CN102286408A

CN102286408A - Bacillus amyloliquefaciens WH3, and preparation method and application thereof

Info

Publication number: CN102286408A
Application number: CN2011102226973A
Authority: CN
Inventors: 祁高富; 苏纪宇; 李菁菁; 赵秀云
Original assignee: WUHAN GUANGGU SHIAO BIOLOGICAL TECHNOLOGY Co Ltd
Current assignee: WUHAN GUANGGU SHIAO BIOLOGICAL TECHNOLOGY Co Ltd
Priority date: 2011-08-04
Filing date: 2011-08-04
Publication date: 2011-12-21
Anticipated expiration: 2031-08-04
Also published as: CN102286408B

Abstract

The invention discloses a Bacillus amyloliquefaciens WH3 strain, and a preparation method and application thereof. The preparation method comprises the following steps: 1, separation and identification of bacteria: separating bacteria resistant to rape sclerotinia rot from rape seedlings, and carrying out 16SrDNA and morphological identification to determine that the WH3 strain obtained by separation is Bacillus amyloliquefaciens; 2, separation, purification and identification of an antifungal active substance Safenour: fermenting the WH3 strain, extracting the antifungal active substance, separating and purifying through a sephadex column, and carrying out MALDI-TOF (matrix-assisted laser desorption/ionization-time of flight ) mass spectrometry on the active antifungal substance to infer that the substance is a ring type polypeptide; and 3, application of the strain in the preparation of vaccines and immunological adjuvants. After the Safenour used as the adjuvant is mixed with a protein antigen and mice are respectively immunized through oral administration and injection of the mixture, effective body fluid and cellular immune response can be activated, and a high-titer specific antibody can be detected in the blood serum. The Safenour has low production cost and high stability, does not need to be emulsified when mixed with the antigen, and has a better immunoenhancement effect in comparison with Freund adjuvants and cholera toxin B subunits.

Description

A kind of bacillus amyloliquefaciens WH3 and preparation method and purposes

Technical field

The present invention relates to belong to field of immunology, more specifically relate to a kind of bacillus amyloliquefaciens WH3 bacterial strain, the preparation method who also relates to a kind of bacillus amyloliquefaciens WH3 bacterial strain simultaneously, also relate to the application of a kind of bacillus amyloliquefaciens WH3 bacterial strain in the preparation immunological adjuvant, also be applicable to the cyclic peptide with similar structures of other microorganisms simultaneously.

Background technology

Immunological adjuvant is meant with antigen and uses simultaneously or in advance that energy enhancement antigen material immunogenicity, enhancing body are at antigenic immunne response ability, or change immune response type, and itself there is no antigenic material.

The mechanism of action of adjuvant is very complicated, present research is thought and is mainly contained: (1) antigen storage effect, mineral colloid, latex class adjuvant etc. can form antigen storage pond in the injection site, make antigen avoid hepatic clearance and delay its rate of release, so that vaccine antigen can be fully, high level ground, for a long time with the immunocyte contact action, and then induce significant immunne response; (2) angtigen presentation effect, adjuvant can keep the antigen conformation complete and it is offered to suitable immune effector cell, influence antigen presenting cell (APC) antigen uptaking and secrete cytokines simultaneously; (3) immunoregulation effect, adjuvant can be regulated cytokine network, and different adjuvants is induced the different cytokine of APC secretion; (4) targeting, adjuvant absorbs and transmission antigen by exciting APC, and then to the immunocyte antigen-presenting; (5) inducing T cell immunne response refers on purpose use the adjuvant class material with antigen or t cell epitope, and this material had preferentially induces or the inducing T cell characteristic of replying only.

The kind of adjuvant is abundant, and therefore the mode of classification is also a lot, does not have unified standard.Be divided into according to its source: microbe-derived adjuvant, natural drug adjuvant, physiological product adjuvant, synthetic adjuvant and nutritive substance.According to its physics and chemical property, can be divided into gel-type adjuvant, particle type adjuvant, microbe-derived adjuvant, emulsion and synthetic adjuvant to adjuvant.Then can be divided into immunomodulator, transportation type adjuvant and targeting type adjuvant according to the adjuvant effect mode.According to its performance difference, can be divided into immunostimulation type adjuvant, granule type adjuvant, mucosal adjuvants and therapeutic vaccine adjuvant again.

Be accompanied by the fast development of bio-science, the range of application of immunological adjuvant constantly enlarges, and immune effect also improves gradually, but they still have various inevitable shortcomings.These defectives mainly are presented as: (1) toxic side effect is outstanding, as freund's adjuvant, Quil A etc.; (2) be of limited application for antigenic, as aluminium adjuvant; (3) immunization mechanism is single, can not induce as aluminium adjuvant to produce the reaction of Th1 type; (4) not high, the complex manufacturing technology of stability is as CpG oligonucleotide fragment, liposome etc.; (5) immunization Mechanism Study is not thorough, as the overwhelming majority's Chinese medicine adjuvant.These drawbacks limit the widespread use of adjuvant, also affect the development of adjuvant integral body.

Desirable vaccine adjuvant need have safety, effectively, target and economic characteristics.Developing novel immunological adjuvant will be development in future trend with immune efficacy that strengthens vaccine and the toxic side effect that reduces vaccine, and new vaccine adjuvant is its adjuvanticity of research and toxic optimum balance.It is the immunomodulator in the biological response modifier, and the non-specific immunostimulating effect is its adjuvanticity of performance, makes body produce the necessary primary condition of protective immune response, if but this overaction or strong excessively then must present toxic side effect.Therefore,, have the material of extremely low non-specific immunostimulating effect again if can seek a kind of strong adjuvanticity that both had, so for adjuvant research with significant.

Summary of the invention

For solving the defective of existing vaccine adjuvant at aspects such as security, stability, the present invention is by a large amount of experiments and creative work, purpose is to be to provide a kind of bacillus amyloliquefaciens WH3 bacterial strain, this bacterial strain can be used to prepare immunological adjuvant by a kind of cyclic peptide of fermentative production, the immunologic adjuvant of preparation has high efficiency, versatility, good security, low cost, stable in properties, advantage such as easy to use, can excite effective body fluid and cellullar immunologic response.

Another object of the present invention is the preparation method who has been to provide a kind of bacillus amyloliquefaciens WH3 bacterial strain, this bacterial strain is to separate the endophyte of plant that obtains having anti-mycotic activity from Brassica campestris L seedling, can produce the ring type polypeptide surfactivity element of anti-mycotic activity, called after Sai Funuo (Safenour).WH3 identifies and 16S rDNA sequential analysis through anti-mycotic activity detection, morphologic observation, physiological and biochemical test, is accredited as bacillus amyloliquefaciens (Bacillus amyloliquefacien).Bacillus amyloliquefaciens is the Gram-positive bacillus, and widespread use in food, medicine, industrial and agricultural production is considered to not have toxin and no pathogenicity.The Safenour polypeptide that contains basic amino acids arginine that the WH3 bacterial strain produces has the immunological adjuvant activity of highly significant.

A further object of the present invention is to be to provide a kind of bacillus amyloliquefaciens WH3 bacterial strain in the application of preparation in the vaccine adjuvant, by fermentation culture WH3 bacterial strain, can produce and contains the plain Safenour of arginic ring type polypeptide surfactivity.Safenour can be used as immunological adjuvant, no matter is oral or the drug administration by injection approach, and Safenour can both excite effective humoral immunoresponse(HI) and cellullar immunologic response.Safenour is safe as vaccine adjuvant, and oral immunity reaches the dosage of 1.5g/kg body weight, and experimental animal is dead for not having, nothing is poisoned, no organ-tissue pathology, has very high security.The Safenour polypeptide has versatility as adjuvant, can be used for oral immunity, also can be used for injecting immune; The intensive humoral immunization can be excited, effective cellular immunization can be excited again.The Safenour polypeptide also has high efficiency as adjuvant, and as oral adjuvant, the oral dosage of every mouse Safenour is 50-200 μ g, and antigen protein glutathione-S-transferase (GST) dosage is 50-200 μ g; Injecting immune Safenour is 1-20 μ g, antigen protein GST dosage is that 2-5 μ g just can excite immunne response efficiently, wherein to induce the tiring of anti-GST antibody of generation in serum be 12000 times to oral immunity, and injecting immune induces the antibody titer of generation especially up to 400000 times.The specific antibody that immune response that the Safenour polypeptide adjuvant excites produces sustainable existence more than 2 months in the mouse body, form memory lymphocyte, when immunity once more the time can excite the intensive immunne response rapidly, produce high titer antibody, tiring to reach 400000 times.

In order to realize above-mentioned purpose, the present invention adopts following technical measures:

A kind of preparation method of bacillus amyloliquefaciens WH3 bacterial strain the steps include:

1. separation screening of bacterium and evaluation: from rape field, academy of agricultural sciences, Hubei, Chinese Wuhan City, Hubei Province (arbitrary rape field), choose the Brassica campestris L seedling of 3 leaf phases and separate bacterium with anti-sclerotinia rot of colza.Carry out 16S rDNA, Physiology and biochemistry and identification of morphology to detecting bacterium, determine that separating the WH3 bacterial strain that obtains is a strain bacillus amyloliquefaciens (Bacillus amyloliquefaciens) with remarkable anti-mycotic activity.

2. the separation and purification of antifungus active substance Safenour and evaluation: the fermented liquid of bacillus amyloliquefaciens WH3 cultivation after 2 days to above-mentioned acquisition extracts antibacterial substance with " two step extraction processs " (seeing embodiment 2), to extract back liquid and concentrate, and be dissolved in the 10ml distilled water through rotary evaporation in vacuo.With the further separation and purification of dextran G-25 post, draw elution curve.Utilize the component of each peak value of elution curve to carry out the anti-microbial activity detection.After anti-mycotic activity is analyzed, activated antimicrobial substance is carried out vacuum lyophilization to be concentrated, and through the MALDI-TOF mass spectroscopy, obtain the structure of antimicrobial substance, be found to be a kind of special ring type polypeptide (surfactivity element), contain basic aminoacids Arg, called after Sai Funuo (Safenour).

Result of implementation:

Be divided into from Brassica campestris L seedling from obtaining bacterial isolates 86 strains, wherein the bacterial strain of called after WH3 has the resistance of significant anti-sclerotinia rot of colza.The WH3 bacterial strain is analyzed through morphologic observation and 16S rDNA, find that this bacterial strain is a Gram-positive, thalline is shaft-like, thalline size 1-1.4 μ m * 2.3-3.5 μ m, the energy rapid diffusion does not form specific colonial morphology on the PDA flat board, the edge is irregular, be canescence, thickness has pod membrane, and cultivating the 48h rear surface has little gauffer.On the LB flat board, form the bacterium colony of rice white, colony diameter 3-5mm, surface drying has gauffer, and the centre subsides, and the edge is wavy.37 ℃ of growths are obviously faster than 28 ℃.Brood cell's near-end is given birth to, flagellum Zhousheng.The catalase of WH3 bacterial strain, casein hydrolysis, anaerobic growth, gelatin hydrolysis, starch hydrolysis, V-P reaction and nitrate reduction are all positive; Tyrosine hydrolysis, phenylalanine deaminase, indoles produce, the Citrate trianion utilization is all negative; Can utilize D-glucose, D-N.F,USP MANNITOL, maltose, sucrose.In conjunction with, above-mentioned morphological specificity and coloration result, judgement WH3 is a bacillus.Again in conjunction with 16S rDNA sequential analysis (with the homology of bacillus amyloliquefaciens be 99.4%) be indicated as bacillus amyloliquefaciens (Bacillus amyloliquefaciens) WH3, be stored in Chinese typical thing preservation center, preservation address: China. Wuhan. Wuhan University, preservation date: on July 26th, 2011, deposit number: CCTCC NO:M2011266, classification name: bacillus amyloliquefaciens WH3B acillus amyloliquefaciens WH3.

The antimycotic material that WH3 produces is after " two step extraction processs " extraction, separate through gel column again, the material with anti-mycotic activity that obtains is further analyzed through MALDI-TOF-MS, find that its molecular weight is 1065 Da, for containing arginic ring type polypeptide surfactivity element, called after Sai Funuo (Safenour), structural formula such as figure below.It is characterized by and contain a basic amino acids arginine, have very strong thermostability, insensitive to acid or alkali environment, but standing storage.

The application of a kind of bacillus amyloliquefaciens WH3 bacterial strain in preparation vaccine and immunological adjuvant the steps include:

1.Safenour the detection of adjuvant effect:

With the cyclic peptide Safenour of above-mentioned preparation as adjuvant with after proteantigen GST or chicken egg white (OVA) mix, respectively through three kinds of approach immune mouses such as subcutaneous injection, abdominal injection and filling appetite clothes, immunity once weekly, get blood after continuous 3 one weeks of immunity, separation of serum is with the titre of anti-GST or OVA antibody in euzymelinked immunosorbent assay (ELISA) (ELISA) the mensuration serum.

Behind immune mouse after OVA pattern antigen and the mixing of Safenour polypeptide adjuvant 3 times, get blood weekly once, continue two months altogether, detect the titre of anti-OVA antibody in the serum.After 2 months, once more with Safenour polypeptide adjuvant and OVA immune mouse, the ELISA method is measured the titre of anti-OVA antibody in the serum after one week, detect and to form memory lymphocyte after the Safenour polypeptide adjuvant stimulates, can excite immunne response to generate high titer antibody once more after the immunity rapidly.

2.Safenour the detection of adjuvant activated cell immunne response

OVA pattern antigen and Safenour polypeptide adjuvant are mixed the immune C57 mouse in back 3 times, after 2 months once more with OVA and Safenour polypeptide mixed solution immune mouse, put to death mouse after 3 days, get mouse spleen separation and Culture splenocyte, respectively with the OVA helper T cell epitope peptide and the cytotoxic t cell epitope peptide irritation cell of chemosynthesis, the secreting, expressing that adds golgi body inhibition agent inhibit cell, again respectively with fluorescently-labeled anti-CD4, CD8, the antibody padding of CD28, antibody with fluorescently-labeled anti-TNF-α and IFN-γ carries out dyeing in the born of the same parents then, detects CD4 through flow cytometer ⁺CD28 ⁺, CD8 ⁺CD28 ⁺, CD4 ⁺TNF-α ⁺, CD8 ⁺TNF-α ⁺, CD4 ⁺IFN-γ ⁺And CD8 ⁺IFN-γ ⁺Lymphocyte, judge after Safenour adjuvant and antigen mix according to the result to excite effective cellullar immunologic response.

Result of implementation:

With Safenour as immunological adjuvant, its immuno-potentiation of check in experimentation on animals, the result shows effectively former humoral immunoresponse(HI) and the cellullar immunologic response of enhancing immunity of Safenour, its injecting immune reinforced effects is better than or approaches freund's adjuvant, and the specific antibody titres of generation reaches as high as 400000 times; Oral immunity and choleratoxin B subunit (CTB) effect is suitable, induces the specific antibody titres of generation to reach as high as 12000 times in the serum, and its sensitization and security all are better than freund's adjuvant and aluminium adjuvant.Safenour is as adjuvant, can in blood, excite and produce the antibody that high titre continues existence for a long time, the time length period of greater than two months, and can form memory lymphocyte, after stimulating, same antigen can excite immunne response efficiently when running into once more rapidly, produce high titer antibody, tiring to reach 400000 times.The Safenour adjuvant not only can excite humoral immunization, equally also can the activating cells immunne response, induce to produce more CD4 ⁺TNF-α ⁺, CD8 ⁺TNF-α ⁺, CD4 ⁺IFN-γ ⁺And CD8 ⁺IFN-γ ⁺The T lymphocyte.Therefore, the Safenour polypeptide adjuvant has very strong application potential in development new oral vaccine and vaccinate.

Described cyclic peptide Safenour is as vaccine adjuvant and proteantigen mixed immunity mouse, and recommended dose is: injecting immune 5 μ g Safenour and 10 μ g antigens, oral immunity 200 μ g Safenour and 50 μ g antigens.The present invention's immunological adjuvant can promote the immune response of animal, and the raising antigen-specific antibodies is tired and prolonged the antibody time length, and can not produce detrimentally affect to animal.The present invention's immunogen can be proteantigen, also can be polypeptide, deactivation bacterium or virus, attenuated bacteria and virus.The present invention's animal immune can adopt the mode of oral immunity, subcutaneous injection, intramuscular injection or abdominal injection to carry out.

The present invention compares with existing adjuvant has following advantage:

(1) cyclic peptide Safenour oral and the injection toxicity low, the biological safety height; (2) cyclic peptide Safenour production cost is low, is easy to preparation, and stability is high, is convenient to prolonged preservation and transportation; (3) cyclic peptide Safenour has than strongly hydrophilic, can directly dissolve use, need not emulsification, and is convenient and swift; (4) cyclic peptide Safenour can efficiently stimulate immune response, and immunoenhancement result is good; (5) cyclic peptide Safenour both can be used for injecting immune, can be used for oral immunity again; Can stimulate body to produce humoral immunoresponse(HI), can produce cellullar immunologic response by excitating organism again, have excellent versatility.

Description of drawings

Fig. 1 is the MALDI-TOF collection of illustrative plates of a kind of ring type polypeptide Safenour of bacillus amyloliquefaciens WH3 product.

Fig. 2 is a kind of Safenour adjuvant and the horizontal synoptic diagram of chicken egg white (OVA) the injecting immune anti-OVA IgG of inductive serum.FA is the freund's adjuvant contrast.

Fig. 3 is a kind of Safenour adjuvant and the horizontal synoptic diagram of glutathione-S-transferase (GST) the injecting immune anti-GST IgG of inductive serum.

Fig. 4 is a kind of Safenour adjuvant and the horizontal synoptic diagram of the anti-OVA IgG of OVA oral immunity inductive serum.CTB is the contrast of vibrio cholera toxin B subunit.

Fig. 5 is a kind of Safenour adjuvant and the horizontal synoptic diagram of the anti-GST IgG of GST injecting immune inductive serum.

Fig. 6 is a relatively synoptic diagram of a kind of injecting immune various dose Safenour adjuvant effect, among the figure:

G/ GST of g/ Safenour+10 μ of A:20 μ

G/ GST of g/ Safenour+10 μ of B:10 μ

G/ GST of g/ Safenour+10 μ of C:5 μ

G/ GST of g/ Safenour+10 μ of D:1 μ

G/ GST of E:10 μ

Fig. 7 is a relatively synoptic diagram of a kind of oral immunity various dose Safenour adjuvant effect, among the figure:

G/ GST of g/ Safenour+200 μ of A:2000 μ

G/ GST of g/ Safenour+200 μ of B:1000 μ

G/ GST of g/ Safenour+200 μ of C:500 μ

G/ GST of g/ Safenour+200 μ of D:200 μ

G/ GST of g/ Safenour+200 μ of E:100 μ

G/ GST of F:200 μ

Fig. 8 is a blood serum special antibody titer synoptic diagram behind a kind of oral immunity various dose GST, among the figure:

G/ GST of g/ Safenour+200 μ of A:500 μ

G/ GST of g/ Safenour+100 μ of B:500 μ

G/ GST of g/ Safenour+50 μ of C:500 μ

G/ GST of g/ Safenour+20 μ of D:500 μ

G/ GST of g/ Safenour+10 μ of E:500 μ

Fig. 9 is a kind of Safenour adjuvant and the horizontal synoptic diagram of the HCMV-IE1 polypeptide injecting immune anti-HCMV-IE1IgG of inductive serum, and Safenour adjuvant group-specific IgG antibody horizontal is extremely remarkable with no adjuvant control group difference.

Figure 10 is used for the blood serum special antibody horizontal synoptic diagram of different time after the secondary immune response for a kind of Safenour adjuvant.

Figure 11 brings out the splenocyte hyperplasia for a kind of Safenour adjuvant.Mtt assay detects OVA immune mouse spleen cell proliferated specifically effect, A: oral immunity OVA+Safenour; B: oral immunity OVA; C: peritoneal immunity OVA+Safenour; D: peritoneal immunity OVA; The E:PBS control group; F: substratum.

Figure 12 impels the outgrowth flow cytometry synoptic diagram of T lymph CD28 surface molecular for a kind of Safenour adjuvant.A: oral immunity OVA+Safenour; B: oral immunity OVA; C: peritoneal immunity OVA+Safenour; D: peritoneal immunity OVA; The E:PBS control group.

Figure 13 is that a kind of Safenour adjuvant stimulates T lymphocyte CD 4 ⁺CD28 ⁺The flow cytometry synoptic diagram of cell subsets.A: oral immunity OVA+Safenour; B: oral immunity OVA; C: peritoneal immunity OVA+Safenour; D: peritoneal immunity OVA; The E:PBS control group.

Figure 14 is CD4 behind a kind of Safenour adjuvant and the antigen immune ⁺The flow cytometry synoptic diagram of TNF-α in the T lymphocyte/IFN-γ.A: oral immunity OVA+Safenour; B: oral immunity OVA; C: peritoneal immunity OVA+Safenour; D: peritoneal immunity OVA; The E:PBS control group.

Figure 15 induces CD8 in the born of the same parents for a kind of Safenour adjuvant ⁺The flow cytometry of TNF-α in the T lymphocyte/IFN-γ.A: oral immunity OVA+Safenour; B: oral immunity OVA; C: peritoneal immunity OVA+Safenour; D: peritoneal immunity OVA; The E:PBS control group.

Embodiment

In conjunction with implementing the present invention is described further and proves, be not limited thereto but hold within the present invention.

Embodiment 1:

1. the screening and separating of bacillus amyloliquefaciens (Bacillus amyloliquefaciens) WH3:

Get the Brassica campestris L seedling in tri-leaf period at random from rape field, academy of agricultural sciences, Hubei, Chinese Wuhan City, Hubei Province and count strain, clean the back and separate root.After rape root outside surface rinsed well with tap water, again with aseptic water washing 5 times, then with 70% (V/V) alcohol immersion sterilization 30s, take out, behind aseptic water washing 5 times, rice root is cut into the fragment of about 1mm size with sterile scissors, place the PDA substratum (to contain the 200g potato and cook liquid then, 20g glucose, 20g agar, adding distil water is to 1L) go up in 28 ℃ and cultivate 48h.The bacterium that separation is obtained (contains the 200g potato and cooks liquid with the PD liquid nutrient medium, 20g glucose, adding distil water is to 1L) in 28 ℃, shaking culture 48h in the 200rpm shaking table, centrifugal, collect supernatant liquor and,, detect anti-microbial activity with 1: 9 by volume the mixed Sclerotinia sclerotiorum of falling the plating of PDA substratum with behind the 0.22 μ m membrane filtration.Measure through anti-microbial activity, successfully screen the bacterial isolates that a strain has remarkable anti-mycotic activity, called after WH3.

2.WH3 the evaluation of bacterial strain:

With the growth of on the PDA flat board, ruling of WH3 bacterial strain, form, size, edge, surface, camber, the transparency of observing single bacterium colony; Bacterium is carried out gramstaining and spore staining observation strain morphology, measure the size of bacterial cell.Found that bacterial strain is a Gram-positive, thalline is shaft-like, thalline size 1-1.4 μ m * 2.3-3.5 μ m, the energy rapid diffusion does not form specific colonial morphology on the PDA flat board, and the edge is irregular, be canescence, thickness has pod membrane, and cultivating the 48h rear surface has little gauffer.On the LB flat board, form the bacterium colony of rice white, colony diameter 3-5mm, surface drying has gauffer, and the centre subsides, and the edge is wavy.37 ℃ of growths are obviously faster than 28 ℃.Brood cell's near-end is given birth to, flagellum Zhousheng.On the basis of morphologic observation, further with reference to " uncle Jie Shi division bacteria handbook is carried out Physiology and biochemistry mensuration to WH3, comprises projects such as catalase, casein hydrolysis, anaerobic growth, gelatin hydrolysis, starch hydrolysis, V-P reaction and nitrate reduction, tyrosine hydrolysis, phenylalanine deaminase, indoles generation, Citrate trianion utilization, D-glucose utilization, the utilization of D-N.F,USP MANNITOL, maltose utilization and sucrose utilization.The catalase, casein hydrolysis, anaerobic growth, gelatin hydrolysis, starch hydrolysis, V-P reaction and the nitrate reduction that found that the WH3 bacterial strain are all positive; Tyrosine hydrolysis, phenylalanine deaminase, indoles produce, the Citrate trianion utilization is all negative; Can utilize D-glucose, D-N.F,USP MANNITOL, maltose, sucrose.On the basis of the above, the 16S rDNA that carries out the WH3 bacterial strain again analyzes and identification of morphology, with the bacterium that PD liquid nutrient medium incubated overnight is separated to, extract the genomic dna of bacterium with ordinary method, to measure the universal primer (F:AGAGTTTGATCCTGGCTCAG of 16S rDNA; R:AAGGAGGTGATCCAGCCGCA) carry out pcr amplification (the PCR reaction system is: distilled water 18.3 μ l, 10 * PCR damping fluid, 2.5 μ l, general positive anti-primer, each 1 μ l of dNTP, Taq enzyme 0.2 μ l).Response procedures: 94 ℃ of 4min, 94 ℃ of 45s of 30 round-robin again, 52 ℃ of 45s, 72 ℃ of 90s, 72 ℃ of 10min again), 1% (W/V) agarose electrophoresis detects the dna fragmentation that the size that successfully increases is approximately 1.5kb, and gives birth to worker's biotechnology company limited by Shanghai and carry out being defined as bacillus amyloliquefaciens (Bacillus amyloliquefaciens) through the Blast comparative analysis behind the sequencing in NCBI, be stored in Chinese typical thing preservation center, preserving number is CCTCC:M2011266.

Embodiment 2:

The separation and purification of Safenour and evaluation

The bacillus amyloliquefaciens WH3 bacterial classification 10 μ l that inoculation is preserved are in the PD substratum of 10ml sterilization, and 28 ℃, the 200rpm shaking culture is spent the night.Inoculate 2.5ml fresh culture thing then in the 1L triangular flask that contains the fresh PD substratum of 250ml, 28 ℃ or 37 ℃, 200rpm shaking culture 48h.4 triangular flasks of general each usefulness are cultivated the culture of 1L.The centrifugal 10min of 8000g collects supernatant then, extract antibacterial substance with " two step extraction processs ", concrete steps are: culture supernatants at first with the phase of fetching water after the equal volume of ethyl acetate, again with behind isopyknic n-butanol extraction, is collected the propyl carbinol phase with the centrifugal 20min of 8000g.Use vacuum rotary evaporator at 65 ℃ of following evaporates to dryness mutually the propyl carbinol ester that obtains, use the dissolved in distilled water of 10ml again.The solution centrifugal that obtains after the dissolving removes post precipitation, with the supernatant liquor further separation and purification of dextran G-25 post, carry out wash-out with distilled water, collect each elution fraction, every pipe is collected the 6ml elutriant, draw elution peak figure, separate and obtain 5 components, after filtration after the degerming with 10% volume ratio be used to cultivate sclerotinia rot of colza after the PDA substratum mixes, carry out anti-microbial activity and detect, collection has the component of strong anti-mycotic activity through MALDI-TOF mass spectroscopy (QTRAP3200, Applied Biosystems, CA, USA), it is as follows that the mass spectrum condition is optimized the back with the TurboIonspray parameter: under the positive ion mode, and ionspray voltage (IS) 2600V, remove a bunch voltage 60V, the mass scanning scope is 200-1500.Ion source gas I (GSI), gas II (GSII), assisted atomization gas (CUR) and Heating temperature (TEM) are set at 40,5,30 and 175 ℃ respectively.The results are shown in Figure 1, antimicrobial substance Safenour molecular weight is 1065Da, forms cyclic peptide structures by an aliphatic chain and 8 amino acid, contains basic aminoacids Arg, has the Asp-Val-Leu structure, is a kind of surfactivity element.

Embodiment 3:

1.Safenour the mensuration of adjuvant injecting immune effect:

Kunming (KM) mouse is divided into four groups at random: Safenour adjuvant+antigen group, antigen group, freund's adjuvant (FA)+antigen group, PBS control group, every group 6, Safenour adjuvant dosage is 100 μ g//times, and antigen is respectively GST, OVA albumen, and the antigen amount is 10 μ g//times.Adopt the subcutaneous multi-point injection in back and two kinds of immunization wayses of abdominal injection, immunity amount 0.2mL/ time, the immunity time was 0,1,2 weeks, week blood sampling after the last immunity.

A week after the last immunity, gather mouse tail vein blood, separation of serum adopts indirect elisa method to detect the anti-GST of serum, OVA IgG level.Concrete grammar is: respectively GST, OVA are diluted to 5 μ g/mL with coating buffer, wrap by elisa plate in 100 μ L/ holes, and 4 ℃ are spent the night, (PBST PBS+0.05%Tween-20) washes 1 time to washings, and every hole adds 100 μ L2%BSA-PBS, 37 ℃ of sealing 2h, washings is washed 3 times.Antibody diluent (PBST+0.5%BSA) begins doubling dilution serum to be checked for 1: 100 times, adds the elisa plate of bag quilt, 50 μ L/ holes, 37 ℃, 1.5h, washings wash 5 times, the sheep anti-mouse igg (1: 30000, Wuhan doctor's moral company product) that adds the HRP mark, 50 μ L/ holes, 37 ℃, 60min, washings wash 5 times, add tmb substrate colour developing liquid, room temperature (identical below 20-25 ℃) lucifuge reaction 5min-30min, 50 μ L stop buffer (2M H ₂SO ₄) termination reaction, making blank with the PBS hole, 450nm measures each hole OD value.The result is with the antibody titer of test sample A value (P)/negative control A value (N)＞2.1 as antiserum positive.

Three times the anti-OVA IgG of immunity back serum antibody titer detected result is seen Fig. 2.Experiment was with 0 day clear OD that taken a blood sample ₄₅₀The negative sample observed value of mean value (N), other each experimental group absorption value is experimental specimen (P), when P/N high dilution greater than 2.1 time is serum titer.Negative control group in the experiment (PBS immune group) serum doubling dilution post-absorption value and 0 day serum absorption value are more or less the same, and P/N is much smaller than 2.1, with 0 note of tiring, expression among the figure.When adopting the subcutaneous injection immunization ways, the serum antibody titer of Safenour adjuvant group reaches 5 * 10 ⁴For 2 times of no adjuvant control group (OVA) antibody titer, organize a little less than freund's adjuvant (FA); Adopt the abdominal injection mode, the serum antibody titer of Safenour adjuvant group reaches 2 * 10 ⁵ Be 16 times of no adjuvant control group (OVA) antibody titer, be higher than the FA group.

Three times the anti-GST IgG of immunity back serum antibody titer detected result is seen Fig. 3.When adopting the subcutaneous injection immunization ways, the serum antibody titer of Safenour adjuvant group reaches 10 ⁵ Be 2 times of no adjuvant control groups (GST); Adopt the abdominal injection mode, the serum antibody titer of Safenour adjuvant group reaches 2 * 10 ⁵Be 128 times of no adjuvant control groups (GST).

Result of study explanation, when adopting the injecting immune mode, cyclic peptide Safenour can significantly improve the antigenic humoral immunoresponse(HI) of GST, OVA, and its immunoenhancement result is better than or approaches freund's adjuvant.

2.Safenour the mensuration of adjuvant oral immunity effect

The KM mouse is divided into four groups at random: Safenour adjuvant+antigen group, antigen group, CTB adjuvant+antigen group, PBS control group, every group 6, Safenour adjuvant dosage is 500 μ g//times, antigen is respectively GST, OVA albumen, the antigen amount is 200 μ g//times, and CTB dosage is 20 μ g//times.The fasting 16h that freely drink water before the mouse immune, irrigation stomach device is irritated and is fed the 0.2mL immunogen, and immunity back 1h recovers feed drinking-water, and the immunity time was 0,1,2 weeks, all collection samples after the last immunity.

A week after the last immunity, gather mouse tail vein blood, separation of serum adopts indirect elisa method to detect the anti-GST of serum, OVA IgG level.Concrete grammar is: respectively GST, OVA are diluted to 5 μ g/mL with coating buffer, wrap by elisa plate in 100 μ L/ holes, and 4 ℃ are spent the night, (PBST PBS+0.05%Tween-20) washes 1 time to washings, and every hole adds 100 μ L2% (W/V) BSA-PBS, 37 ℃ of sealing 2h, washings is washed 3 times.Antibody diluent (PBST+0.5%BSA) begins doubling dilution serum to be checked for 1: 100 times, adds the elisa plate of bag quilt, 50 μ L/ holes, and 37 ℃, 1.5h, washings wash 5 times, the sheep anti-mouse igg of adding HRP mark (1: 30000; Wuhan doctor's moral company product), 50 μ L/ holes, 37 ℃, 60min, washings wash 5 times, add tmb substrate colour developing liquid, room temperature lucifuge reaction 5min-30min, the 50 μ L stop buffer (H of 2M ₂SO ₄Solution) termination reaction is made blank with the PBS hole, and 450nm measures each hole OD value.The result is with the antibody titer of test sample A value (P)/negative control A value (N)＞2.1 as antiserum positive.

The anti-OVA IgG of serum antibody titer detected result is seen Fig. 4 after the last immunity.Negative control group in the experiment (PBS immune group) serum doubling dilution post-absorption value and 0 day serum absorption value are more or less the same, and P/N is much smaller than 2.1, with 0 note of tiring, expression among the figure.It is 3200 consistent with CTB adjuvant group that the serum antibody titer of Safenour adjuvant group reaches, and is 2 times of no adjuvant control group (OVA) antibody titers.

The anti-GST IgG of serum antibody titer detected result is seen Fig. 5 after the last immunity.Negative control group in the experiment (PBS immune group) serum doubling dilution post-absorption value and 0 day serum absorption value are more or less the same, and P/N is much smaller than 2.1, with 0 note of tiring, expression among the figure.The serum antibody titer of Safenour adjuvant group reaches 12800, is 32 times of no adjuvant control group (GST) antibody titer.

The result of study explanation, when adopting the oral immunity mode, cyclic peptide Safenour can significantly improve the antigenic humoral immunoresponse(HI) of GST, OVA, and its immunoenhancement result is identical with choleratoxin B subunit.

3. the effect detection of injecting immune various dose Safenour adjuvant

Identical with the 1st content, only change the experiment condition that each is organized.The KM mouse is divided into six groups at random: 20 μ g/ Safenour adjuvant+GST, 10 μ g/ Safenour adjuvant+GST, 5 μ g/ Safenour adjuvant+GST, 1 μ g/ Safenour adjuvant+GST, GST, PBS control group, every group 6, the GST antigen dose is 10 μ g//times, adopts the abdominal injection immunization ways.

Detect the anti-GST IgG of serum, IgG1 antibody titer after the last immunity, the results are shown in Figure 6.Negative control group in the experiment (PBS immune group) serum doubling dilution post-absorption value and 0 day serum absorption value are more or less the same, and P/N is much smaller than 2.1, with 0 note of tiring, expression among the figure.When Safenour immunity amount be 20 μ g/ only/time, 10 μ g/ only/time and 5 μ g/ only/time the time, the anti-GST IgG of three experimental group, IgG1 antibody titer are identical and the highest, wherein to tire be 25600 to total IgG, it is 12800 that IgG1 tires.Show the peritoneal immunity mode that adopts, the suitableeest immunity amount of cyclic peptide Safenour is 5-20 μ g//time, can induce this moment body to produce the highest specific antibody of tiring.Consider that from saving the cost angle optimal dose is 5 μ g//times.

4. the effect detection of oral immunity various dose Safenour adjuvant

Identical with the 2nd content, only change the experiment condition that each is organized.The KM mouse is divided into seven groups at random: 2000 μ g/ Safenour adjuvant+GST, 1000 μ g/ Safenour adjuvant+GST, 500 μ g/ Safenour adjuvant+GST, 200 μ g/ Safenour adjuvant+GST, 100 μ g/ Safenour adjuvant+GST, GST, PBS control group, every group 6, the GST antigen dose is 200 μ g//times, adopts the oral immunity mode.

Detect the anti-GST IgG of serum, IgG1 antibody titer after the last immunity, the results are shown in Figure 7.Negative control group in the experiment (PBS immune group) serum doubling dilution post-absorption value and 0 day serum absorption value are more or less the same, and P/N is much smaller than 2.1, with 0 note of tiring, expression among the figure.When Safenour immunity amount be 500 μ g/ only/time and 200 μ g//times the time, anti-GST IgG, IgG1 antibody titer are the highest, wherein specific IgG is tired and is reached 12800.Show the oral immunity mode that adopts, the suitableeest immunity amount of Safenour is 200-500 μ g//time, can induce this moment body to produce the highest specific antibody of tiring.Consider that from the Financial cost angle best immunity amount is 200 μ g//times.

5. the detection of various dose antigen immune effect

Identical with the 2nd content, only change the experiment condition that each is organized.The KM mouse is divided into seven groups at random: Safenour adjuvant+200 a μ g/ OVA, Safenour adjuvant+100 a μ g/ OVA, Safenour adjuvant+50 a μ g/ OVA, Safenour adjuvant+25 a μ g/ OVA, Safenour adjuvant+10 a μ g/ OVA, Safenour adjuvant, PBS control group, every group 6, Safenour adjuvant dosage is 500 μ g//times, adopts the oral immunity mode.

Detect the anti-GST IgG of serum, IgG1 antibody titer after the last immunity, the results are shown in Figure 8.Do not have antigen group (Safenour immune group) and negative control group (PBS immune group) serum doubling dilution post-absorption value and 0 day serum absorption value in the experiment and be more or less the same, P/N is much smaller than 2.1, with 0 note of tiring, expression among the figure.When GST antigen immune amount reduces gradually, the also corresponding reduction of serum antibody titer.Show and adopt the oral immunity mode, the Safenour immunizing dose is more in good time, and body produces specific antibody titres and becomes positive correlation with immunogenic dosage.In actual applications, should take all factors into consideration cost and immune effect, select suitable immunogen dosage.

6.Safenour detection to the haptenic immunological adjuvant effect of polypeptide

This project flow process is identical with the 1st, only changes the experiment condition of each group.The KM mouse is divided into three groups at random: Safenour adjuvant+polypeptide, polypeptide, PBS control group, 6 every group, Safenour adjuvant dosage is 100 μ g//times, polypeptide (HCMV-IE1) dosage is 10 μ g//times, adopts the abdominal injection mode.

Detected result is seen Fig. 9, is coating antigen with the HCMV-IE1 polypeptide, and indirect ELISA detects, and Safenour adjuvant group-specific IgG tires and reaches 800, and it is that 25, two group-specific IgG antibody horizontal differences are extremely remarkable that no adjuvant group IgG tires.Show that Safenour has the adjuvant effect of immunostimulant to HCMV-IE1 polypeptide haptens.

7. the detection of secondary immune response

This project flow process is identical with the 1st, only changes the experiment condition of each group.The KM mouse is divided into two groups at random: 100 a μ g/ Safenour adjuvant+10 a μ g/ OVA, PBS control group,, adopt the subcutaneous multiple spot immunization ways in back by 6 every group.The immunity time was 0,1,2 weeks, and three exempt from back one week blood sampling, and per thereafter two all blood samplings once replenish immunity once when antibody titers obviously descends, and animal is gathered serum and carries out antibody test in week back execution.

Detected result is seen Figure 10, and in one week of back of immunity for the third time, specific IgG antibodies is tired and reached 25600, keeping the maximum beginning of tiring after three weeks slowly reduces, still can reach 12800 but tired in the 8th week after three immunity, carry out booster immunization thereafter the 4th time, serum titers reach 4 * 10 after two weeks ⁵When showing subcutaneous injection, cyclic peptide Safenour induces anti-OVA specific antibody high-level stable existence of energy in the mouse body of generation to carry out booster immunization thereafter and can evoke the intensive anamnestic response more than two months.

8.Safenour the detection of adjuvant activating cells immunne response

(1) immune animal:

The C57BL/6Slac mouse is divided into five groups at random: 500 a μ g/ Safenour adjuvant+200 a μ g/ OVA (oral), a 200 μ g/ OVA (oral), 100 μ g/ g/ OVA of a Safenour+10 μ (abdominal injection), a 10 μ g/ OVA (abdominal injection), the PBS control group, every group 6, respectively at 0,1,2 each immunity of week once, last immunity back 30d booster immunization once, mouse takes off neck execution behind the 3d, soak the 5min sterilization in 75% (V/V) spirituous solution, the aseptic abdomen of opening is got mouse spleen, put into the RPMI-1640 substratum, grind, collect splenocyte suspension in the aseptic centrifuge tube of 20mL, the centrifugal 5min of 1500r/min after crossing 200 eye mesh screens.Abandon supernatant, add the 5mL erythrocyte cracked liquid and beat centrifugal tube wall cell is disperseed, handle 3min for 37 ℃.Abandon supernatant and stay precipitation, also piping and druming is even to cumulative volume 15mL to add RPMI-1640, and the centrifugal 5min of 1500r/min washs 2 times, and with RPMI-1640 perfect medium washing 1 time, method is the same again.Add RPMI-1640 perfect medium 6mL in the cell precipitation, trypan blue dyeing, to lymphocyte count, viable count is more than 95% at microscopically, and it is standby to desired concn to adjust cell concn with the RPMI-1640 perfect medium.

(2) mtt assay is measured proliferation of lymphocytes:

Adjusting concentration of cell suspension is 5 * 10 ⁶/ mL, cell suspension is added 96 porocyte culture plates, and every hole adds 100 μ L, establishes 5 repeating holes for every group, add OVA cytotoxic T cell (CTL) epitope peptide of 1 μ g/mL chemosynthesis or 2 μ g/mL OVA helper cell (Th) epitope peptides simultaneously in 96 orifice plate internal stimulus cells, 37 ℃ of 5% CO ₂Leave standstill in the incubator and cultivate 48h.Take out culture plate and place in the Bechtop, it is 5mg/mL MTT 10 μ L that every hole adds concentration, takes out after continuing to cultivate 4h, the careful suction goes that nutrient solution adds DMSO 100 μ L in the hole, put low-speed oscillation 10min on the shaking table, crystallisate is fully dissolved, measure OD with enzyme-linked immunosorbent assay instrument ₄₉₀Value, other establishes the hole that does not add cell and is the zeroing hole.

(3) mensuration of T lymphocytic cell surface developed by molecule:

Adjusting concentration of cell suspension is 5 * 10 ⁶/ mL adds 24 porocyte culture plates to cell suspension, and every hole adds 200 μ L, adds 1 μ g/mLCTL epitope peptide or 2 μ g/mL Th epitope peptides simultaneously in 24 orifice plate internal stimulus cells, 37 ℃ of 5%CO ₂Leave standstill in the incubator and cultivate 20h.With cell transfer to the good aseptic EP pipe of mark, the centrifugal 5min collecting cell of 1500r/min, physiological saline 100 μ L re-suspended cells, add Anti-CD4-FITC (1: 500), Anti-CD28-PE (1: 500) antibody or Anti-CD8-PerCPCy5.5 (1: 500), Anti-CD28-PE (1: 500) antibody, hatch 30min for 4 ℃.Hatch and finish with 1mL physiological saline washing 1 time, 500 μ L physiological saline re-suspended cells, FACS detects.

(4) detection of T lymphocyte intracellular cytokine:

Adjusting concentration of cell suspension is 5 * 10 ⁶/ mL adds 24 porocyte culture plates to cell suspension, and every hole adds 200 μ L, adds 1 μ g/mL CTL epitope peptide or 2 μ g/mL Th epitope peptides in 24 orifice plate internal stimulus cells, adds the golgi body inhibitor simultaneously, 37 ℃ of 5%CO ₂Leave standstill in the incubator and cultivate 5h.With cell transfer to the good aseptic EP pipe of mark, the centrifugal 5min collecting cell of 1500r/min, physiological saline 100 μ L re-suspended cells add Anti-CD4-FITC (1: 500) antibody or Anti-CD8-PerCPCy5.5 (1: 500) antibody, hatch 30min for 4 ℃.Hatch and finish to add fixedly 10min of stationary liquid with 1mL physiological saline washing 1 time.1mL physiological saline washing 1 time adds 4 ℃ of perforation of perforation liquid 75 μ L 30min.Punch off adds 100 μ L washingss, and washing back supernatant discarded adds the washing of 200 μ L washingss once again.Physiological saline 100 μ L re-suspended cells add Anti-TNF-α-PE (1: 500) and Anti-IFN-γ-APC (1: 500) antibody simultaneously, put and hatch 1h on ice.Hatch and finish with 500 μ L physiological saline re-suspended cells, FACS detects.

The result shows, adopts mtt assay to detect the T cell propagation effect of specific T-cells after the CTL of OVA epitope peptide or Th epitope peptide stimulated in vitro in the OVA immune mouse spleen cell, and can detect the special T cell of OVA has tangible propagation.As shown in figure 11, after the CTL epitope peptide of OVA and Th epitope peptide stimulated, experimental group was compared value-added effect obviously (P＜0.05) with the PBS control group, and wherein Safenour+OVA group cultivation effect is better than the OVA group.

CD28 is the transmembrane glycoprotein on a kind of T of being expressed in cell, and the part B7 molecule of its identification on antigen presenting cell is the important costimulatory signal of cell activation, causes effects such as rise that the various kinds of cell factor transcribes and translate, T cell proliferation.Stimulate the OVA immune mouse spleen cell with the proteic CTL epitope peptide of OVA, with flow cytometry lymphocyte subgroup is analyzed, the result shows: during oral immunity, and Safenour adjuvant group CD8 ⁺The CD28 expression amount significantly increases in the lymphocyte, CD8 between other each group ⁺CD28 ⁺Percentage of lymphocyte does not have significant difference (Figure 12).Stimulate the OVA immune mouse spleen cell with the Th epitope peptide, with flow cytometry lymphocyte subgroup is analyzed, the result shows: oral immunity and peritoneal immunity, Safenour adjuvant group CD4 ⁺The CD28 expression amount does not have the adjuvant group in the lymphocyte increases (Figure 13) to some extent.

For further analyzing the CD4 of propagation ⁺The lymphocytic acknowledgement type of T (Th1/Th2) adopts the flow cytometry technology to CD4 ⁺TNF-α in the T lymphocyte and IFN-γ carry out the double-tagging fluorescent dye respectively and detect.As shown in figure 14, experimental group CD4 ⁺IFN-γ expression level significantly descends in the T lymphocyte, and the prompting immunne response departs from the cellullar immunologic response type.Oral immunity Safenour adjuvant group IFN-γ expression level does not have the adjuvant group and increases, and illustrates that Safenour can promote IFN-γ secretion under this kind immune condition, has strengthened the Th1 type and has replied; Peritoneal immunity Safenour adjuvant group IFN-γ expression level does not have the adjuvant group continue to be reduced, and illustrates under this kind immune condition that Safenour has strengthened the Th2 type and replied, and suppresses IFN-γ secretion.Each experimental group and control group CD4 in this experiment ⁺TNF-alpha expression level is extremely low in the T lymphocyte, and not statistically significant is analyzed.

Stimulate mouse boosting cell with the CTL epitope peptide, adopt flow cytometry CD8 ⁺TNF-α in the T lymphocyte and IFN-γ carry out the double-tagging fluorescent dye respectively and detect.As shown in figure 15, adjuvant group and no adjuvant group CD8 during oral immunity ⁺TNF-α, IFN-γ expression amount increase to some extent than the PBS group in the T lymphocyte, and wherein the Safenour group increases significantly, shows that Safenour has induced CD8 ⁺The lymphocytic CTL of T replys; Adjuvant group CD8 during peritoneal immunity ⁺TNF-α, IFN-γ expression amount do not have the adjuvant group and decrease in the T lymphocyte, show that Safenour has suppressed CD8 ⁺The lymphocytic CTL of T replys.This conclusion and CD4 ⁺The lymphocytic response result of T is consistent.

Embodiment 4:

Safenour adjuvant biological safety detects

6 ages in week, healthy KM mouse was 30, male and female half and half, and mouse adapts to 2d at elder generation of animal housing sub-cage rearing, observes its activity, feed, ight soil and experimentizes after all no abnormal.30 mouse are divided into 5 groups at random, every group of male and female half and half.The animal fasting is freely drunk water behind the 16h, presses 0.2mL/ gastric infusion various dose Safenour polypeptide, and its dosage is respectively 1500mg/kg, 1000mg/kg, 500mg/kg, 250mg/kg, PBS, mends behind first administration 6h and feeds once.

Every day is supplement feed, moisture, replacing bedding and padding regularly, animal housing keeps air fresh, relative humidity 65 ± 5%, 25 ± 2 ℃ of temperature, observed for 2 weeks, record mouse outward appearance sign, behavior, secretory product, movement, death condition and toxic reaction (concrete symptom, severity, time of origin, time length, whether reversible) etc.Dead mouse is dissected, and the pathology paraffin section is observed and made to organs such as the heart of not dead mouse, normal control group mouse, liver, spleen, stomach, lung, kidney, small intestine, HE dyeing, and opticmicroscope carries out histopathological examination.

Cyclic peptide Safenour sees Table 1 to each treated animal death toll of acute toxicity test in mice and statistics.Behind first filling stomach, the equal hair of experimental group and control group mice is normal, no secretory product, and action is active, and stool and urine is no abnormal; After secondary is irritated stomach, do not see unusual yet; No toxicity symptom and death in two weeks.

Each dosage animal dead rate of table 1 cyclic peptide Sai Funuo (Safenour) acute toxicity test in mice

Experimental mouse is dissected each internal organs of back visual inspection does not have obvious pathology, and by microscopic examination maximum dose level group experimental mouse internal organ histopathologic slide, the result shows that heart, kidney, liver and the stomach of experimental mouse all do not have obvious pathological change.

In above-mentioned each implementation process, to being observed by immune mouse.Initial immunity is put to death to mouse and is drawn materials, and strong the depositing of experimental mouse do not have death, weight increase, the no abnormal reaction of whole body.It is unusual that depilation, erythema, subcutaneous scleroma and granuloma etc. do not appear in subcutaneous injection group, injection site; Symptoms such as abdominal injection group, mouse peritonitis do not occur and spleen diminishes, attenuation and light transmission enhancing; Oral immunity group, gi tract are not found damage and pathology, and spleen does not have considerable change.

The result shows that cyclic peptide Safenour toxicity is extremely low, has very high biological safety.

Claims

1. a bacillus amyloliquefaciens (Bacillus amyloliquefaciens) WH3, CCTCC:M2011266.

2. a kind of bacillus amyloliquefaciens according to claim 1, it is characterized in that: described bacillus amyloliquefaciens produces the ring-type cyclic peptide, and molecular weight is 1065Da, and this cyclic peptide structures formula is as follows:

3. the application of the described a kind of bacillus amyloliquefaciens of claim 1 in the preparation immunological adjuvant.