CN104630111B - The separation method and application of one bacillus amyloliquefaciens and its active metabolite - Google Patents
The separation method and application of one bacillus amyloliquefaciens and its active metabolite Download PDFInfo
- Publication number
- CN104630111B CN104630111B CN201510064245.5A CN201510064245A CN104630111B CN 104630111 B CN104630111 B CN 104630111B CN 201510064245 A CN201510064245 A CN 201510064245A CN 104630111 B CN104630111 B CN 104630111B
- Authority
- CN
- China
- Prior art keywords
- bacillus amyloliquefaciens
- bax030
- bacillus
- cell
- separation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
- C12R2001/07—Bacillus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
- C12N1/205—Bacterial isolates
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/10—Animals; Substances produced thereby or obtained therefrom
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/66—Microorganisms or materials therefrom
- A61K35/74—Bacteria
- A61K35/741—Probiotics
- A61K35/742—Spore-forming bacteria, e.g. Bacillus coagulans, Bacillus subtilis, clostridium or Lactobacillus sporogenes
Abstract
The separation method and application of one bacillus amyloliquefaciens and its active metabolite, the present invention relates to strain be bacillus amyloliquefaciens BaX030, Bacillus amyloliquefaciens BaX030, the strain is in China typical culture collection center preservation, and culture presevation number is CCTCC NO：M 2014159.Present invention additionally comprises the separation of the active metabolite of bacillus amyloliquefaciens and application.Bacillus amyloliquefaciens active metabolite of the present invention has the antibacterial and anti-tumor biological of wide spectrum.
Description
Technical field
The present invention relates to the separation method and application of a bacillus amyloliquefaciens and its active metabolite, especially relate to
And one plant of antitumor wild-type strain of high-efficiency antimicrobial (Bacillus amyloliquefaciens BaX030) and its active metabolism
The separation method of product and application.
Background technology
Bacillus amyloliquefaciens are a kind of aerobic sporiferous Gram-positive bacillus, and the bacterium is wide in distributed in nature
General, easily separated culture is nontoxic to people and animals, free from environmental pollution.With abundant own metabolism product, low molecule can be produced
The antibiotic and antiseptic protein polypeptide of amount, such as EAFP (Kimet al, 2004) Surfactin (Mikkolaet
Al, 2004；Souto et al, 2004), iturin (Hiradateet al, 2002；Yuet al, 2002), chitin
Enzyme (Wanget al, 2002) amylase protein enzyme etc..Existing studies have shown that bacillus amyloliquefaciens are to various plants pathogen
Have inhibitory action, Mohamed etc. is combined bacillus amyloliquefaciens with 1- methyl cyclopropenes papaya is handled after, find
It can reduce in cold storage procedure (10 DEG C, 85% relative humidity, 14 days) anthracnose and Phomopsis soft rot the incidence of disease and
Disease index, and the after-ripening process of delayed fruit, help to maintain the hardness of fruit and overall quality.Alvindia etc. is from banana table
The bacillus amyloliquefaciens DGA14 of face separation has stronger inhibitory action to banana crown rot.Hao Jianan etc., which is studied, to be shown, Xie Dian
Afnyloliquefaciens NK10.BAhjaWT bacterial strains are to Fusarinm solani (Fusarinmsolani), Rhizoctonia solani Kuhn, aspergillus niger, black
A variety of fungies such as acne germ (ElsinoeampelinaShear) have good inhibiting effect, wherein the suppression to hemorrhagic black smallpox germ
Preferably, biocontrol effect reaches 80.3% to effect.Hao Wei is peaceful etc. to have studied bacillus amyloliquefaciens to Citrus, the preventing and treating of green mould
Effect, the live body inoculation test to sugar orange shows, bacterial strain HC-03 zymotic fluid, bacteria suspension and ferment filtrate processing citrus are green
The incidence of mildew is below 20%, and lesion diameter is in below 10mm.Chen Yanhong etc. from morbidity banana garden banana rhizosphere soil
Middle separation obtains a bacillus amyloliquefaciens R21g9, and the bacterial strain not only has stronger to the different strains of banana blight bacteria
Rejection ability, also to watermelon blight pathogen (F.oxysporum f.sp.niveum), mango blossom-end rot pathogen
The plant pathogenic fungi such as (Botryodiplodia theobromae Pat) and Curvuluria Iunata (Curvularialunata) has
Stronger inhibitory action.
In recent years, bacillus (Bacillus) can produce the microbe groups of abundant metabolite as a class, increasingly
It is taken seriously.Bacillus is widely used in control of insect, fraction of pathogens bacterium as probiotics and suppressed and cytotoxicity three
Individual aspect, but in terms of research has focused largely on biological control, it is less for its antitumor activity relevant report.Weigh below
Point introduces the correlative study of bacillus anti-tumor aspect.
Current malignant tumour turns into the No.1 disease for threatening human health, seriously endangers human health, antineoplaston
Increasingly show its importance.New treatment means and curative effect specificity are the focuses of Medical circle research.Bacillus is one
Plant entomopathogenic bacterium.In recent years, studies have found that the bacillus of some non-insecticidal activities can produce inhibiting tumor cell activity
The some cancer cells of the mankind are had cytotoxicity by metabolin.It is now as follows to the antitumor Summary of Research Progress of this kind of bacillus.
Thuringiensis
Japanese scholars Mizuki was found that to phosphorus wing order and Diptera without insecticidal activity but to external first equal to 1999
The human leukemia T cell (MOLT-4) and human hela passage cell (Hela) of culture have the Bt bacterial strains of lethality.2000
Year, Mizuki etc. carries out analysis of physical and chemical property to the albumen being separated to, it is found that such companion cell protein sequence contains Bt companion cells brilliant
5 shared conservative regions of body protein, but it is very low (＜ 25%) with other existing Cry and Cyt albumen homologies, only in pancreas
In the presence of protease and Proteinase K, active fragment is degraded to, this albumen just can optionally kill MOLT-4 and HeLa, and
To normal cell without effect, companion cell element is named as parasporin (PS) first.Untill up to now, isolated PS
Albumen is mainly divided into 6 groups of 18 classes.
Bacillus amyloliquefaciens
Microbiological Lab of Hua Zhong Agriculture University in 2011 finds one plant of bacillus amyloliquefaciens for having lethality to tumour
WH1, by the isolated lipopeptide surfactant to fermented supernatant fluid, it has been investigated that, lipopeptid is directly contacting tumour
In the case of cell, activity of tumor cells can be suppressed by way of cell lysis or inducing cell apoptosis, and work as fat
When the concentration of peptide is more than 50ug/mL, lipopeptide surfactant has obvious extracorporeal suppression tumor cell activity.Author in research
The specific molecular structure of antitumor activity thing is not determined, and it is Surfactin (Surfactin) simply to speculate the active matter
Class lipopeptid, the molecular structure of Surfactin class lipopeptid is that HanYetal etc. determined (the chemistry knot of the compound in 2008
Structure is 7 peptide compounds and C14-C15 hydroxy fatty acid chain, and the two passes through beta-hydroxy and carboxyl and peptide chain terminal groups
Group forms lactones cyclic structure, and molecular weight is in 1000Da or so), while author does not also carry out broad-spectrum anti-tumor to the active matter
Activity research, desk study active matter is thin to other tumours to a kind of activity of tumour cell of mouse S180 ascites sarcoma
Born of the same parents system has no research.
Bacillus subtillis
Life Science and Technology institute of China Medicine University in 2013 finds that what CLPs can be selective acts on MCF-7 cells
And there is no toxicity to normal cell HELF, research finds that effect of the cyclic lipopeptide to the cancer cell of in vitro culture is mainly and after birth knot
Close, form ion channel, hole occur, cause intracellular is tolerant to leak, Cellular DNA Fragmentation.Damage of the lipopeptid to cell DNA is production
One major reason of raw CDCC.In addition, cyclic lipopeptide can also transfer the immunity function of body, in terms of humoral immunity
To resist the invasion of carcinoma.
Bacillus cereus
Functional dairy products key lab of the Ministry of Education of Food Science and Engineering institute of China Agricultural University in 2008 finds waxy
The extracellular protein that bacillus ZH-14 is produced is to tumour cell S-180 inhibiting rate more than 43.6%.
Other
It is extracellular that Microbiological Lab of Guangxi University in 2005 finds that marine bacteria Bacillus pumilus PLM4 are produced
Polysaccharide is notable to human laryngeal cancer Hep-2 cytoactives.The tortoise field professor (1967) of Kanazawa, Japan University Medical institute passes through zoopery
It was found that growth of the Bacillus nattoSawamura to animal is harmless, and with the function of suppressing growth of cancer cells.Pass through Cell culture invitro
It is a straight chain saturation alkane containing 30~32 carbon that experiment, which further discloses this anti-cancer active matter, wherein active highest, content
Maximum is 31 carbon hydrocarbon.Also contain many active materials such as saponin, vitamin B2 vitamin E etc. in natto, daily food
With internal carcinogen, the generation of pre- anti-cancer can be removed.Although the relevant antineoplastic research starting of bacillus is more early,
It is few for the antineoplastic research of bacillus amyloliquefaciens.
The content of the invention
The technical problem to be solved in the present invention is to overcome the deficiencies in the prior art to have broad-spectrum antibacterial with resisting there is provided one plant
Tumor promotion, and the separation method of the antibacterial and preferable bacillus amyloliquefaciens of antitumor activity and its active metabolite is with answering
With.
The present invention solve its technical problem use technical scheme be：
The bacillus amyloliquefaciens of the present invention, are bacillus amyloliquefaciens BaX030 (Bacillus
Amyloliquefaciens BaX030), the strain is on April 24th, 2014 in China typical culture collection center (abbreviation
CCTCC, address：Wuhan, China Wuhan University) preservation, culture presevation number is CCTCC NO：M 2014159.
The bacillus amyloliquefaciens BaX030 (Bacillus amyloliquefaciens BaX030) of present invention separation
Identification：Using the method such as heating water bath and dilution plate coating, one is directly isolated to obtain in the soil sample gathered from Henan peanut
Strain has the bacterium of bacillus amyloliquefaciens character, through colony morphological observation, Gram's staining, physiological and biochemical property, 16S
RRNA Genetic homology of carbapenem-resistant, identifies that the bacterial strain belongs to for Bacillus, and amyloliquefaciens kinds are named as solution starch bud
Spore bacillus BaX030 (Bacillus amyloliquefaciens BaX030).
Antibacterial and anti-tumor biological：
Bacillus amyloliquefaciens BaX030 after fermented and cultured 48h, is centrifuged in 1L shaking flasks, supernatant is collected, enters action and plant
The antibacterial and cytotoxicity experiment of thing pathogenic bacteria.
Antitumor activity thing is isolated and purified：By bacillus amyloliquefaciens BaX030 in LB culture mediums, in 30 DEG C,
After 160-170rpm/min, shaken cultivation 48h, 8000-12000rpm/min centrifugations 15min；Collect fermented supernatant fluid, mistake
0.22 μm of filter membrane, obtains sterile fermented supernatant fluid；Initial gross separation is carried out on protein purification instrument, is collected with bioactivity
Component；Further isolated and purified using high performance liquid chromatograph, obtain active metabolite.
During initial gross separation, gel column used is preferably the sephadex columns of Superdex 200 on protein purification instrument.
When further isolating and purifying, chromatographic column used is preferably C18 reverse-phase chromatographic columns in the high performance liquid chromatograph.
Further, condition when further being isolated and purified with high performance liquid chromatograph：Pillar model：ZORBAX SB-C18
9.4 × 150mm 5um, mobile phase：Water, methanol, flow velocity：4mL/min, applied sample amount：80 μ L, operation method：0-4min methanol
5%-50%, 4-7min methanol 50%-80%, 7-10min methanol 80%-100%, 10-12min methanol 100%, 12-13min
Methanol 5%.
At present, chromatographic technique has been widely used in the separation and analysis of opsonigenous substance, such as Pradip Kumar
Singh etc. is plain using liquid chromatogram separation Bacillus bacteria, and David C etc. obtain thuringiensis with chromatographic technique
EAFP.Although chromatographic technique is with very frequent, because the strain being related to is different different with obtained active material, point
It is also just different from condition.
It is anti-swollen through LC-MS/MS using the metabolite of bacillus amyloliquefaciens BaX030 obtained by above isolation and purification method
Tumor activity is identified, it was demonstrated that：With preferable antitumor activity；With preferable bacteriostasis, antimicrobial spectrum is wide, to a variety of dynamic
Plant pathogen is inhibited.
Bacillus amyloliquefaciens as important biocontrol microorganisms, its sphere of action cover Rhizoctonia solani Kuhn, banana blight bacteria,
The various plants disease funguses such as watermelon blight pathogen, mango blossom-end rot pathogen and Curvuluria Iunata, but for the present invention
The sharp born of the same parents' anthrax bacteria of the pathogenic bacteria staphylococcus aureus that is related to, Candida albicans, saccharomycete and plant pathogenic fungi capsicum,
Loquat anthrax bacteria, which yet there are no, reports for work.Although the relevant antineoplastic research starting of bacillus is more early, for solution starch gemma
The antineoplastic research of bacillus is few, the Surfactin class that only Hua Zhong Agriculture University produces on bacillus amyloliquefaciens at present
The report of lipopeptid antitumor activity correlative study, its Surfactin class lipopeptid is sensitive to temperature and pH, while Surfactin
Lipoid peptide molecular weight is in 1000Da or so, and this has essence with temperature-resistant small molecule, anti-tumor active matter in the present invention
Difference.Antitumor activity thing molecular weight in the present invention is 122.14, also entirely different with Surfactin lipoid peptide molecular weight.
Brief description of the drawings
Fig. 1 is phase contrast microscope shapes of the bacterial strain Bacillus amyloliquefaciens BaX030 after isolating and purifying
State characteristic pattern；
Fig. 2 is ESEM forms of the bacterial strain Bacillus amyloliquefaciens BaX030 after isolating and purifying
Characteristic pattern；
Fig. 3 is bacillus amyloliquefaciens BaX030 strain growth curve maps；
Fig. 4 is temperature to Bacillus amyloliquefaciens BaX030 fermented supernatant fluid bacteriostatic activities thing activity
Influence figure (in figure 1 be staphylococcus aureus, 2 be Candida albicans, and 3 be saccharomycete)；
Fig. 5 is pH to Bacillus amyloliquefaciens BaX030 fermented supernatant fluid bacteriostatic activities thing activity
Influence figure (1 is staphylococcus aureus in figure, and 2 be Candida albicans, and 3 be saccharomycete)；
Fig. 6 is Bacillus amyloliquefaciens BaX030 strains on plant pathogens Pyricularia oryzae, capsicum point
Born of the same parents' anthrax bacteria, loquat anthrax bacteria, the influence figure of Phytophthora nicotianae state；
Fig. 7 is toxic effect figure of the fermented supernatant fluid to B16 cells of various concentrations；
Fig. 8 is toxic effect figure of the fermented supernatant fluid after treatment of different temperature to B16 cells；
Fig. 9 is that AKTA Purifier10 isolating active components B5 is thin to Hep-3B, 4T1, HT29, Hela, B16 and HUVEC
The broad-spectrum anti-tumor activity detection figure of born of the same parents；
Figure 10 be AKTA Purifier10 isolating active component B5 to Hela, B16, Hep-3B and HUVEC cytoactives
MTT determines figure；
Figure 11 is initial gross separation figure of the fermented supernatant fluid on AKTA Purifier10；
Figure 12 is separation figure of the active component of initial gross separation collection on the Infinity of Agilent 1260；
Figure 13 is isolated each unimodal determination of activity figure；
Figure 14 is the first mass spectrometric result figure of antitumor activity thing；
Figure 15 is the second order mses result figure of antitumor activity thing.
Microbial preservation situation explanation
Bacillus amyloliquefaciens BaX030 (Bacillus amyloliquefaciens BaX030), the strain is in 2014
On April 24, in is in China typical culture collection center (abbreviation CCTCC, address：Wuhan, China Wuhan University) preservation, bacterium
It is CCTCC NO to plant preserving number：M 2014159.
Embodiment
The present invention is described in further detail below in conjunction with specific embodiment.
Embodiment
1. the bacillus amyloliquefaciens BaX030 (Bacillus amyloliquefaciens BaX030) of the present embodiment,
The strain is on April 24th, 2014 in China typical culture collection center (abbreviation CCTCC, address：Wuhan, China Wuhan
University) preservation, culture presevation number is CCTCC NO：M 2014159.
2. bacillus amyloliquefaciens BaX030 strain isolation processes of the present embodiment：Soil sample is gathered from Henan peanut, plus
Enter sterilized water, mix, 80 DEG C of heating 30min take appropriate homogenate to be coated on LB flat boards, 48h cultivated under the conditions of 30 DEG C, from flat board
Upper picking single bacterium colony dilutes again to be lined on LB flat boards, cultivates 48h under the conditions of 30 DEG C, the single bacterium colony that repeated isolation is purified to
It is inoculated into LB fluid nutrient medium shaking flasks, 30 DEG C, 160rpm/min, cultivates 12h, 50% glycerine is mixed, long-term in -80 DEG C of refrigerators
Preservation.
3. light microscope and electron microscope observation：
Specific implementation process：Bacillus amyloliquefaciens BaX030 are taken to cultivate 24h bacterium solution 1.5mL,
Supernatant is removed in 9000rpm/min, 3min, centrifugation, and distilled water is cleaned twice, and thalline is resuspended with 200 μ L distilled waters, draws 10 μ L bacterium
Drop is in slide center, covered, in the form of 100 times of oily Microscopic observation thalline.Take bacterium solution 1.5mL, 9000rpm/
Supernatant is removed in min, 3min, centrifugation, and PBS is washed 6-8 times, and thalline finally is resuspended with 200 μ L PBSs, add etc.
Amount glutaraldehyde is fixed, and thalli morphology is observed under a scanning electron microscope.
Fig. 1 and Fig. 2 are morphological features of the bacterial strain Bacillus amyloliquefaciens BaX030 after isolating and purifying
Figure.Wherein Fig. 1 is phase contrast microscope figure, and it is shaft-like production brood cell bacterium as a result to show the bacterial strain.Fig. 2 is scanning electron microscope (SEM) photograph, through seeing
Examine, its length is 2-3 μm, and width is 1-2 μm, and the generation of brood cell is can see in brood cell's acquisition time.
4. Bacillus amyloliquefaciens BaX030 bacterial strains 16S rRNA DNA homolog sequence analyses：
Specific implementation process：From picking single bacterium colony on LB flat boards, the 1.5mL containing 1.4mL LB fluid nutrient mediums is transferred to
In Ep pipes, aperture is pricked with syringe needle in lid, 30 DEG C, 1000rpm/min after shaken cultivation 24h, uses bacterial gene
Group DNA extraction kit, full-length genome extraction is carried out by operating procedure.Draw according to the design of bacterial 16 S rRNA gene orders is general
Thing (Bf-F, AGAGTTTGATCCTGGCTCAG；Bf-R, ACGGCTACCTTGTTACGACTT) and by the biological skill of raw work (Shanghai)
Art Co., Ltd synthesizes.
16S rRNA gene magnifications are carried out by following reaction system and reaction condition：
Reaction system (20 μ L)：Aseptic double-distilled water, 12 μ L；5XBuffer, 4 μ L；DNTP, 1.6 μ L；Bf-R (10 μM), 0.6
μL；Bf-F (10 μM), 0.6 μ L；Genomic templates, 1 μ L；Pyrobest DNA Polymerase, 0.2 μ μ L；
Response procedures：94 DEG C of 4min of pre-degeneration, are denatured 94 DEG C of 30s, and anneal 52 DEG C of 30s, 72 DEG C of 90s of extension, 30 circulations,
Extend 72 DEG C of 10min.
PCR primer delivers the biological skill of Shanghai English fine horse through multifunctional dna purifying QIAquick Gel Extraction Kit purifying together with appropriate primer
Art Co., Ltd is sequenced.Sequencing result shows isolated strains Bacillus amyloliquefaciens BaX030 16S
RRNA gene orders length is 1513bp.By the Bacillus amyloliquefaciens BaX030 measured 16S rRNA
Gene order, and in American National Biotechnology Information center (NCBI, http://www.ncbi.nlm.nih.gov) in
The 16S rRNA gene orders of 21 Bacillus (Bacillus sp.) different strain that Blast is obtained carry out homology ratio
To analysis, analysis result shows that the bacterial strain belongs to Bacillus, respectively with Bcillus amyloliquefaciens SQR9
(CP006890.1)、Bcillus amyloliquefaciens UCMB5033(HG328253.1)、Bacillus
amyloliquefaciens BCRC17038(DQ993675.1)、Bacillus amyloliquefaciens FZB42
(CP000560.1)、Bacillus amyloliquefaciens CC178(CP006845.1)、Bacillus
amyloliquefaciens UCMB5113(HG328254.1)、Bcillus amyloliquefaciens M7J
Etc. (AB735985.1) similitude highest, is 99%.Speculate that the bacterial strain belongs to Bcillus according to BLAST acquired results
Amyloliquefaciens subspecies, are named as Bacillus amyloliquefaciens BaX030 and phylogenetic tree construction
(Replications=1000, Bootstrap value take percentage).
5. Bacillus amyloliquefaciens BaX030 growth curve is determined：
LB culture mediums：1g sodium chloride, 1g peptones, 0.5g dusty yeasts, 2g agar (fluid nutrient medium is not added with), add water constant volume
To 100mL, pH 7.0；
Specific implementation process：From picking single bacterium colony on LB flat boards, the 1.5mL containing 1.4mL LB fluid nutrient mediums is transferred to
In Ep pipes, aperture is pricked with syringe needle in lid, 30 DEG C, 1000rpm/min, after shaken cultivation 12h, by 1% transfer in
In 50mL LB culture mediums, 30 DEG C, 170rpm/min, shaken cultivation, the sampling per 4h determines OD600Value.
Bacillus amyloliquefaciens BaX030 strain growths curve is as shown in figure 3, Bacillus amyloliquefaciens
BaX030 growth lag phase is about 12h, and 12-24h is Exponential growth stage, and it after stationary phase, 32h is decline phase that 24-32h, which is,.It is raw
Long curve determination result illustrates the growth cycle and known brood cell's bar of Bacillus amyloliquefaciens BaX030 bacterial strains
The bacteria growing cycle is basically identical, and the bacterial strain antibacterial and antitumor activity are understood referring concurrently to its growth cycle and bioactivity research
Thing has substantial amounts of accumulation in decline phase.
6. the Antibacterial Activity of Bacillus amyloliquefaciens BaX030 bacterial strains：
Specific implementation process：Detect Bacillus amyloliquefaciens BaX030 to aerogenesis using filter paper enzyme
Enterobacteria, Bacillus subtillis, staphylococcus aureus, Candida albicans, saccharomycete, salmonella typhimurium and Pseudomonas aeruginosa
Fungistatic effect.Take Bacillus amyloliquefaciens X030 bacterial strain 48h fermented supernatant fluids (fermentation process and growth
Incubation during curve determination is identical, and 48h fermented supernatant fluids are directly to centrifuge 48 hours zymotic fluid 8000rpm of bacterial strain
30min is taken obtained by supernatant) (48h is the decline phase of the strain culturing, and metabolite can largely be accumulated in supernatant) difference
5-10 μ L are respectively taken to be used for bacteriostatic test after thermograde 40,60,80,100 DEG C of processing 1h；Separately take Bacillus
Amyloliquefaciens X030 bacterial strain 48h fermented supernatant fluids are adjusted after handling 1h through pH gradient 1,3,5,7,9,10,13 respectively
PH is to neutrality, and (Temperature Treatment and pH processing 48h fermented supernatant fluids are independent and non-interfering two experiments, it is therefore an objective to respectively
Probe into the influence of temperature and pH to bacteriostatic activity thing activity in 48h fermented supernatant fluids), respectively take 5-10 μ L to be used for bacteriostatic test, use
Slide measure detects fungistatic effect.
Using flat board opposite culture method, in PDA plate center inoculated plant disease fungus rice blast fungus mycelia,
Capsicum point born of the same parents' anthrax bacteria mycelia, loquat anthrax bacteria mycelia, cucumber phytophthora root rot bacterium mycelia, Rhizoctonia solani Kuhn mycelia, rape
Add 5-10 μ L bacterium solutions (Bacillus at hyphal cluster germ mycelia and tobacco black shank bacterium mycelia, each 2cm in distance center both sides
Amyloliquefaciens X030 bacterial strain 48h fermented supernatant fluids), 28 DEG C are inverted culture 7-15d, with control group (control group：With
Above-described various plant pathogenic fungis are inoculated with PDA plate center for same method and training method is same, but
It is not added with bacterium solution) comparative observation disease fungus growth result, and observe the disease fungus bacterium by antagonism using phase contrast microscope
Silk.Fig. 4 is influence of the temperature to Bacillus amyloliquefaciens BaX030 fermented supernatant fluid bacteriostatic activities thing activity
Figure；Fig. 5 is influences of the pH to Bacillus amyloliquefaciens BaX030 fermented supernatant fluid bacteriostatic activities thing activity
Figure；Fig. 6 is Bacillus amyloliquefaciens BaX030 strains on plant pathogens Pyricularia oryzae, the sharp born of the same parents' charcoal of capsicum
Subcutaneous ulcer germ, loquat anthrax bacteria, the influence figure of Phytophthora nicotianae state.Result of study shows Bacillus
Amyloliquefaciens BaX030 fermented supernatant fluids have preferably to staphylococcus aureus, Candida albicans, saccharomycete
Inhibition, inhibition is best at normal temperatures, and active matter still has certain activity after high-temperature process (referring to Fig. 4)；
The activity of bacteriostatic activity thing is almost consistent with the activity of the bacteriostatic activity thing under neutrallty condition under strong acid treatment, at highly basic
Bacteriostatic activity thing activity after reason reduces but still remains with certain activity (referring to Fig. 5)；While Bacillus
Amyloliquefaciens BaX030 bacterial strains are to Pyricularia oryzae, the sharp born of the same parents' anthrax bacteria of capsicum, loquat anthrax bacteria, the black shin of tobacco
Germ generates obvious antagonism (referring to Fig. 6).Bacillus is understood by result above result
Amyloliquefaciens BaX030 produce bacteriostatic activity thing be probably the more stable acid resistance small molecule of structure (after testing
It is 182.09) material to determine its molecular weight.
7. the antitumor cytolytic activity of Bacillus amyloliquefaciens BaX030 bacterial strains：
Specific implementation process：Bacillus amyloliquefaciens BaX030 bacterial strain 48h zymotic fluid (48h zymotic fluids
Strain culturing method of acquisition methods when being determined with growth curve it is consistent) in refrigerated centrifuge (8000rpm) centrifuge
15mim, crosses 0.22 μm of filter membrane and obtains sterile fermented supernatant fluid.By B16 mouse melanoma cell line with 104The number in individual/every hole
(100 μ L) is laid in 96 orifice plates respectively, is placed in 37 DEG C, 5%CO2Quiescent culture 24h, makes cell attachment in cell constant temperature incubator
Growth, is separately added into 2,4,6,8,10 μ L sterile fermented supernatant fluid and the sterile fermentation through 40, after 60,80,100 DEG C of processing 1h
The μ L of supernatant 10, separately set control group (the i.e. CK of control, plus culture 48h do not connect the fermented supernatant fluid of bacterium), control group and sterile fermentation
Supernatant respectively sets 3 repetitions, continues to cultivate 24h.Changed with inverted microscope observation cancer cell.Fig. 7 is the sterile of various concentrations
Toxic effect figure of the fermented supernatant fluid to B16 cells；Fig. 8 is sterile fermented supernatant fluid after treatment of different temperature to B16 cells
Toxic effect figure.Result of study shows that Bacillus amyloliquefaciens BaX030 fermented supernatant fluids are sent out in 2 μ L
Can be rounded B16 cell shrinkages under the processing of ferment supernatant, and the cell being rounded with the rise shrinkage of concentration can gradually increase simultaneously
There is cell cracking (referring to Fig. 7).Sterile fermented supernatant fluid under treatment of different temperature is to cytotoxicity without substantially poor
It is different, all with stronger cytotoxicity, it can be rounded B16 cell shrinkages so that cracking (referring to Fig. 8).Thus fermentation can be speculated
Antitumor activity thing in supernatant is resistant to elevated temperatures small molecule (determining its molecular weight 122.14 through subsequent detection) material.
8. AKTAPurifier10 isolating actives component B5 broad-spectrum anti-tumor experiment and MTT are determined：
Active component B5 preparation：12,000rpm/min collects Bacillus amyloliquefaciens
BaX03048h fermented supernatant fluids, cross 0.22 μm of filter membrane, using the sephadex chromatography posts of Superdex 200 in protein purification
Initial gross separation, (separation condition are carried out on instrument：Mobile phase：Water, flow velocity：1mL/min, applied sample amount：1mL, operation method：100%
Water, run time：80min), the active component B5 obtained is collected；
Specific implementation process：By Hep-3B (human liver cancer cell), 4T1 (mouse mastopathy cell), (human colon carcinoma is thin by HT29
Born of the same parents), Hela (human cervical carcinoma cell) and B16 (mouse melanin tumor cell) and HUVEC (Human umbilical vein endothelial cells：It is normal thin
Born of the same parents) cell is respectively with 104Individual/number per hole is inoculated in 96 orifice plates, is placed in 37 DEG C, 5%CO2Cultivated in cell constant temperature incubator,
Cell attachment is grown, 24h is cultivated；The μ L of active component B5 2,4,6,8,10 are separately added into, continue to cultivate 24h (every group of setting 3
Individual repetition)；Control group, which is not added with active component B5, to be continued to cultivate 24h；Supernatant is sucked, the fresh RPMI-1640 culture mediums of 90 μ L are added,
10 μ L MTT reagents are added, continue to cultivate 4h；Supernatant is sucked, 110 μ L Formazan lysates are added per hole, is placed
10min, interval concussion crystal is fully dissolved (MTT reagents are shown in that light is easily decomposed with Formazan lysates, above step lucifuge
Operation), it is placed on enzyme-linked immunosorbent assay instrument and measures the light absorption value in each hole at 490nm, and calculates cell survival rate.
Fig. 9 is that AKTA Purifier10 isolating active components B5 is thin to Hep-3B, 4T1, HT29, Hela, B16 and HUVEC
Born of the same parents Activity determination (in Fig. 9 A1, B1, C1, D1, E1, F1 be respectively be not added with active component B5 Hep-3B, 4T1, HT29,
Hela, B16 and HUVEC cell culture 24h picture, A2, B2, C2, D2, E2, F2 be respectively active component B5 processing Hep-3B,
4T1, HT29, Hela, B16 and HUVEC cell 24h picture)；As a result show, active component B5 has broad-spectrum anti-tumor activity,
Very strong toxicity is shown to Hep-3B, 4T1, HT29, Hela and B16 cell, can make this several tumour cell shrinkage be rounded and
Cracking, while active component B5 is weaker to normal cell HUVEC toxicity, largely growth is normal (referring to Fig. 9 F1 and F2) for cell；
Figure 10 is that AKTA Purifier10 isolating active component B5 are determined to Hela, B16, the MTT of Hep-3B and HUVEC cytoactives.
MTT results show that active component B5 is to Hela, and B16, Hep-3B and HUVEC cells are all active, and when the training of 100 μ L cells
When 8 μ L B5 are added in nutrient solution, the inhibiting rate of four kinds of cells all reaches or close to 50%, wherein poison of the active matter to B16 cells
Property preferably (referring to Figure 10).Cell inhibitory rate calculation formula is as follows：
Inhibiting rate=[(ODCK-OD zeroings)-(OD samples-OD zeroings)]/(ODCK-OD zeroings)
ODCK：The cell normally cultivated；
OD returns to zero：Only culture medium is added to be not added with cell；
OD samples：The cell plus sample treatment normally cultivated.
9. the chromatographic isolation of Bacillus amyloliquefaciens BaX030 antitumor activity things：
Specific implementation process：12,000rpm/min collects Bacillus amyloliquefaciens BaX030 48h hairs
Ferment supernatant, crosses 0.22 μm of filter membrane, using the sephadex chromatography posts of Superdex 200 in protein purification instrument (AKTA
Purifier10 initial gross separation (mobile phase is carried out on)：Water, flow velocity：1mL/min, applied sample amount：1mL, operation method：100% water
80min), active component B5 is collected；Recycling high performance liquid chromatograph (Infinity of Agilent 1260), further separation is anti-
Tumor promotion thing (pillar：5 μm of 9.4 × 150mm of ZORBAX SB-C18, mobile phase：Water, methanol, flow velocity：4mL/min, loading
Amount：80 μ L, operation method：0-4min methanol 5%-50%, 4-7min methanol 50%-80%, 7-10min methanol 80%-
100%th, 10-12min methanol 100%, 12-13min methanol 5%).
Figure 11 is initial gross separation of the fermented supernatant fluid on AKTA Purifier10；Figure 12 is the work that initial gross separation is collected
Separation and preparation of the property component on the Infinity of Agilent 1260；Figure 13 is each the unimodal activity survey prepared
Fixed (after B5 components separate each unimodal 30min through 13000rpm centrifugations prepared on the Infinity of Agilent 1260,
Cross 0.22 μm of film and obtain sterile each unimodal collection liquid, respectively take 10 μ L to act on B16 cell 24h, observe the form of cell).By with
Upper research understands that the component B5 (Figure 11) that AKTA Purifier10 initial gross separations are collected has antitumor activity (Figure 13)；Activity
Further separation is with preparing (Figure 12) on Agilent1260 Infinity by component B5, and the detached peaks 1 of preparation can make B16 cells
Shrinkage is rounded (Figure 13, A：CK is compareed, B：B5 components, C-F:Detached peaks 1-4).
10. the LC-MS/MS identifications of Bacillus amyloliquefaciens BaX030 antitumor activity things：
Specific implementation process：Bacillus amyloliquefaciens BaX030 fermented supernatant fluids are in AKTA
After being isolated and purified step by step on the Infinity of Purifier10, Agilent 1260, purity very high antitumor component is obtained
(Figure 12, detached peaks 1), active component is collected and takes 10 μ L to carry out LC-MS/MS after 10 times of concentration in freeze-drying concentrating instrument
Identification.Figure 14 is the first mass spectrometric result of antitumor activity thing；Figure 15 is the second order mses result of antitumor activity thing.By one-level
Mass spectral results understand that the molecular weight of antitumor activity thing is 122.14 (Figure 14), and the active owner can be obtained by second order mses result
The molecular weight for wanting fragment is 104.07 (Figure 15).
Claims (1)
1. a kind of separation method of bacillus amyloliquefaciens active metabolite, it is characterised in that
The bacillus amyloliquefaciens are bacillus amyloliquefaciens (Bacillus amyloliquefaciens) BaX030, the bacterium
Plant and be preserved in China typical culture collection center, preserving number is CCTCC NO：M 2014159；
Separation method comprises the following steps：By bacillus amyloliquefaciens BaX030 in LB culture mediums, in 30 DEG C, 160-
After 170rpm/min, shaken cultivation 48h, 8000-12000rpm/min centrifugations 15min；Fermented supernatant fluid is collected, 0.22 μm is crossed
Filter membrane, obtains sterile fermented supernatant fluid；Initial gross separation is carried out on protein purification instrument, the component with bioactivity is collected；
Further isolated and purified, obtained with antibacterial and antitumor activity metabolite using high performance liquid chromatograph；
During initial gross separation, gel column used is the sephadex columns of Superdex 200 on protein purification instrument；
When further isolating and purifying, chromatographic column used is C18 reverse-phase chromatographic columns in the high performance liquid chromatograph.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510064245.5A CN104630111B (en) | 2015-02-09 | 2015-02-09 | The separation method and application of one bacillus amyloliquefaciens and its active metabolite |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510064245.5A CN104630111B (en) | 2015-02-09 | 2015-02-09 | The separation method and application of one bacillus amyloliquefaciens and its active metabolite |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104630111A CN104630111A (en) | 2015-05-20 |
| CN104630111B true CN104630111B (en) | 2017-10-27 |
Family
ID=53209363
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510064245.5A Active CN104630111B (en) | 2015-02-09 | 2015-02-09 | The separation method and application of one bacillus amyloliquefaciens and its active metabolite |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104630111B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106755117B (en) * | 2016-12-29 | 2020-07-31 | 四川农业大学 | Preparation method of rice blast bacterium inhibitor |
| TWI649419B (en) * | 2017-07-13 | 2019-02-01 | 國立屏東科技大學 | Liquefied Bacillus starch and its application |
| CN107574129B (en) * | 2017-07-18 | 2020-05-05 | 大连交通大学 | Radix cynanchi bungei endophytic bacterial strain Bacillus amyloliquefaciens BSW-7 and application thereof in antitumor activity |
| CN110117311B (en) * | 2019-04-30 | 2023-04-14 | 湖南师范大学 | Method for separating and purifying bacillomycin from bacillus amyloliquefaciens |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102286408A (en) * | 2011-08-04 | 2011-12-21 | 武汉光谷世傲生物科技有限公司 | Bacillus amyloliquefaciens WH3, and preparation method and application thereof |
| CN103224898A (en) * | 2013-03-05 | 2013-07-31 | 中国水产科学研究院黄海水产研究所 | Marine bacillus and its polypeptide with antitumor activity |
| CN104017048A (en) * | 2013-10-25 | 2014-09-03 | 广西科学院 | Cyclic tetrapeptide compounds with anti-tumor activity as well as preparation method and application thereof |
-
2015
- 2015-02-09 CN CN201510064245.5A patent/CN104630111B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102286408A (en) * | 2011-08-04 | 2011-12-21 | 武汉光谷世傲生物科技有限公司 | Bacillus amyloliquefaciens WH3, and preparation method and application thereof |
| CN103224898A (en) * | 2013-03-05 | 2013-07-31 | 中国水产科学研究院黄海水产研究所 | Marine bacillus and its polypeptide with antitumor activity |
| CN104017048A (en) * | 2013-10-25 | 2014-09-03 | 广西科学院 | Cyclic tetrapeptide compounds with anti-tumor activity as well as preparation method and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| Bacillus amyloliquefaciens strain X030 16S ribosomal RNA gene，partial sequence，Accession No. KM191359.1;He，H;《GenBank》;20140831;全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104630111A (en) | 2015-05-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Song et al. | Antifungal activity of the lipopeptides produced by Bacillus amyloliquefaciens anti-CA against Candida albicans isolated from clinic | |
| Wan et al. | Iturin: cyclic lipopeptide with multifunction biological potential | |
| CN107245457A (en) | A kind of extracting method and application of dendrobium candidum endogenetic fungal bacterial strain and its exocellular polysaccharide of generation and the exocellular polysaccharide | |
| Sharma et al. | Antifungal activity of extracts obtained from actinomycetes | |
| CN106479934B (en) | A kind of ash arrhizus bacteria antagonistic strain and its screening technique and application | |
| CN104630111B (en) | The separation method and application of one bacillus amyloliquefaciens and its active metabolite | |
| CN103540542A (en) | Bidirectional burkholderia as well as culture method and application thereof | |
| CN111040976A (en) | Bacillus amyloliquefaciens and application thereof | |
| CN115044505B (en) | Antibacterial lipopeptid produced by bacillus bailii and application of antibacterial lipopeptid in cosmetics and foods | |
| CN104450580A (en) | Preparation method of actinomycin D and application thereof | |
| CN105296386B (en) | The interior raw bacillus amyloliquefaciens of one plant height production antagonism tobacco bacterial wilt active material | |
| CN103931659B (en) | Mo Hawei bacillus KJS-3 is as the application of biological pesticide | |
| CN103834585A (en) | Rhizospheric pseudomonad capable of largely producing phenazine-1-carboxylic acid and phenazine-1-amide | |
| CN104962507B (en) | One plant of slime bacteria bacterial strain and its antitumor activity metabolite | |
| CN101899098A (en) | Cyclic lipopeptide compound Maribasin B and preparation and application thereof | |
| CN105018380B (en) | One bacillus amyloliquefaciens BR25 and its cultural method and application | |
| CN104450835A (en) | Preparation method of new compound | |
| CN105132338B (en) | Bacillus DY26-020 and its application in preparing prevention phytopathogenic fungi fermented supernatant fluid | |
| CN106635885A (en) | Symbiotic bacterium of entomopathogenic nematode and application of symbiotic bacterium | |
| TW202005538A (en) | Streptomyces abikoensis and metabolic products, preparation method and mosquito killing application thereof characterized by preparing the metabolic products and metabolic extracts of Streptomyces abikoensis to be a biological agent having mosquito killing ability and commercial availability | |
| CN105112322B (en) | Grey mold quinone A and B and preparation method thereof and medical usage | |
| CN114854631A (en) | Sponge-derived biocontrol streptomyces ITBB-ZK-a5 and application thereof | |
| CN104988096B (en) | One plant height effect inhibits biocontrol microorganisms Kg2A and its application of sickle-like bacteria and anthrax-bacilus | |
| CN105907658A (en) | Peony endogenous Bacillus subtilis and its separation method and use | |
| CN103087949B (en) | Biocontrol endophytic actinomycetes- streptomyces sioyaensis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20190411 Address after: 410000 No. 903-904, Building C3, Yuyuan, Lugu, 27 Wenxuan Road, Changsha High-tech Development Zone, Changsha City, Hunan Province Patentee after: Hunan Qingtian Biotechnology Co.,Ltd. Address before: 410081 No. 36 Lushan Road, Changsha City, Hunan Province Patentee before: Hunan Normal University |
|
| PE01 | Entry into force of the registration of the contract for pledge of patent right | ||
| PE01 | Entry into force of the registration of the contract for pledge of patent right |
Denomination of invention: A strain of Bacillus amyloliquefaciens and its separation method and application of active metabolites Effective date of registration: 20220328 Granted publication date: 20171027 Pledgee: Huarong Bank of Xiangjiang Limited by Share Ltd. Changsha branch Pledgor: Hunan Qingtian Biotechnology Co.,Ltd. Registration number: Y2022430000021 |
|
| PC01 | Cancellation of the registration of the contract for pledge of patent right | ||
| PC01 | Cancellation of the registration of the contract for pledge of patent right |
Date of cancellation: 20220728 Granted publication date: 20171027 Pledgee: Huarong Bank of Xiangjiang Limited by Share Ltd. Changsha branch Pledgor: Hunan Qingtian Biotechnology Co.,Ltd. Registration number: Y2022430000021 |