CN102925437B - Specific molecular marker of deletion mutation of base at site of eIF(iso) 4E.c of Chinese cabbage and application thereof - Google Patents
Specific molecular marker of deletion mutation of base at site of eIF(iso) 4E.c of Chinese cabbage and application thereof Download PDFInfo
- Publication number
- CN102925437B CN102925437B CN201210455275.5A CN201210455275A CN102925437B CN 102925437 B CN102925437 B CN 102925437B CN 201210455275 A CN201210455275 A CN 201210455275A CN 102925437 B CN102925437 B CN 102925437B
- Authority
- CN
- China
- Prior art keywords
- iso
- chinese cabbage
- eif
- site
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a specific codominant acid sphingomyelinase (ASM) marker at a site of a Chinese cabbage, and the specific codominant ASM marker at the site of the Chinese cabbage is directly related to identification of a wild type and a base deletion mutant at the eIF(iso) 4E.c of the Chinese cabbage. A marker related to detection of the site of the wild type is named as ASM-W, the size of a segment is 128bp, as shown in SEQ ID No.1. A marker related to detection of the corresponding site of the base deletion mutant is named as ASM-m, and the size of a segment is 124bp, as shown in SEQ ID No.2. According to a specific molecular marker of the deletion mutation of a base at the site of eIF(iso) 4E.c of the Chinese cabbage and application of the specific molecular marker, the homologous cloning technology is utilized to find a mutant at the side of eIF(iso) 4E.c, and the specific molecular marker used for indentifying the site is developed. The specific molecular marker can be utilized for accurate selection of genotypes of backcrossing descendants. At the same time, the specific molecular marker can also be used for sorting out Chinese cabbage germplasm resources to seek for mutant materials which are more abundant in genetic background.
Description
Technical field
The present invention relates to a kind of exploitation of mutant and related locus specific molecular marker thereof of gene, relate in particular to base deletion sudden change and locus specificity molecular markers development and the application of a kind of Chinese cabbage eukaryotic translation initiation factor eIF (iso) 4E.c.Mutant can provide variation source containing the antiviral Chinese cabbage germplasm in this mutational site for seed selection, site-specific molecule marker can directly apply to molecular mark and select the Chinese cabbage material that contains this mutational site, the efficiency of selection that improves eIF4E mutant, belongs to biological technical field.
Background technology
Chinese cabbage (Brassica rapa L.ssp pekinensis) is the important vegetable crop of Cruciferae, originates in China, all has at present plantation all over the world.Especially in the year-round provisions of China vegetables and s are adjusted, become the important component part that vegetable products is supplied with, thereby people's life has been had to material impact.In Chinese cabbage production process, often suffer the threat of the diseases such as virus disease, oidium and soft rot.The harm of virus disease is the most serious as a complete unit, and there is no blanket viral diseases medicament or other effective control techniques.Cultivate antiviral New Chinese Cabbage Variety and be the harm of reply virus disease first-selected approach [Wang Xue, Liu Yumei, Li Hanxia, make widely known brave, Fang Zhiyuan. Advance in Research on TuMV-resistance Breeding of Brassica Crops. gardening journal .2005,32 (5): 939-946].Vertical strong [the Miao Liqiang that waits of seedling, Zhang Yaowei, Cui Chongshi. China's progress of study on Chinese cabbage breeding for diseases resistance. the journal .2008 of Northeast Agricultural University, 37 (4): 529-533] research is found, in the pathogen separation thing of China's Chinese cabbage virus disease, 70% is Brassica 2 et 4 (Turnip Mosaic Virus, TuMV), also has a small amount of cucumber mosaic virus (Cucumber Mosaic Virus, CMV) and other virus.Therefore the main goal of attack of China's Chinese cabbage viral diseases breeding is anti-TuMV.
Two key elements cultivating anti-TuMV New Chinese Cabbage Variety are to have abundant anti-TuMV germ plasm resource and efficient breeding efficiency.China is Chinese cabbage country of origin, and germ plasm resource is very abundant, is wherein no lack of the good resource of anti-TuMV, also has how best in quality but not antiviral resource simultaneously.In conventional breeding practice, often the means by backcross transformation obtain the abundant resistant material of more genetic background.Along with the rise of molecular marking technique and going deep into of research, marker assisted selection has become and has improved efficiency of selection, the Main Means of shortening the breeding cycle in conventional breeding operation.Some transnational breeding groups spare no high price the main contents using innovation resources and exploitation and the closely linked molecule marker of Main Agronomic Characters as breeding project especially.
Generally speaking, find and the closely linked molecule marker of certain economical character, often need to be first chosen in the parent that objective trait aspect exists significant difference, and build segregating population (F2, RI, BC1, DH etc.), adopt to mix hive off (BSA) and traditional molecule marker (as RAPD, SRAP, AFLP, SSR etc.) technology analyzes, linkage distance by corresponding software analysis gained mark and proterties, finally obtains the molecule marker chain with objective trait.At present report adopts aforesaid method to obtain with the chain molecule marker in Turnip mosaic virus resistance in Chinese cabbage (TuMV) site just.Because different investigator's material therefors are different with selected labeling pattern, the resulting marking path chain from ntiviral characteristic is also different, between 3.8-15.36cM.Due to the linkage degree undertighten of these marks and proterties, thereby it still has certain distance for the anti-TuMV assistant breeding of Chinese cabbage.
On the other hand, because Arabidopis thaliana and Chinese cabbage belong to Cruciferae together, its antiviral correlation function gene has more deep research; The whole genome sequence of Chinese cabbage is announced [Wang et al., 2011, the genome of the mesopolyploidcrop species Brassica rapa.Nature Genetics.43 (10): 1035-1039] simultaneously.So can be by result and the combination of Chinese cabbage genome sequence column information of the research of Arabidopis thaliana functional gene, directly from the angle of antiviral correlation function gene, start with, by Chinese cabbage natural population is started with in the natural variation of some critical function gene locuss, find the mutant of antiviral correlation function gene; For mutational site exploitation locus specificity molecule marker (Allele specific marker, ASM), this mark itself is directly related with proterties, and this can make marker assisted selection more accurate undoubtedly.
Discovered in recent years aspect antiviral functions gene studies, how relevant with the sudden change of eukaryotic translation initiation factor 4E and isomer thereof by the antiviral proterties of recessive Dominant gene.[the Wittmann S such as Wittmann, Chatel H, Fortin MG, Laliberte JF.Interaction of the viral protein genome linked of Turnip mosaic virus with thetranslational eukaryotic initiation factor (iso) 4E of Arabidopsis thaliana using the yeast two-hybridsystem.Virology.1997, 234:84-92] and [the L é onard S such as L é onard, Plante D, Wittmann S, DaigneaultN, Fortin MG, Lalibert é JF.Complex formation between potyvirus VPg and translation eukaryoticinitiation factor 4E correlates with virus infectivity.J.Virol.2000, 74:7730-7737] prove respectively: Arabidopis thaliana eIF4E and eIF (iso) 4E can interact in conjunction with albumen (VPg) with the viral genome of TuMV.It is different that this interactional key amino acid and eukaryote self mRNA translate required key amino acid site, so some amino acid mutations of eIF4E and eIF (iso) 4E do not affect grow, but cause virus and the host of plant self, can not there is not mutual work, thereby make host show the characteristic of opposing virus infection.Ryder at romaine lettuce [Ryder EJ.1970.Inheritance of resistance tocommon lettuce mosaic.Am Soc Horticult Sci.95:378 – 379], Ruffel at capsicum [Ruffel S, DussaultMH, Palloix A, Moury B, Bendahmane A, Robaglia C, Caranta is natural recessiveresistance gene against potato virus Y in peper corresponds to the eukaryotic initiation factor 4E (eIF4E) .Plant Dec J.2002 C.2002.A, 32 (6): 1067-75], Nieto is at muskmelon [Nieto C, Piron F, Dalmais M, Marco CF, Moriones E, Gomez-Guillamon ML, Truniger V, Gomez P, Garcia-Mas J, Aranda MA, Bendahmane is for the identification of allelic variants of melon eIF4E A.2007.EcoTILLING, afactor that controls virus susceptibility.BMC Plant Biology.7, 34-42] etc. important vegetables had been found that on many such mutant resources, [the Yeam I such as Yeam, Kang BC, Lindeman W, Frantz JD, Faber N, andJahn MM.2005.Allele-specific CAPS markers based on point mutations in resistance alleles at thepvr1 locus encoding eIF4E in Capsicum.Theor.Appl.Genet.NNO, 178-186] in capsicum, for mutational site, developed corresponding locus specificity CAPs mark and the assisted Selection during for antiviral material transformation.
EIF4E and eIF (iso) 4E sudden change and the supposition of the effect antiviral thereof from other crops, in Chinese cabbage natural population, also may have the mutant of eIF4E and eIF (iso) 4E, and this sudden change may be relevant with the ntiviral characteristic of Chinese cabbage.China's Chinese-cabbage Germplasm is very abundant, but at present, seldom, the material relating to is very limited in the domestic and international research about Chinese cabbage ntiviral characteristic and eIF4E and eIF (iso) 4E relation.[the Rusholme RL such as Rusholme, Higgins EE, Walsh JA, Lydiate DJ.Genetic control of broad-spectrum resistance to turnip mosaic virus in Brassica rapa (Chinese cabbage) .Journal of General Virology.2007,88:3177 – 3186] to take Chinese cabbage inbred lines RLR22 and the viral sensitive material R-O-18 of high resistance TuMV be parent, build BC1F1 colony, carry out anti-TuMV (CDN1 and CZE1 strain) genetic research.Found that the antiviral recessive inheritance of a Chinese cabbage site retr01 and a dominant locus ConTR01, the mark pN202e1 chain with retr01 and the mark pO85e1 chain with ConTR01 have been found respectively in the association analysis of RFLP mark.Further adopt the means of southern hybridization to find in A genome, have respectively the eIF4E (laying respectively at karyomit(e) N1, N3 and N8) of 3 copies and eIF (iso) 4E (laying respectively at karyomit(e) N4, N5 and N8) of 3 copies.Author, according to results of hybridization, infer that the eIF4E being positioned on the 8th karyomit(e) may be relevant with ConTR01 with eIF (iso) 4E, and eIF (iso) 4E being positioned on the 4th karyomit(e) may be relevant with retr01.In literary composition, the sequence information about two genes is not reported.[the Jenner CE such as Jenner, Nellist CF, Barker GC, Walsh JA.Turnip mosaic virus (TuMV) is able touse alleles of both eIF4E and eIF (iso) 4E from multiple loci of the diploid Brassica rapa.Mol PlantMicrobe Interact.2010, 3 (11): 1498-1505] from viral sensitive material R-O-18, clone has obtained eIF4E and each three copies of eIF (iso) 4E, difference called after BraA.eIF (iso) 4E.c, BraA.eIF4E.b, BraA.eIF4E.c and BraA.eIF (iso) 4E.a, BraA.eIF (iso) 4E.b, BraA.eIF (iso) 4E.c.Except BraA.eIF4E.b and BraA.eIF (iso) 4E.b, all the other 4 genes are arabidopsis thaliana transformation At.eIF (iso) 4E afunction mutant [DupratA respectively, Caranta C, ReversF, Menand B, Browning KS, Robaglia is Arabidopsis eukaryotic initiation factor (iso) 4E is dispensable for plant growth but required for susceptibility to potyviruses.The PlantJournal C.2002.The, 32:927 – 934], then to all transgenic line inoculation TuMV Canada strain CDN1, carry out viral susceptibility complementation test.According to disease index and ELISA result, find that four genes that turn all can make mutant recover wholly or in part the susceptibility that TuMV is infected.This shows, when TuMV infects Chinese cabbage group, eIF4E and eIF (iso) 4E may participate in virus and host's interaction.Author points out simultaneously, wants the acquisition antiviral material relevant with eIF (iso) 4E with eIF4E in Chinese cabbage, and these genes need loss of function simultaneously.Up to now, Chinese cabbage has no report both at home and abroad in the sudden change of above-mentioned two gene locuss and the marker development of related mutants detection.
Given this, be necessary the polymorphism in eIF4E and each site of eIF (iso) 4E in resist/sense of the Chinese cabbage of China's abundant TuMV material to carry out extensive examination, with the mutation type of finding that each site may exist; For the sequence difference of mutational site and wild-type, exploitation detects relevant locus specificity molecule marker with mutant simultaneously.The potential benefit that has the following aspects: 1. can, by this mark for examination Chinese cabbage population, provide efficient Chinese cabbage mutant detection means; 2. when mutation type is found in other sites, can adopt the exploitation mark that uses the same method; 3. when the sudden change in a plurality of sites is arranged in different materials, can the sudden change of multidigit point be condensed together by marker assisted selection means, create the anti-TuMV Chinese cabbage of wide spectrum new germ plasm; 4. when cultivating the anti-TuMV New Chinese Cabbage Variety of wide spectrum, can realize marker assisted selection, improve breeding efficiency.Because this mark is located immediately at functional gene inside, the rate of accuracy reached 100% of therefore selecting.
Summary of the invention
For above-mentioned prior art, for current Chinese cabbage in the blank aspect eIF4E and the evaluation of eIF (iso) 4E gene point mutation body, first the present invention obtains the base deletion mutant in an eIF (iso) 4E.c site, secondly according to the sequence characteristic in mutational site, design primer, has developed and has identified the ASM codominant marker of wild-type and mutant and for marker assisted selection.
The present invention is achieved by the following technical solutions:
A kind ofly identify directly related locus specificity codominance ASM mark to Chinese cabbage eIF (iso) 4E.c wild-type and base deletion mutant: detect relevant mark called after ASM-W with wild-type site, clip size 128bp, as shown in SEQ ID No.1; Relevant mark called after ASM-m is detected in corresponding base deletion mutational site, and clip size 124bp, shown in SEQ ID No.2.
For differentiating that the primer of above-mentioned specificity codominant marker is:
Forward primer PF1:5'-CGAAGAAGAATATGGCGACAGA-3';
PF2：5'-ACATTCACATGTTCAAAGCTGGTGTT-3'；
Reverse primer PR1:5'-CTATTCTCTTGCATTGTTTGAGCG-3';
PR2:5'-AGTTTCAAGCCAAGCCTTGTCTAAAG-3'; As shown in SEQ ID NO.3,4,5,6.
The present invention adopts Homology-based cloning to be cloned into respectively eIF (iso) 4E.c gene complete sequence from the anti-TuMV of a Chinese cabbage and a Chinese cabbage sense TuMV self-mating system material, by eIF (iso) 4E.c of the B.rapa self-mating system R-O-18 having reported in 2 sequences and GenBank relatively after, discovery from eIF (iso) 4E.c of sensitive material with reported in full accord, eIF (iso) 4E.c from virus resistance material has lacked four bases, and this deletion segment is positioned at exon region.This shows that eIF (iso) 4E.c from resistant material is mutant, with lowercase, represents to be eIF (iso) 4e.c1, with distinguish that Yu Ben seminar identifies another at the transposon insertion mutation body eIF (iso) in this site 4e.c2.
Because Chinese cabbage has three eIF (iso) 4E gene, and between three, homology is higher, and we have adopted Nested PCR Technique this mutational site of increasing.First we analyzed the genome sequence of three eIF of Chinese cabbage (iso) 4E, the special primer of having determined amplification eIF (iso) 4E.c, carries out first round pcr amplification, then for the conserved sequence of both sides, mutational site, design nested primers, carries out second and takes turns PCR.Amplified production carries out non-denaturing polyacrylamide (8%) gel electrophoresis, can wild-type and mutant be carried out effective separated.Through resisting/feel the F2 of material, for population analysis, show, the method reaches 100% to the identification efficiency of wild-type, mutant and heterozygous.
The screening process of described ASM mark is as follows:
(1) take the responsive self-mating system 06-247 of Chinese cabbage anti-TuMV self-mating system He102 and TuMV is material, adopts CTAB method, extracts both genomic dnas.
(2) according to eIF (iso) the 4E.c sequence of the B.rapa self-mating system R-O-18 having reported in GenBank, in coding region upstream and downstream, design primer.Adopt Homology-based cloning, from two parts of materials, clone has obtained its eIF (iso) 4E.c and has checked order respectively.
(3) eIF (iso) the 4E.c sequence of gained eIF (iso) 4E.c and R-O-18 is compared respectively, found a place 4 base deletion sudden changes; Coding region sequence is derived and the prediction of translation product simultaneously, find in full accord from eIF (iso) its genome sequence of 4E.c of viral sensitive material 06-247 and coding region sequence and the R-O-18 of derivation.And lacked four bases from eIF (iso) 4E.c of resistant material He102, and through coding region, derive, find that these four bases are positioned at 411bp-414bp place, coding region just, this disappearance causes phase shift mutation and translation product premature termination.Accordingly, according to the conservative property of eIF (iso) 4E.c gene, in both sides, base deletion site, design respectively two cover primers, carry out nest-type PRC amplification, first set primer can increase out by the genome sequence of eIF (iso) 4E.c specifically, then as template, add inner side nested primers, carry out second and take turns pcr amplification, result has increased wild-type site and mutational site out simultaneously, and this is codominance site-specific labeling (ASM).
Described mark can be used as molecule marker and is applied to Chinese-cabbage Germplasm evaluation and breeding assist-breeding, selects germplasm materials or the transformation offspring of containing eIF in He102 (iso) 4E.c base deletion mutation type.Concrete application mode is: utilizing two cover combination of primers of ASM mark to carry out twice PCR amplification to the genomic dna of individuality to be measured, detect amplified fragments size, if amplify the band of 128bp, is wild-type; The band that expands 124bp is saltant type; If expand two bands simultaneously, it is heterozygous.
The invention has the beneficial effects as follows: owing to being subject to the control of a plurality of genes on Chinese cabbage eIF4E site, in a material, the frequency of polygene simultaneous mutation is lower.If can identify mutant separately in each site respectively, the locus specificity molecule marker that exploitation detects for each mutant, can pass through convergent cross binding molecule marker assisted selection, and a plurality of mutational sites are aggregated in in a material.The present invention utilizes Homology-based cloning to find a base deletion mutant in eIF (iso) 4E.c site and developed the molecule marker of identifying this site.Utilize this mark accurately to select backcross transformation offspring's genotype.This mark also can be used for Chinese-cabbage Germplasm to carry out examination simultaneously, to find the mutant material that genetic background is abundanter.Its advantage is specific as follows:
The present invention obtain with eIF (iso) the 4E.c site base deletion directly related mark that suddenlys change, result is stable, accurate, easy and simple to handle.Being applicable to the screening of different genetic background Chinese cabbage materials, is a ubiquity mark.It can precise Identification Chinese-cabbage Germplasm in the genotype in this site, greatly improved the screening efficiency at eIF (iso) 4E.c site mutation body to Chinese-cabbage Germplasm.
2. aspect Chinese cabbage eIF4E gene order and saltant type research, only Jenner etc. (2010) has reported the sequence of a self-mating system R-O-18 of B.rapa, and other mutant has no report.For the specific mark in this mutational site, can identify for germ plasm resource, by the screening of the means such as backcross transformation and the mutant material of cultivating different genetic backgrounds, provide assisted Selection instrument.Application of the present invention can greatly be simplified screening means, shorten the transformation time limit, has avoided the blindness of selecting in conventional breeding method.
Accompanying drawing explanation
Fig. 1: the amplification (agarose gel electrophoresis) of two parts of Chinese cabbage material eIF (iso) 4E.c gene, M is DNA molecular amount standard DL5000.
The eIF of Fig. 2: He102 and 06-247 (iso) 4E.c genome sequence comparison (showing discrepant part in figure).
Fig. 3: from 06-247(wild-type BraeIF (iso) 4E.c) with He102(mutant BraeIF (iso) 4e.c) amino-acid sequence comparison (being shown with difference part in figure).
Fig. 4: amplification (the be ASM marker development) result of nested primer in parent.
Fig. 5: the amplification situation (P1: parent 1 is 06-247 of nested primer part individual plant in parent JiF2 colony; P2: parent 2 is He102; 1-21 is F2 generation 21 individual plants, wherein 6,11,12,15,17 and 20 with parent 1,10,16 with parent 2, all the other individual plants are heterozygous).
Embodiment
Below in conjunction with embodiment, the present invention is further illustrated.Experimental technique in embodiment, if no special instructions, is ordinary method.
The clone of eIF (iso) 4E.c in embodiment 1, different Chinese cabbage inbred lines material
1.1 Chinese cabbage extracting genome DNA
(1) Seedling of Chinese Cabbage blade is put into the mortar of Liquid nitrogen precooler, abundant grind into powder in liquid nitrogen;
(2) treat that liquid nitrogen volatilization is dry, transfer to immediately in the centrifuge tube of 2ml, every 100mg material approximately adds 0.6ml to be preheated to the CTAB extracting solution of 65 ℃, and after thawing, thermal agitation mixes sample, and 65 ℃ of water-baths are placed and within 40-60 minute, made lysis;
(3), after cracking finishes, take out sample and make it be cooled to room temperature completely.Add isopyknic chloroform (chloroform), put upside down gently and make to mix, room temperature is placed 10 minutes;
(4) room temperature, centrifugal 15 minutes of 12000rpm;
(5) with the careful sucking-off of pipettor upper strata water, add in the centrifuge tube of new 1.5ml, add the Virahol (1:1 volume) of 500 μ l, fully mix precipitation at room temperature 10min;
(6) 4 ℃, the centrifugal 10min of 12000rpm, careful abandoning supernatant;
(7) DNA precipitation 1ml75% washing with alcohol.4 ℃, the centrifugal 10min collecting precipitation of 8000rpm;
(8) repeat by DNA precipitation of 75% washing with alcohol;
(9) remove supernatant, DNA is deposited on aseptic operating platform and dries about 10-15 minute, and it is transparent that DNA shows slightly, and adds the Tris.HCl (pH8.0) of the 10mM of proper volume (30-50 μ l) to make resolution of precipitate (can be placed on 4 ℃ of refrigerators dissolvings spends the night);
(10) ultraviolet spectrophotometer and 1%Agrose detected through gel electrophoresis DNA concentration and quality.
Clone and the sequential analysis of 1.2eIF (iso) 4E.c
(1) eIF (iso) the 4E.c gene complete sequence (GenBank:HM131211.1) of retrieval B.rapa self-mating system R-O-18, designs respectively forward and reverse primer at upstream of coding region and downstream,
PF1：5'GTTCGGAGAAGAGAAGACGGAG3'；
PR1:5'AAGATTACAGGCTTTTAAGGCC 3', as shown in SEQ ID NO.3,5.
(2) pcr amplification: in 20 μ l reaction systems, comprise 1 * TransStart FastPfu buffer; The genomic dna of 20ng; The forward and reverse primer of 0.4 μ M; 0.25mM dNTPmix; The TransStart FastPfu archaeal dna polymerase (TransGenAP221) of 1 unit.PCR cycling condition: 95 ℃ of denaturations 5 minutes; Then be 95 ℃ of sex change 30 seconds, anneal 30 seconds for 57.5 ℃, 72 ℃ are extended 40 seconds, 35-38 circulation, and last 72 ℃ are extended 10 minutes.
(3) electrophoresis detection of PCR product:
After PCR finishes, get 10 μ lPCR amplified productions and add 1 μ l10 * loading buffer, carry out electrophoresis on 1% sepharose, electrophoresis finishes rear EB dyeing, and gel imaging system is observed and taken pictures automatically.The results are shown in Figure 1.
(4) cloning and sequencing of PCR product
After electrophoresis confirms that object band is amplified, get 1 μ l pcr amplification product and add 1 μ l pEasy-Blunt (TransGen CB101) carrier room temperature connection 10 minutes, transform competent escherichia coli cell Trans1-T1 (TransGen:CD501), transformed bacteria is being cultivated about 16 hours containing 37 ℃ of inversions on the LB solid plate of 50 μ g/ml kantlex.After bacterium colony PCR detects, picking positive colony entrusts Beijing Hua Da gene company limited to carry out the mensuration of DNA sequence dna.
(5) Chinese cabbage eIF (iso) the 4E.c sequential analysis of cloning
BrA.eIF (iso) 4E.c genome sequence from TuMV resistant material He102 and susceptible material 06-247 is compared respectively at the known BrA.eIF from R-O-18 (iso) 4E.c, discovery is from BrA.eIF (iso) the 4E.c genome sequence of TuMV sensitive material 06-247 and the complete homology of R-O-18, by its called after BrA.eIF (iso) 4E.c, be called wild-type; And lacked four bases from BrA.eIF (iso) 4E.c of TuMV resistant material He102, and we are called mutant by its called after BrA.eIF (iso) 4e.c, and its sequence is as shown in SEQ ID NO.7, and the two difference part is as shown in Figure 2.
1.3ORF prediction and amino-acid sequence are derived
(1) from GenBank, retrieval obtains homogenic ORF in R-O-18.Splign (http://www.ncbi.nlm.nih.gov/sutils/splign/splign.cgi textpage=online & level=form) instrument with NCBI, the ORF that analyzes BrA.eIF (iso) 4e.c, its sequence is as shown in SEQ ID NO.8.
(2) its ORF is carried out to sequence alignment, the part that finds differences is positioned at exon region just, as shown in Figure 2.Amino acid whose derivation is carried out with DNAMAN software, and the disappearance that found that four bases causes the premature termination of phase shift mutation and translation product.Wild-type coded product has 200 amino acid, and mutant code product only has 117 amino acid, the amino-acid sequence of its translation product is as shown in SEQ ID NO.9, and the difference of itself and normal encoding product as shown in Figure 3, visible in figure, mutant has lacked 90 amino acid of N end.
The exploitation of embodiment 2 codominance ASM marks
Because the genome sequence of BrA.eIF (iso) 4E.c and BrA.eIF (iso) 4e.c exists the insertion/deletion sudden change of four bases, and the conservative property of the nucleotide sequence of both sides, mutational site is not strong, we adopt nest-type PRC strategy this mutational site of increasing accordingly, first with the pair of primers (PF1 and PR1) of amplification gene group sequence, carry out first run pcr amplification, in both sides, mutational site, design again inner side nested primers PF2 and PR2 (as SEQ ID NO.4, shown in 6), the pcr amplification product for the first time of take is template, carry out second and take turns pcr amplification, pcr amplification condition is as shown in 1.2 (2) bars.
Amplified production carries out electrophoretic separation and cma staining on 8% polyacrylamide gel, dyeing procedure is with reference to [Zhang Chunleis such as Zhang Chunleis, Tong Guangxiang, the friendship of rectifying, Zhang Chao, Yin Jiasheng. the sex change of micro-satellite product and the comparison of non-sex change PAGE-silver staining method. Fisheries Science magazine .2010,23 (1): 11-14] method.Result makes a distinction wild-type and mutant well, and result as shown in Figure 4.This is labeled as codominant marker, and wherein the mark relevant with wild-type is ASM-W, clip size 128bp, and its sequence is as shown in SEQID NO.1; Relevant with the mutant ASM-m that is labeled as, clip size 124bp, its sequence is as shown in SEQ ID NO.2.
The F2 colony that embodiment 3 ASM marks combine He102 * 06-247 to Chinese cabbage identifies
(1) each individual plant extracting genome DNA of F2 colony is as described in 1.1.
(2) pcr amplification: the preparation of PCR reaction solution and amplification condition are as described in 1.2 (2) bars.
(3) detection of PCR product as described in Example 2.As shown in Figure 5, P1 is parent 1 to detected result, i.e. 06-247, and P2 is parent 2, i.e. He102A, 1-21 is that 21 F2 are for individual plant.As can be seen from the figure 6,11,12,15,17 and 20 with parent 1, is wild-type, and 10,16 with parent 2, is mutant, and all the other individual plants are heterozygous.Adopt as can be seen here nest-type PRC strategy, by twice PCR, increase, to identifying the rate of accuracy reached 100% of wild-type, base deletion saltant type and the heterozygous in eIF (iso) 4E.c site.
Claims (5)
1. a specific molecular marker for Chinese cabbage eIF (iso) 4E.c site base deletion sudden change, is characterized in that: detect relevant mark called after ASM-W to wild-type site, clip size 128bp, as shown in SEQ ID No.1; Relevant mark called after ASM-m is detected in corresponding base deletion mutational site, and clip size 124bp, as shown in SEQ ID No.2.
2. the primer of the specific molecular marker that the base deletion of Chinese cabbage eIF claimed in claim 1 (iso) 4E.c site suddenlys change, is characterized in that: sequence is as follows:
PF1:5 '-CGAAGAAGAATATGGCGACAGA-3 ', as shown in SEQ ID NO.3;
PF2:5 '-ACATTCACATGTTCAAAGCTGGTGTT-3 ', shown in SEQ ID NO.4;
PR1:5 '-CTATTCTCTTGCATTGTTTGAGCG-3 ', as shown in SEQ ID NO.5;
PR2:5 '-AGTTTCAAGCCAAGCCTTGTCTAAAG-3 ', as shown in SEQ ID NO.6;
The genomic dna that utilizes PF1 and PR1 to be primer pair individuality to be measured carries out pcr amplification for the first time; Recycling PF2 and PR2 are primer, and the pcr amplification product of take for the first time carries out pcr amplification for the second time as template.
3. the application of the specific molecular marker of Chinese cabbage eIF claimed in claim 1 (iso) 4E.c site base deletion sudden change in the genotype of differentiating Chinese cabbage eIF (iso) 4E.c gene locus.
4. the application of primer claimed in claim 2 in the genotype of differentiating Chinese cabbage eIF (iso) 4E.c gene locus, is characterized in that: concrete application mode is: the genomic dna that utilizes PF1 and PR1 to be primer pair individuality to be measured carries out pcr amplification for the first time; Recycling PF2 and PR2 are primer, and the pcr amplification product of take for the first time carries out pcr amplification for the second time as template; The size of pcr amplified fragment is for the second time detected, if amplify the band of 128bp, is wild-type; The band that expands 124bp is saltant type; If expand two bands of 128bp and 124bp simultaneously, it is heterozygous.
5. application according to claim 4, is characterized in that: described pcr amplification is specially: in 20 μ l reaction systems, comprise 1 * TransStart FastPfu buffer; The genomic dna of 20ng; The forward and reverse primer of 0.4 μ M; 0.25mM dNTPmix; The TransStart FastPfu archaeal dna polymerase of 1 unit;
PCR cycling condition: 95 ℃ of denaturations 5 minutes; Then be 95 ℃ of sex change 30 seconds, anneal 30 seconds for 57.5 ℃, 72 ℃ are extended 40 seconds, 35-38 circulation, and last 72 ℃ are extended 10 minutes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210455275.5A CN102925437B (en) | 2012-11-13 | 2012-11-13 | Specific molecular marker of deletion mutation of base at site of eIF(iso) 4E.c of Chinese cabbage and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210455275.5A CN102925437B (en) | 2012-11-13 | 2012-11-13 | Specific molecular marker of deletion mutation of base at site of eIF(iso) 4E.c of Chinese cabbage and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102925437A CN102925437A (en) | 2013-02-13 |
| CN102925437B true CN102925437B (en) | 2014-02-26 |
Family
ID=47640368
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210455275.5A Expired - Fee Related CN102925437B (en) | 2012-11-13 | 2012-11-13 | Specific molecular marker of deletion mutation of base at site of eIF(iso) 4E.c of Chinese cabbage and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102925437B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103103187A (en) * | 2013-02-22 | 2013-05-15 | 山东省农业科学院蔬菜研究所 | Specific molecular marker of Brassica rapa L.ssp pekinensis eIF (iso) 4E.a locus large fragment deletion mutation and application thereof |
| CN108866234B (en) * | 2018-08-28 | 2021-09-17 | 贵州省烟草科学研究院 | Tobacco eIF4E-1 mutation site specific codominant molecular marker and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101838645A (en) * | 2010-05-24 | 2010-09-22 | 山东省农业科学院蔬菜研究所 | A pair of cabbage turnip mosaic virus EST-SSR markers and application thereof |
| CN102703445A (en) * | 2012-05-31 | 2012-10-03 | 山东省农业科学院蔬菜研究所 | Specific molecular markers of eIF4E.a mutation site of Chinese cabbage and application of Specific molecular markers |
-
2012
- 2012-11-13 CN CN201210455275.5A patent/CN102925437B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101838645A (en) * | 2010-05-24 | 2010-09-22 | 山东省农业科学院蔬菜研究所 | A pair of cabbage turnip mosaic virus EST-SSR markers and application thereof |
| CN102703445A (en) * | 2012-05-31 | 2012-10-03 | 山东省农业科学院蔬菜研究所 | Specific molecular markers of eIF4E.a mutation site of Chinese cabbage and application of Specific molecular markers |
Non-Patent Citations (3)
| Title |
|---|
| Mapping and candidate-gene screening of the novel Turnip mosaic virus resistance gene retr02 in Chinese cabbage(Brassica rapa L.);Wei Qian等;《Theor Appl Genet》;20120921;第126卷;179-188 * |
| Turnip mosaic virus (TuMV) Is Able to Use Alleles of Both eIF4E and eIF(iso)4E from Multiple Loci of the Diploid Brassica rapa;Carol E. Jenner等;《Molecular Plant-Microbe Interactions》;20101231;第23卷(第11期);1498-1505 * |
| 大白菜eIF4E基因家族cDNA克隆及序列分析;刘栓桃 等;《中国园艺学会十字花科分会第十届学术研讨会论文集》;20121001;213-218 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102925437A (en) | 2013-02-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Saito et al. | Fine mapping of the clubroot resistance gene, Crr3, in Brassica rapa | |
| Ohmori et al. | Molecular characterization of RAPD and SCAR markers linked to the Tm-1 locus in tomato | |
| US7919675B2 (en) | Marker mapping and resistance gene associations in soybean | |
| CN108893551B (en) | Molecular marking method for detecting high oleic acid content of peanuts and application | |
| CN102703445B (en) | Specific molecular markers of eIF4E.a mutation site of Chinese cabbage and application of Specific molecular markers | |
| AU2019246847A1 (en) | Qtls associated with and methods for identifying whole plant field resistance to sclerotinia | |
| JP5908834B2 (en) | Pathogen resistant plant | |
| US20180030550A1 (en) | Genetic locus associated with phytophthora root and stem rot in soybean | |
| CN104450932B (en) | Rice blast resistance gene Pi2 gene specific molecular labelings Pi2SSR and its preparation method and application | |
| Jia et al. | Characterization of wheat yellow rust resistance gene Yr17 using EST-SSR and rice syntenic region | |
| KR102052428B1 (en) | SSR molecular markers for discriminating Korean wild grape accessions and uses thereof | |
| CN102766697A (en) | Molecular marking method for detecting imidazolone herbicide resisting gene of cabbage type rape | |
| Khan et al. | Development of an RAPD-based SCAR marker for smut disease resistance in commercial sugarcane cultivars of Pakistan | |
| CN102747070A (en) | Two CAPs markers tightly linked with muskmelon anti-powdery mildew gene Pm-AN and its application method | |
| CN102925437B (en) | Specific molecular marker of deletion mutation of base at site of eIF(iso) 4E.c of Chinese cabbage and application thereof | |
| CA2867535A1 (en) | Molecular markers for low palmitic acid content in sunflower (helianthus annus), and methods of using the same | |
| CN105586432B (en) | Detect wheat whether reagent set and molecular labeling containing haynaldia villosa 6VS chromosome arm | |
| CN103103187A (en) | Specific molecular marker of Brassica rapa L.ssp pekinensis eIF (iso) 4E.a locus large fragment deletion mutation and application thereof | |
| Azhaguvel et al. | High-resolution linkage mapping for the non-brittle rachis locus btr1 in cultivated× wild barley (Hordeum vulgare) | |
| Kozjak et al. | Isolation and sequence analysis of NBS–LRR disease resistance gene analogues from hop Humulus lupulus L. | |
| CN102994497B (en) | Chinese cabbage eIF (iso) 4E.c site transposon degenerated hull | |
| CN105695589B (en) | Detect wheat whether reagent set and molecular labeling containing haynaldia villosa 6V#4S chromosome arm | |
| CN103290126B (en) | Molecular marker for distinguishing cabbage eIF (iso) 4G gene wild type and mutant and application thereof | |
| Abedi et al. | Performance of different rice genotypes against blast pathogen through linked molecular markers | |
| JP4366494B2 (en) | Microsatellite marker for detection of resistance genes against clubroot clubroot and its utilization |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140226 Termination date: 20211113 |