum immunoglobulin G antibody aptamer may further comprise the steps:

Step 1 makes up at random single stranded oligonucleotide library, the random single-stranded DNA banks of synthetic 78 base pairs of design:

5 '-GGGAGCTCAGAATAAACGCTCAA-N ₃₅-TTCGACATGAGGCCCGGATC-3 ', wherein N represents any one among base A, G, C, the T, and capacity is 10 ¹⁴-10 ¹⁵, and further obtain the strand ssDNA library of purifying for the SELEX technology screening of IgG antibody aptamer;

Step 2 is utilized aptamer technology screening immunoglobulin g antibody aptamer: with coated damping fluid the IgG aptamer is coated in the microwell plate, establishes simultaneously blank anti-sieve aperture and the anti-sieve aperture of Healthy Human Serum; Hatch with blank anti-sieve aperture first behind ssDNA library and the SELEX binding buffer liquid mixing; Then transferring to IgG antibody sandwich hole hatches, the washing of SELEX dcq buffer liquid, the ssDNA that adds SELEX elution buffer wash-out and IgG antibodies after drying, product is through the extracting of phenol chloroform, ethanol deposition and purification, behind the pcr amplification, carry out 10 and take turns screening, the saturated library after the screening, through cloning and sequencing, obtain single aptamer.

In a preferred embodiment of the present invention, also comprise the purifying to immunoglobulin g antibody in the step 1.

In another preferred embodiment of the present invention, described purifying comprises according to a conventional method crosses chromatography column with tubercular's serum, and uses the potassium sulfocyanate wash-out.

In another preferred embodiment of the present invention, use SELEX binding buffer liquid to be in the step 2: 20mmol/LHepes, 120mmol/LNaCl, 5mmol/LKCl, 1mmol/LCaCl ₂, 1mmol/LMgCl, the pH value of described SELEX binding buffer liquid is 7.35.

In another preferred embodiment of the present invention, use SELEX dcq buffer liquid to be in the step 2: the mixing solutions of described SELEX binding buffer liquid and 0.05% Tween, 20 solution.

In another preferred embodiment of the present invention, use the SELEX elution buffer to be in the step 2: 20 mmol/L Tris-HCl, 4 mol/L guanidinium isothiocyanates, 1mmol/L DTT, described SELEX elution buffer pH value is 8.3.

Tubercular's serum IgG antibody DNA aptamer affinity of the present invention, specificity height, the preparation method is easy; It is used for the serology detection can significantly improve the tuberculosis patient positive rate, can be used for quick, the easy diagnosis lungy of people and animal, can be that laboratory diagnosis lungy and antituberculosis therapy assessment improve favourable foundation.

Description of drawings

Fig. 1 is the secondary structure collection of illustrative plates of the IgG antibody dna aptamer of SEQ ID NO.1;

Fig. 2 is the secondary structure collection of illustrative plates of the IgG antibody dna aptamer of SEQ ID NO.1;

Fig. 3 is the secondary structure collection of illustrative plates of the IgG antibody dna aptamer of SEQ ID NO.1.

Embodiment

A kind of tubercular's serum immunoglobulin G (IgG) antibody aptamer, it has the nucleotide sequence shown in SEQ ID NO.1, SEQ ID NO.2 or the SEQ ID NO.3.

A kind of preparation method of DNA aptamer of tubercular's serum immunoglobulin G antibody may further comprise the steps:

Step 1 makes up at random single stranded oligonucleotide library: the random single-stranded DNA banks of synthetic 78 base pairs of design:

5 '-GGGAGCTCAGAATAAACGCTCAA-N ₃₅-TTCGACATGAGGCCCGGATC-3 ', wherein N represents any one among the base AGCT, and capacity is 10 ¹⁴-10 ¹⁵, and further obtain the strand ssDNA library of purifying for the SELEX technology screening of IgG antibody aptamer;

Step 2 is utilized aptamer technology screening immunoglobulin g antibody aptamer: with coated damping fluid the IgG aptamer is coated in the microwell plate, establishes simultaneously blank anti-sieve aperture and the anti-sieve aperture of Healthy Human Serum take microwell plate as separating medium; Hatch with blank anti-sieve aperture first behind ssDNA library and the SELEX binding buffer liquid mixing; Then transferring to IgG antibody sandwich hole hatches, the washing of SELEX dcq buffer liquid, the ssDNA that adds SELEX elution buffer wash-out and IgG antibodies after drying, product is through the extracting of phenol chloroform, ethanol deposition and purification, behind the pcr amplification, carry out 10 and take turns screening, the saturated library after the screening, through cloning and sequencing, obtain single aptamer.

The present invention is with the research field of LESEX technology introduction mycobacterium tuberculosis, and take IgG as the target material, screening obtains the aptamer of IgG, for the diagnoses and treatment that further utilizes the aptamer technology to carry out mycobacterium tuberculosis provides foundation.

Use the method for the DNA aptamer diagnosis of tuberculosis of above-mentioned tubercular's serum immunoglobulin G antibody, select the combination of IgG aptamer or aptamer to make up oligonucleotidase connection immune detecting system.

The present invention can detect by selecting IgG aptamer or aptamer combination structure oligonucleotidase connection immune detecting system to carry out tubercular's serology after obtaining the IgG aptamer.Reached purpose quick, Accurate Diagnosis.

In one embodiment of the invention, a kind of preparation method of DNA aptamer of tubercular's serum IgG antibody comprises

Step 1, the purifying of (1) tubercular's serum IgG antibody:

Binding buffer liquid (0.1mol/LNaHCO with 5 times of volumes ₃, 0.5mol/LNaCl, the pH value is 8.3) wash chromatography column; The serum that 10 parts of tuberculosis is just controlled the patient is crossed chromatography column 2 times, and it is slightly slow to cross post speed; The binding buffer liquid washing of 10 times of volumes; 1mlKSCN (potassium sulfocyanate 10 column volumes, 3mol/L, pH value 6.1) wash-out; Pillar is washed post with the washing of binding buffer liquid, distillation washing post, 20% alcohol; Post is recycled in the 1ml dactylethrae, 4 ℃ of preservations; The IgG antibody that reclaims in the eluting fraction carries out SDS-PAGE glue, Bradford standard measure antibody concentration; It is stand-by that the IgG antibody that reclaims is put-20 ℃ of preservations.

(2) make up single stranded oligonucleotide library at random and obtain the single-stranded DNA banks of purifying:

Make up at random single stranded oligonucleotide library: the random single-stranded DNA banks of synthetic 78 base pairs of design:

5 '-GGGAGCTCAGAATAAACGCTCAA-N ₃₅-TTCGACATGAGGCCCGGATC-3 ', wherein N represents any one among the base AGCT, and capacity is 10 ¹⁴-10 ¹⁵Make up upstream primer: 5 '-GGGAGCTCAGAATAAACGCTCAA-3 ', make up downstream primer 5 '-TTCGACATGAG

GCCCGGATC-3’。And the strand ssDNA library that further obtains purifying is used for the SELEX technology screening of IgG antibody aptamer.

Design and obtain the single-stranded DNA banks of purifying can be by general PCR(polymerase chain reaction) increase, asymmetric PCR method and phenol chloroform method purifying obtain.

Step 2, utilize aptamer technology screening immunoglobulin G (IgG) antibody aptamer:

With coated damping fluid (0.05mol/L carbonate buffer solution, pH value 9.6) the IgG aptamer is coated in the microwell plate, establishes simultaneously blank anti-sieve aperture and the anti-sieve aperture of Healthy Human Serum; IgG antibody sandwich hole and anti-sieve aperture all seal with 5% BSA (bovine serum albumin); Under 37 ℃, hatch the ssDNA that removal is combined with BSA and microwell plate with blank anti-sieve aperture first behind ssDNA library and the SELEX binding buffer liquid mixing; Then transferring to IgG antibody sandwich hole hatches under 37 ℃, the washing of SELEX dcq buffer liquid, add the SELEX elution buffer after drying in 80 ℃ of effect 10min, the ssDNA of wash-out and IgG antibodies, product is through the extracting of phenol chloroform, ethanol deposition and purification, behind the pcr amplification, carry out the next round screening.Carry out altogether 10 and take turns screening.Take turns the anti-sieve that carries out take Healthy Human Serum as background the 5th, 7,8,9,10.

Saturated library after the screening through cloning and sequencing, obtains single aptamer.This aptamer be can with the DNA aptamer of IgG antibodies, its sequence is sequence 1, sequence 2 and sequence 3, and carries out the secondary structure collection of illustrative plates (seeing Fig. 1 to Fig. 3) that structural analysis obtains this aptamer.

The used SELEX binding buffer liquid of embodiments of the invention is: 20mmol/L Hepes, 120mmol/L NaCl, 5 mmol/L KCl, 1mmol/LCaCl ₂, 1mmol/LMgCl, binding buffer liquid pH value is 7.35; SELEX dcq buffer liquid is: SELEX binding buffer liquid+0.05% Tween 20; The SELEX elution buffer is: 20 mmol/L Tris-HCl, and 4 mol/L guanidinium isothiocyanates, 1mmol/L DTT, the pH value of elution buffer is 8.3.

The DNA aptamer of using IgG antibody of the present invention carries out the method that serum detects, and comprising:

IgG antibody aptamer or aptamer combination that selection has high-affinity make up oligonucleotidase connection immune detecting system (enzyme-linked oligonucleotide sorbent assay, ELOSA) for serology detection lungy.

Aptamer spectrophotometric instrumentation concentration, and through 99 ℃ of sex change 5min, ice bath 10min carries out pre-treatment; Aptamer after the processing dilutes with coating buffer (0.05mol/L carbonate buffer solution, pH value 9.6), and according to the coated elisa plate of the concentration of every hole 0.1 μ g, coated process is 37 ℃ and hatches 2h that 4 ℃ are spent the night; Then 5% BSA(bovine serum albumin) 37 ℃ of lower sealing 1h;

Serum is added with the dilution proportion of sample diluting liquid according to 1:25, hatch 30min for 37 ℃; The goat-anti people two who adds horseradish peroxidase-labeled is anti-, hatches 30min for 37 ℃; Add PBST washing 3 times, 3min/ time;

Colouring reagents A mixes adding with colouring reagents B according to the ratio of 1:1, hatches 10min for 37 ℃, adds the stop buffer color development stopping; Add PBST washing 3 times, 3min/ time;

Utilize microplate reader dual wavelength (450nm and 620nm) to detect the absorbance (A450, A620) of sample.

The result judges: the OD value of carrying out result's judgement should be the difference of OD450nm and OD630nm.The every hole of positive control OD value 〉=0.5; Negative control OD value≤0.1, otherwise test is false.Threshold value (Cutoff) is calculated: the average OD value of negative control+0.06(remarks: negative control OD value is lower than 0.05, with 0.05 calculating, is higher than 0.05 by calculated with actual values).

The result explains: sample OD value 〉=threshold value is that tuberculosis antibody is positive; Sample OD value＜threshold value is that tuberculosis antibody is negative.

The serology that is used for IgG antibody dna aptamer of the present invention detects can significantly improve the tuberculosis patient positive rate, can be used for quick, the easy diagnosis lungy of people and animal, can be laboratory diagnosis lungy and the favourable foundation of antituberculosis therapy assessment raising.

More than specific embodiments of the invention are described in detail, but it is just as example, the present invention is not restricted to specific embodiment described above.To those skilled in the art, any equivalent modifications that the present invention is carried out and substituting also all among category of the present invention.Therefore, not breaking away from impartial conversion and the modification of doing under the spirit and scope of the present invention, all should contain within the scope of the invention.

SEQUENCE LISTING

＜110〉Shanghai Pulmonary Hospital

＜120〉tubercular's serum IgG antibody aptamer and preparation method thereof

<160> 3

<170> PatentIn version 3.5

<210> 1

<211> 78

<212> DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400> 1

gggagctcag aataaacgct caacgcattt cgcaacacga cttggccaac gtacctggtt 60

cgacatgagg cccggatc 78

<210> 2

<211> 78

<212> DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400> 2

gggagctcag aataaacgct caagacctgg acgtcttgcg catagtgcgg tggcccgctt 60

cgacatgagg cccggatc 78

<210> 3

<211> 58

<212> DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400> 3

gggagctcag aataaacgct caacggtcaa ctcgtgtatt cgacatgagg cccggatc 58

Claims

1. tubercular's serum IgG antibody aptamer, its sequence is the nucleotide sequence shown in SEQ ID NO.1, SEQ ID NO.2 or the SEQ ID NO.3.

2. the preparation method of tubercular's serum IgG antibody aptamer as claimed in claim 1 is characterized in that, may further comprise the steps:

Step 1 makes up at random single stranded oligonucleotide library, the random single-stranded DNA banks of synthetic following 78 base pairs of design:

5’-GGGAGCTCAGAATAAACGCTCAA-N ₃₅-TTCGACATGAGGCCCGG

ATC-3’，

Wherein N represents any one among base A, G, C, the T, and capacity is 10 ¹⁴-10 ¹⁵

Step 2 is utilized aptamer technology screening immunoglobulin g antibody aptamer.

3. the preparation method of tubercular's serum IgG antibody aptamer as claimed in claim 2 is characterized in that, also comprises the purifying to immunoglobulin g antibody in the step 1.

4. the preparation method of tubercular's serum IgG antibody aptamer as claimed in claim 3 is characterized in that, described purifying comprises according to a conventional method crosses chromatography column with tubercular's serum, and uses the potassium sulfocyanate wash-out.

5. as the preparation method of tubercular's serum IgG antibody aptamer as claimed in claim 2, it is characterized in that, used SELEX binding buffer liquid in the aptamer technology of step 2: 20mmol/L Hepes, 120mmol/L NaCl, 5 mmol/L KCl, 1mmol/LCaCl ₂, 1mmol/LMgCl, the pH value of described SELEX binding buffer liquid is 7.35.

6. as the preparation method of tubercular's serum IgG antibody aptamer as claimed in claim 5, it is characterized in that, the aptamer utilization in the step 2 SELEX dcq buffer liquid: the mixing solutions of described SELEX binding buffer liquid and 0.05% Tween, 20 solution.

7. as the preparation method of tubercular's serum IgG antibody aptamer as claimed in claim 2, it is characterized in that, aptamer utilization in the step 2 the SELEX elution buffer: 20mmol/L Tris-HCl, the 4mol/L guanidinium isothiocyanate, 1mmol/L DTT, described SELEX elution buffer pH value is 8.3.