CN102925472A - Recombinant expression of actinoporins proteins - Google Patents
Recombinant expression of actinoporins proteins Download PDFInfo
- Publication number
- CN102925472A CN102925472A CN2012104109292A CN201210410929A CN102925472A CN 102925472 A CN102925472 A CN 102925472A CN 2012104109292 A CN2012104109292 A CN 2012104109292A CN 201210410929 A CN201210410929 A CN 201210410929A CN 102925472 A CN102925472 A CN 102925472A
- Authority
- CN
- China
- Prior art keywords
- sea anemone
- liquid
- albumen
- rgt
- cytolysin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention relates to the technical field of marine organisms, in particular to a recombinant expression method of actinoporins proteins. Actinoporins are of proteins with the molecular weight of 20kDa and have very extensive physiological activity. At present, a main method for getting actinocongestin proteins is realized by separation and purification of sea anemone tentacle proteins. The invention provides the recombinant expression method of the actinoporin proteins, and the actinoporin proteins obtained by the recombinant expression method disclosed by the invention have the advantages of biological activity and high purity. The invention further discloses application of the actinoporin proteins in preparation of medicaments for preventing or treating tumors.
Description
Technical field
The present invention relates to the marine biotechnology field, be specifically related to a kind of recombinant expression method of sea anemone cytolysin albumen.
Background technology
There is the numerous Peptide toxin of kind in the marine organisms, these toxin are unique, have widely that neural system is active, the various biological such as cardiovascular system activity and cytoactive are active, hold out broad prospects in research and the application facet of biomedical, molecular biology and pharmacy.In recent years, because congestin novel structure, target site are single-minded, the functioning efficiency high, be subject to paying close attention to widely.
The tentacle of sea anemone and health all contain a large amount of thread cells, the organoid that a special cryptomere is arranged in each thread cell, stinging capsule by name, the interior venom that storing, thread tube is tortuous in stinging capsule, the ecthoaeum tip is pricker, when being subject to machinery or chemical stimulation, can discharging ecthoaeum and thrust the prey health and by thread tube toxin is injected in the prey body.To the research of congestin from 20 century 70s, at present from approximately being separated to above 300 kinds of toxin 40 kinds of sea anemones, according to the difference of molecular weight and biological function, can be divided into sea anemone synocytotoxin and sea anemone polypeptide class neurotoxin two large classes.
The sea anemone cytolysin is named as actinoporins, is the protein about molecule amount 20kDa, belongs to pore-forming toxin (pore-forming toxins, PFTs) family.The sea anemone cytolysin has very widely physiologically active, comprise myocardium toxicity, molten cytosis, the pulmonary edema that causes, antibiotic, antitumor etc., wherein most typical is to form perforation at cytolemma, make cytoclasis, dissolving, at antibiotic, desinsection, anti-tumor aspect certain using value is arranged.There are some researches show that sea anemone cytolysin RTX-A has anti-tumor activity, as the mass action and the JB6P that use far below its molten cytosis
+When Cl41 and two kinds of tumour cells of Hela, propagation that can the establishment tumour cell, and can suppress JB6P
+AP-1 in the Cl41 cell, the activity of the transcription factor that NF-κ B is relevant with p53.（Fedorov，S.,et?al.,The?anticancer?effects?of?actinoporin?RTX-Afrom?the?sea?anemone?Heteractis?crispa(＝Radianthus?macrodactylus).Toxicon,2010.55(4):p.811-7）。
The applicant has applied for Chinese patent CN201110027250.0 on January 25th, 2011, denomination of invention is " a kind of sea anemone cytolysin and application thereof ", publication number is CN102174097A, disclose a kind of by Stichodactyla mertensii (Heteractis magnifica) tentacle is carried out protein separation, the molecular weight that obtains is the synocytotoxin Cytolysin-4 of 19KD approximately, and this sea anemone cytolysin has the activity of very strong hemolytic activity and sphingomyelinase.
As seen, the main method of obtaining congestin albumen to the separation and purification of sea anemone tentacle albumen at present, but the toxin that this method is obtained on the one hand less than q.s carries out deep research, also is destruction to oceanic resources and ecotope for catching and killing of sea anemone on the other hand.
In recent years, the researchist begins to put forth effort to obtain congestin albumen by recombinant expressed this molecular biological method both at home and abroad, remedies the deficiency of traditional separation purification method.
Along with the growing interest to oceanic resources, newfound sea anemone cytolysin can be on the increase, and research also will deepen continuously to the structure and function of sea anemone cytolysin.Extensive and deep research helps rationally and fully to utilize the sea anemone resource of China's abundant to the sea anemone cytolysin, for the sting treatment measure of hindering of new drug development and sea anemone all significant.
Summary of the invention
The object of the present invention is to provide a kind of recombinant expression method of sea anemone cytolysin albumen, another object of the present invention provides the sea anemone cytolysin albumen that obtains by recombinant expression method, and the application of this sea anemone cytolysin albumen in preparation prevention or medicine for treating tumor thing.
The present invention utilizes gene engineering method, at first designed pair of primers, this primer is that to refer to that according to the huge row of coding the multienzyme of maturation protein two terminal sequences of gigtIV gene (GENBANK No.JQ353486) of sea anemone (Stichodactyla gigantea) cytolysin and prokaryotic expression carrier pET-22b is cut the site synthetic, and upstream primer contains Nde I enzyme and cuts sequence (CATATG), and downstream primer contains Xho I enzyme and cuts sequence (CTCGAG); Secondly, the present invention selects prokaryotic expression carrier pET-22b, is built into expression plasmid pET-22b-gigtIV, the expression plasmid pET-22b-gigtIV that the present invention makes up, this expression plasmid carrier is behind NdeI/Xho I double digestion, and the fragment that can obtain 540bp is SEQ ID NO:1; Afterwards it is transformed e. coli bl21 (E.coli BL21 has another name called E.coli DE3) bacterial strain, this expression vector of pET-22b is take T7 as promotor, and the C end has 6 * His structure, is convenient to utilize the immobilization metal affinity chromatogra to carry out purifying; The present invention is also further to the groping and optimize of the conditions such as incubation time, induction time, temperature, to obtain the higher fusion rotein of purity.
The sea anemone cytolysin albumen rGT-4 that the present invention obtains by recombinant expression method, its expression amount can reach 25mg/L, and basically is in solvable state.
The invention provides a kind of recombinant expression method of sea anemone cytolysin albumen, the method may further comprise the steps:
The structure of A, restructuring sea anemone cytolysin expression plasmid:
Design and synthesize pair of primers as follows:
Upstream primer: 5 ' AAA
CATATGAGTGCTTCAGAAGTCGCTG 3 ' (SEQ ID NO:3)
Downstream primer: 5 ' TTT
CTCGAGGCGTGAAATCTTAATTTGCAG 3 ' (SEQ IDNO:4)
Pcr amplification is cloned into the goal gene that increases on the prokaryotic expression carrier pET-22b, is built into expression plasmid pET-22b-gigtIV.
Pcr amplification, gene clone are carried out all according to a conventional method.
B, restructuring sea anemone cytolysin rGT-4 protein expression:
PET-22b-gigtIV is transformed e. coli bl21, express Cnidarian cytotoxin rGT-4 albumen (SEQID NO:2).
Further, the recombinant expression method of above-mentioned sea anemone cytolysin albumen, among the step B, pET-22b-gigtIV is transformed e. coli bl21, culture condition is: single colony inoculation is in 50ml amicillin resistance LB liquid nutrient medium (1%(w/v) Tryptones, 0.5%(w/v) yeast extract, 1%(w/v) sodium-chlor, 0.01%(w/v) penbritin) in, 37 ° of C, the 180rpm overnight incubation is got in the LB liquid nutrient medium of amicillin resistance that overnight culture 20ml is inoculated in 2L, 37 ° of C, 180rpm is cultured to OD
600=0.6, adding 100mmol/L IPTG is 0.4mmol/L to final concentration, 37 ° of C, centrifugal results thalline behind the 180rpm inducing culture 5h.
The recombinant expression method of above-mentioned sea anemone cytolysin albumen also comprises the purifying of step C, restructuring sea anemone cytolysin rGT-4 albumen:
With total thalline 10mmol/L of step B results, A liquid (the 20mmol/L imidazoles, pH 7.4 for 20mmol/L PBS, 500mmol/LNaCl) suspension is used in the washing of the PBS damping fluid of pH 7.5 again, after the supersound process, and 4 ° of centrifugal 30min of C, 12000rpm, supernatant liquor is through Ni
2+The affinity chromatography single step purification;
This post is used A liquid balance in advance, and the complete rear usefulness B liquid of loading (20mmol/L PBS, 500mmol/LNaCl, the 500mmol/L imidazoles, pH 7.4) gradient elution, and each gradient elution time is 10min, flow velocity is 1ml/min.Restructuring rGT-4 is eluted at 20%B liquid, rGT-4 is kept at-75 ° of C.
Other rGT-4 that takes a morsel carries out SDS-PAGE and analyzes, and show that its molecular weight is about 19KD, and purity reaches more than 90%.
The present invention also provides the sea anemone cytolysin albumen that obtains by above-mentioned recombinant expression method.The recombinant protein rGT-4 that the present invention obtains has bioactive.
The present invention also provides the application of this sea anemone cytolysin albumen in preparation prevention or medicine for treating tumor thing.
The recombinant protein rGT-4 that the present invention obtains all has obvious lethal effect, IC to pancreatic cancer cell SW1990 and the human breast cancer cell MCF-7 of vitro culture
50Be respectively 1.32 μ g/mL, 1.71 μ g/mL.
The present invention obtains congestin albumen by recombinant expressed this molecular biological method, has remedied the deficiency of traditional separation purification method, and the development of the utilization of marine drug and anti-cancer agent is had extremely significance.
Description of drawings
Fig. 1 is that pET-22b-gigtIV expression plasmid enzyme is cut evaluation figure
1：Wide?Range?DNA?Marker(100-6,000)(TAKARA)；
2：pET-22b-gigtIV；
3：pET-22b-gigtIV；
4:pET-22b-gigtIV Nde I/Xho I double digestion.
Fig. 2 is the protein induced expression of rGT-4, affinity chromatography electrophorogram
1.BL21-pET-22b-gigtIV total protein (IPTG induces)
2.BL21-pET-22b-gigtIV total protein (not inducing)
3. ultrasonic supernatant
4. ultrasonic supernatant affinity chromatography stream is worn the peak
5. ultrasonic supernatant affinity chromatography 10%B liquid elution peak
6. the rGT-4(20%B liquid elution peak that obtains through affinity chromatography)
7. low molecular weight protein (LMWP) marker (TAKARA).
Fig. 3 is rGT-4 affinity chromatography collection of illustrative plates
1:10%B liquid wash-out;
2:20%B liquid wash-out.
Fig. 4 is the haemolysis graphic representation of rGT-4;
Fig. 5 is that rGT-4 suppresses curve to pancreatic cancer cell SW1990 and human breast cancer cell MCF-7.
Embodiment
Describe the present invention below in conjunction with embodiment.But the following example should not regarded limitation of the scope of the invention as.
Embodiment 1: the structure of restructuring sea anemone cytolysin expression plasmid
Cut the synthetic pair of primers in site according to maturation protein two terminal sequences of gigtIV genes encoding and the multienzyme of prokaryotic expression carrier pET-22b, upstream primer contains Nde I enzyme and cuts sequence (CATATG), downstream primer contains Xho I enzyme and cuts sequence (GGATCC), and sequence is as follows:
Upstream primer: 5 ' AAA
CATATGAGTGCTTCAGAAGTCGCTG 3 ' (SEQ ID NO:3, the line part is cut sequence for Nde I enzyme and do not translated)
Downstream primer: 5 ' TTT
CTCGAGGCGTGAAATCTTAATTTGCAG 3 ' (SEQ IDNO:4, the line part is cut sequence for Xho I enzyme)
Pcr amplification, gene clone are carried out all according to a conventional method.The PCR product is 540bp(SEQ ID NO:1 approximately), 179 amino-acid residues (SEQ ID NO:2) of encoding.Goal gene is cloned into prokaryotic expression carrier pET-22b(available from Novagen company) on, be built into expression plasmid pET-22b-gigtIV.Cut evaluation and sequencing analysis through enzyme, the gene that shows the clone is goal gene (Fig. 1).
Embodiment 2: the expression of restructuring rGT-4
PET-22b-gigtIV is transformed e. coli bl21 (available from Novagen company).Genetic engineering bacterium ultrasonic degradation supernatant liquor shows through the SDS-PAGE electrophoretic analysis, and thalline has obvious specifically expressing product band after inducing, molecular weight conform to the theoretical value 19.7kD of prediction (Fig. 2).
Process is to incubation time, induced concentration, groping of the conditions such as temperature, abduction delivering relatively behind the thalline enlarged culturing different time, the culture condition of the final genetic engineering bacterium of determining is: single colony inoculation is in 50ml amicillin resistance LB liquid nutrient medium (1%(w/v) Tryptones, 0.5%(w/v) yeast extract, 1%(w/v) sodium-chlor) in, 37 ° of C, the 180rpm overnight incubation, get in the LB liquid nutrient medium of amicillin resistance that overnight culture 20ml is inoculated in 2L, 37 ° of C, 180rpm is cultured to OD
600=0.6, sec.-propyl-β-D-sulfo-galactopyranoside (IPTG) to final concentration is 0.4mmol/L to add 100mmol/L, 37 ° of C, centrifugal results thalline behind the 180rpm inducing culture 5h.
Embodiment 3: the purifying of restructuring rGT-4 albumen
Total thalline of results is washed with PBS damping fluid (10mmol/L, pH 7.5), use again A liquid (20mmol/L PBS, 500mmol/LNaCl, the 20mmol/L imidazoles, pH 7.4) suspend, after the supersound process, centrifugal (4 ° of C, 12000rpm, 30min), supernatant liquor is through Ni
2+The affinity chromatography single step purification.
This post is used A liquid balance in advance.The complete rear usefulness B liquid of loading (20mmol/L PBS, 500mmol/LNaCl, the 500mmol/L imidazoles, pH 7.4) gradient elution, and each gradient elution time is 10min, flow velocity is 1ml/min.Restructuring rGT-4 is eluted (Fig. 3) at 20%B liquid, rGT-4 is kept at-75 ° of C.Other takes a morsel and carries out the SDS-PAGE analysis, shows that its molecular weight is about 19KD and purity reaches (Fig. 2) more than 90%.
Embodiment 4: the hemolytic activity of restructuring rGT-4 albumen
Get the ripe human blood of 1ml, use 20mL PBS(10mmol/L, pH 7.5) rinsing, the centrifugal 5min of 3000 * g abandons supernatant, uses PBS rinsing 2 ~ 3 times limpid to supernatant again, abandons supernatant, then red corpuscle and PBS is pressed 1:50 and dilutes, and namely is prepared into 2% red cell suspension.Get red cell suspension 0.5mL, then add certain density rGT-4 sample, reaction cumulative volume 1.5mL.Establish in addition negative control (not adding toxin), positive control (0.5%Triton X-100) for every group.At 37 ℃ of oscillation incubation 30min, then the centrifugal 5min of 3000 * g gets supernatant and detect 420nm absorbance (repeating 3 times) in 96 orifice plate behind the application of sample.Calculate the haemolysis mark with following formula:
The haemolysis mark=[(sample hose absorbance-negative control pipe absorbance)/(positive control pipe absorbance-negative control pipe absorbance] * 100%.
The result shows when the concentration of rGT-4 is 90ng/ml, can cause 50% erythrocyte hemolysis, illustrates that this cytolysin has very strong hemolytic activity (Fig. 4).
Embodiment 5: restructuring rGT-4 albumen is to the effect of the tumour cell of vitro culture
Mtt assay detects rGT-4 to the retarding effect of tumor cell proliferation.Take the MCF-7 of logarithmic phase
(available from cell institute of the Chinese Academy of Sciences) or SW1990 cell (available from cell institute of the Chinese Academy of Sciences) are with 1 * 10
6The density of/mL is inoculated in 96 orifice plates, every hole 100 μ l.Negative control group, experimental group and blank group are established in experiment, establish 5 multiple holes, 37 ℃, 5%CO for every group
2Overnight incubation in the saturated humidity incubator adds respectively the substratum 100 μ l that contain medicine or do not contain medicine, continues to cultivate 24h, microscopic examination, then every hole adds MTT solution (5mg/mL) 20 μ l, continues to hatch 4h, stop to cultivate, carefully draw in the hole culture supernatant and discard.In every hole, add again 150 μ l DMSO, shaking table gentle agitation 10min, the dissolve purple crystallization places microplate reader, and light absorption value is detected at 570nm wavelength place, calculates the inhibiting rate of recombinant protein rGT-4 cell growth by following formula:
Inhibiting rate (%)=[(negative control group A
570-experimental group A
570)/(negative control group A
570-blank group A
570)] * 100%
Experimental group: contain substratum, the MTT of cell, the rGT-4 group of different concns (0,1,2,5,10,15,20 μ g/mL).
Negative control group: the substratum, MTT, the PBS group that contain cell.
Blank group: the substratum, the MTT group that do not contain cell and medicine.
Mtt assay detects rGT-4 the result of the retarding effect of tumor cell proliferation is shown, after the rGT-4 experimental group of different concns is cultivated 24h, the propagation of SW1990 cell and MCF-7 cell is all had restraining effect, IC
50Be respectively 1.32 μ g/mL and 1.71 μ g/mL(Fig. 5).
Above demonstration and described ultimate principle of the present invention, principal character and advantage of the present invention.The technician of the industry should understand; the present invention is not restricted to the described embodiments; that describes in above-described embodiment and the specification sheets just illustrates principle of the present invention; the present invention also has various changes and modifications without departing from the spirit and scope of the present invention, and these changes and improvements all fall in the claimed scope of the invention.The claimed scope of the present invention is defined by appending claims and equivalent thereof.
Claims (5)
1. the recombinant expression method of a sea anemone cytolysin albumen, the method may further comprise the steps:
The structure of A, restructuring sea anemone cytolysin expression plasmid:
Design and synthesize pair of primers as follows:
Upstream primer shown in SEQ ID NO:3,
Downstream primer shown in SEQ ID NO:4,
Pcr amplification, the PCR product is cloned into goal gene on the prokaryotic expression carrier pET-22b shown in SEQ ID NO:1, is built into expression plasmid pET-22b-gigtIV;
B, restructuring sea anemone cytolysin rGT-4 protein expression:
PET-22b-gigtIV is transformed e. coli bl21, express Cnidarian cytotoxin rGT-4 albumen, aminoacid sequence is shown in SEQ ID NO:2.
2. the recombinant expression method of a kind of sea anemone cytolysin albumen according to claim 1, it is characterized in that, among the step B, pET-22b-gigtIV is transformed e. coli bl21, and culture condition is: single colony inoculation in 50ml amicillin resistance LB liquid nutrient medium, 37 ° of C, the 180rpm overnight incubation, get in the amicillin resistance LB liquid nutrient medium that overnight culture 20ml is inoculated in 2L, 37 ° of C, 180rpm is cultured to OD
600=0.6, adding 100mmol/L IPTG is 0.4mmol/L to final concentration, 37 ° of C, centrifugal results thalline behind the 180rpm inducing culture 5h;
Described amicillin resistance LB liquid culture based formulas is: 1%w/v Tryptones, 0.5%w/v yeast extract, 1%w/v sodium-chlor, 0.01%w/v penbritin.
3. the recombinant expression method of a kind of sea anemone cytolysin albumen according to claim 1 is characterized in that, the method also comprises the purifying of step C, restructuring sea anemone cytolysin rGT-4 albumen:
With total thalline 10mmol/L of step B results, the washing of the PBS damping fluid of pH 7.5 suspends with A liquid again, after the supersound process, and 4 ° of centrifugal 30min of C, 12000rpm, supernatant liquor is through Ni
2+The affinity chromatography single step purification;
This post is used A liquid balance in advance, the complete rear B liquid gradient elution of using of loading, and each gradient elution time is 10min, flow velocity is 1ml/min; Restructuring rGT-4 is eluted at 20%B liquid, rGT-4 is kept at-75 ° of C;
Described A liquid: 20mmol/L PBS, 500mmol/LNaCl, the 20mmol/L imidazoles, pH 7.4;
Described B liquid: 20mmol/L PBS, 500mmol/L NaCl, the 500mmol/L imidazoles, pH 7.4.
4. the sea anemone cytolysin albumen that obtains of the recombinant expression method of arbitrary described a kind of sea anemone cytolysin albumen according to claim 1-3.
5. the application of sea anemone cytolysin albumen according to claim 4 in preparation prevention or medicine for treating tumor thing.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012104109292A CN102925472A (en) | 2012-10-25 | 2012-10-25 | Recombinant expression of actinoporins proteins |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012104109292A CN102925472A (en) | 2012-10-25 | 2012-10-25 | Recombinant expression of actinoporins proteins |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102925472A true CN102925472A (en) | 2013-02-13 |
Family
ID=47640401
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2012104109292A Pending CN102925472A (en) | 2012-10-25 | 2012-10-25 | Recombinant expression of actinoporins proteins |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102925472A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105399835A (en) * | 2015-12-02 | 2016-03-16 | 华东理工大学 | Recombinant immunotoxin Gigantoxin-4-4D5 scFv and preparation method and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1405311A (en) * | 2002-09-03 | 2003-03-26 | 中山大学 | Cnidarian cytotoxin gene and its expression and application |
-
2012
- 2012-10-25 CN CN2012104109292A patent/CN102925472A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1405311A (en) * | 2002-09-03 | 2003-03-26 | 中山大学 | Cnidarian cytotoxin gene and its expression and application |
Non-Patent Citations (2)
| Title |
|---|
| HU ET AL: "Purification and Characterization of Gigantoxin-4, a New Actinoporic from the Sea Anemone Stichodactyla Gigantea", 《INT.J.BIOL.SCI.》 * |
| 刘伟 等: "海葵溶细胞素的研究进展", 《海洋科学》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105399835A (en) * | 2015-12-02 | 2016-03-16 | 华东理工大学 | Recombinant immunotoxin Gigantoxin-4-4D5 scFv and preparation method and application thereof |
| CN105399835B (en) * | 2015-12-02 | 2019-07-12 | 华东理工大学 | Recombinant immunotoxin Gigantoxin-4-4D5 scFv and its preparation method and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106135285B (en) | Application of the Rhodopseudomonas palustris biocontrol agent in prevention and control rice blast | |
| CN109169702B (en) | Nano RNAi preparation and preparation method and application thereof | |
| CN101173005A (en) | Insect antimicrobial peptide Thanatin derivant, producing method and uses of the same | |
| CN101173004A (en) | Insect antimicrobial peptide Thanatin and method for producing deletion mutant thereof | |
| CN107987153A (en) | The soluble PD-1 molecules of high-affinity | |
| CN115044505B (en) | Antibacterial lipopeptid produced by bacillus bailii and application of antibacterial lipopeptid in cosmetics and foods | |
| CN105801680B (en) | A kind of grouper piscidin4 polypeptide and its application | |
| CN101418039B (en) | Novel antibacterial peptide and preparation method and use thereof | |
| CN104630111B (en) | The separation method and application of one bacillus amyloliquefaciens and its active metabolite | |
| CN102174097B (en) | Actinoporin and application thereof | |
| CN105566484A (en) | Novel recombinant perforin protein and preparation method and application thereof | |
| CN110669114B (en) | Lanthionine precursor peptide amyA6, and preparation method and application thereof | |
| CN102925472A (en) | Recombinant expression of actinoporins proteins | |
| CN105504063B (en) | The antineoplastic amalgamation protein of a kind of alexin-albumin and its preparation and application | |
| CN102816223B (en) | Brachymystax lenok Cathelicidin antimicrobial peptide CATH_BARLE, and gene, preparation and application thereof | |
| CN113527461B (en) | Horseshoe head bats source antibacterial peptide RF-CATH1 and application thereof | |
| CN110923289B (en) | Screening method of drug for treating citrus greening disease | |
| CN102115496A (en) | Antimicrobial peptide Pc-CATH1 and gene thereof, chemical synthesis method and application thereof | |
| CN103467580B (en) | Preparation method and application of artificial antimicrobial peptide MA-D4 | |
| CN106188242A (en) | The application in the medicine of preparation suppression tubercule bacillus of a kind of Novel ring peptide compounds | |
| CN101845092A (en) | Antimicrobial peptide Ea-CATH1 of Equus asinus and genes and application thereof | |
| CN112315962A (en) | Application of mycophenolic acid in treating and preventing coxsackie virus infection | |
| CN101921820B (en) | Preparation method of recombinant tumor specificity antiapoptotic factors with activity and application of products thereof | |
| CN109251929A (en) | A kind of siRNA interfering striped rice borer chitinase gene CsCht10 | |
| CN102657852A (en) | Medical composition of recombinant Wautersiella asparaginase and preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20130213 |