CN108866234B - Tobacco eIF4E-1 mutation site specific codominant molecular marker and application thereof - Google Patents

Abstract

The invention discloses a tobacco eIF4E-1 mutation site specificity codominant molecular marker, wherein a marker related to wild type site detection is named as ASM-W, and the segment size is 543bp, and is shown as SEQ ID No. 1; the corresponding marker related to the detection of the base insertion mutation site is named as ASM-m, the fragment size is 543bp, and the marker is shown as SEQ ID No. 2. The invention also discloses a primer for identifying the mutation site specificity codominant molecular marker, and the primer sequence is shown as SEQ ID NO.3, 4 and 5. The marker and the primer can be used for accurately selecting the genotype of the backcross transfer progeny of the PVY resistant donor parent. The marker and the primer can be used as molecular markers to be applied to tobacco germplasm resource identification and breeding auxiliary breeding, and germplasm materials or transformed offspring containing the open-positive small black tobacco eIF4E-1 mutation type are selected.

Description

Tobacco eIF4E-1 mutation site specific codominant molecular marker and application thereof

Technical Field

The invention relates to a gene mutant and development of a site-specific molecular marker related to the gene mutant, in particular to mutation of a translation initiation factor eIF4E-1 of a tobacco eukaryote and development and application of the site-specific molecular marker. The mutant can provide a mutant source for breeding antiviral tobacco germplasm containing the mutation site, and the site-specific molecular marker can be directly applied to molecular marker-assisted breeding to select tobacco materials containing the mutation site, so that the selection efficiency of the eIF4E-1 mutant is improved, and the method belongs to the technical field of biology.

Background

Tobacco Potato virus Y, also known as vein blotch, is a systemic infection of tobacco caused by Potato Virus Y (PVY). The loss caused by the disease is different between the tobacco infection period and the virus strain, the early-infected pulse necrosis strain can cause dead delivery and no harvest, and if the strain is infected or infected with weak strain in the near-harvest period, the yield reduction is relatively light, and the loss is generally 25-45%. Besides causing yield loss, PVY is worse in color and smoke flavor after the diseased leaves are baked and sun-cured, and the quality is obviously reduced.

The breeding of PVY-resistant tobacco varieties is the most economical and effective method for preventing and treating the PVY-resistant tobacco varieties. In order to select and breed disease-resistant varieties, a plurality of PVY-resistant germplasm resources such as VAM, V.SCR and the like are identified at home and abroad, and disease-resistant burley tobacco varieties TN86 and TN90, flue-cured tobacco varieties NC55 and NC102 and the like are bred. Most resistance to the source is manifested by recessive gene (va) control, due to gene deletion in the PVY susceptibility. And developing molecular markers (RAPD, SCAR) related to the Va site. The resistance of the tobacco germplasm RY5 to a PVY necrosis strain (PVYN) accords with a genetic model of quality traits controlled by a Mendelian pair of recessive genes, and RAPD markers O12V3695 and SCAR markers PVY ME1 which are closely linked with a dominant allelic locus (Va) corresponding to a disease-resistant gene are reported. The RAPD marker and SCAR marker reported in the literature are linked to PVY resistance by 2.10cM and 2.52cM respectively. The long linkage distance to PVY resistance results in large errors in the determination of the resistance phenotype using marker data. Meanwhile, RAPD markers have the defects of low specificity of amplification products, judgment of non-target band interference results, the number of cycles required by PCR amplification up to 45 cycles and the like.

The eIF4E has been shown to be a recessive PVY-resistant gene at the locus of the Va gene, i.e. a PVY-sensitive gene. In 2014, foreign scholars adopt a new generation sequencing technology to compare tobacco influenza PVY near isogenic line transcriptome, and the tobacco eIF4E-1 gene (GenBank accession number KF155696) is determined to be the tobacco PVY recessive disease-resistant gene. In 2015, Liu Yong, etc. of Yunnan province developed a dominant molecular marker (patent application No. 2014101504706) closely linked to PVY resistance according to sequence information of tobacco eIF4E-1 gene and its family gene, and obtained a primer pair with no amplified band in tested disease-resistant variety and specific band in susceptible variety by designing an upstream primer (CF2) in the 1 st exon of tobacco wild type eIF4E-1 gene and designing a downstream primer (GR11) in the intron region. The marker can distinguish partial disease-resistant flue-cured tobacco (or burley tobacco) varieties from susceptible varieties, but cannot effectively distinguish homozygous and heterozygous genotypes of wild type eIF4E-1, for example, the applicant finds that approximate specific bands can be amplified in 6 PVY disease-resistant flue-cured tobacco varieties and 8 PVY disease-resistant flue-cured tobacco or sun-cured tobacco varieties by applying the CF2/GR11 primer through sequence analysis and PCR verification (as shown in figure 1), so that the marker cannot effectively distinguish the tobacco PVY resistant varieties, and the molecular marker cannot be directly used for auxiliary selection when the mutant eIF4E-1 locus is backcrossed and transformed.

Disclosure of Invention

In order to overcome the defects of the existing molecular marker, the invention provides a molecular marker for identifying the PVY resistance of tobacco aiming at the obtained base insertion mutant of the eIF4E-1 site, designs a primer according to the sequence characteristics of a mutation site, develops a codominant marker for identifying a wild type and a mutant and is used for marker-assisted selection. The molecular marker of the tobacco PVY recessive disease-resistant gene is utilized to carry out auxiliary selective breeding, thereby playing a promoting role in accelerating the breeding process and improving the tobacco breeding level in China.

The technical scheme of the invention is as follows: a tobacco eIF4E-1 mutation site specificity co-dominant molecular marker is directly related to identification of a tobacco eIF4E-1 wild type and a base insertion mutant, wherein the marker related to detection of the wild type site is named as ASM-W, and the fragment size is 543bp, and is shown as SEQ ID No. 1; the corresponding marker related to the detection of the base insertion mutation site is named as ASM-m, the fragment size is 543bp, and the marker is shown as SEQ ID No. 2.

A primer for identifying the mutation site specificity codominant molecular marker has the following sequence:

forward primer FW: 5'-CACTTTTTCCACTGTCGAAGATTTATG-3', respectively;

forward primer Fm: 5'-ACTTTTTCCACTGTCGAAGATTTTATG-3', respectively;

reverse primer Rwm: 5'-AAAATTTTTAAAACAAGATAGACATTTGTGTG-3', respectively;

as shown in SEQ ID NO.3, 4 and 5;

the three primers were combined in two ways:

the combination of a forward primer FW and a reverse primer Rwm is used for amplifying a molecular marker ASM-W;

the combination of forward primer Fm and reverse primer Rwm is used to amplify the molecular marker ASM-m.

The invention also provides application of the tobacco eIF4E-1 mutation site specific co-dominant molecular marker in identifying the genotype of the tobacco eIF4E-1 gene site.

The invention also provides application of the primer in identifying the genotype of the eIF4E-1 gene locus. The specific application mode is as follows: performing PCR amplification on the genome DNA of an individual to be detected twice by using two sets of primers of the (FW + Rwm) combination and the (Fm + Rwm) combination, detecting the existence of an amplified fragment, and if the (Fm + Rwm) combination amplifies a 543bp specific amplified band, the (FW + Rwm) combination cannot amplify the band, the band is a homozygous mutant type; if the combination of (FW + Rwm) amplifies a specific amplification band of 543bp, but the combination of (Fm + Rwm) cannot amplify the specific amplification band, the specific amplification band is a wild type; and if the combination (FW + Rwm) and the combination (Fm + Rwm) can amplify a 543bp specific amplification band, the mutant is a heterozygous mutant.

The invention has the beneficial effects that: the invention utilizes the whole genome re-sequencing technology to combine PCR product clone verification to discover 1 SNP locus on the recessive anti-PVY gene eIF4E-1 of Kaoyang small black smoke, and utilizes the SNP locus to develop a locus specificity co-dominant ASM marker. The marker can be used for accurately selecting the genotype of the backcross transfer progeny of the PVY resistant donor parent. The marker and the primer can be used as molecular markers to be applied to tobacco germplasm resource identification and breeding auxiliary breeding, and germplasm materials or transferred offspring containing PVY resistant mutation types are selected.

Drawings

FIG. 1: polymorphism (agarose gel electrophoresis) of a primer CF2/GR11 among anti-influenza tobacco varieties, wherein 1-8 are anti-PVY varieties, 9-16 are influenza PVY varieties, and M is DNA molecular weight standard DL 5000;

FIG. 2: gDNA amplification (agarose gel electrophoresis) of eIF4E-1 genes of two parts of tobacco materials, wherein 1 and 2 respectively represent two parts of tobacco materials of K326 and Kaiyang Xiaoheiyan, and M is DNA molecular weight standard DL 15000;

FIG. 3: cDNA amplification (agarose gel electrophoresis) of eIF4E-1 genes of two tobacco materials, wherein 1 and 2 respectively represent two tobacco materials of K326 and Kaiyang Xiaoheiyan, and M is a DNA molecular weight standard 100bp Ladder;

FIG. 4: genomic sequence alignments from open-sun small black tobacco, K326 and red large eIF4E-1 (the differing portions are shown in the figure);

FIG. 5: alignment graph of cDNA sequences of eIF4E-1 of KANGYANG SMALL BLACK YANG, HONGHUADAJINYUAN and K326 (shown as the obvious difference part in the figure, the front ellipses are base insertion parts of two splice isomers of KANGYANG SMALL BLACK YANG, and the rear ellipses are base deletion parts of KANGYANG SMALL BLACK YANG splice isomer-2);

FIG. 6: the two deduced amino acid sequences were compared to the eIF4E-1 amino acid sequence from K326 and the major carthamus tinctorius (two splice isoforms of the open-positive small black tobacco or a frameshift mutation starting at amino acid 83, premature termination, or deletion of the middle large fragment can be seen);

FIG. 7 shows the amplification of two sets of AS-PCR primers for the genomic DNA of the infection-resistant material (A: FW/Rwm amplification result; B: Fm/Rwm amplification result; 1: resistance-developing small black tobacco of disease-resistant tobacco variety containing mutant eIF4E-1 gene locus; 2, 3, 4, 5, 6: infection-sensitive tobacco variety K326, safflower large jinyuan, Yunyan 87, Zhenyuan small tobacco and guicheng sun-cured tobacco containing wild type eIF4E-1 gene locus);

FIG. 8: the detection results of two sets of AS-PCR primers on part of single plants in F2 generation segregation populations (A: FW/Rwm primer pair amplification result; B: Fm/Rwm primer pair amplification result);

FIG. 9: the detection results of two sets of AS-PCR primers on part of single plants in backcross offspring (A: the amplification result of FW/Rwm primer pair; B: the amplification result of Fm/Rwm primer pair);

FIG. 10: the comparison between conventional improved breeding of transferred single recessive gene and molecular marker assisted selective breeding is shown schematically.

Detailed Description

1. Tobacco eIF4E gene locus difference analysis and verification

Based on the previous research on PVY disease-resistant related genes, the research carries out sequencing on the whole genome of a high-resistance and high-sensitivity PVY tobacco variety and carries out deep sequence comparison on eIF4E and eIF (iso)4E gene family members by a genome re-sequencing technology. As a result, it was found that: compared with the conservation of the high-susceptible variety, the high-resistance variety has different degrees of base insertion or deletion mutation in the eIF4E-1 gene region.

To further validate candidate mutation sites obtained by whole genome re-sequencing, upstream and downstream primers for tobacco eIF4E-1 were designed based on the genomic sequence of eIF4E-1 and the sequence of eIF4E family members,

an upstream primer 4-S: CTAAAATCTATAACTAAGTACATAGAAAACACACG, respectively;

the downstream primer 4-A: GGTACTTAAACTGTCAAGTGGCAGC, as shown in SEQ ID NO.6, 7;

a PVY-sensitive flue-cured tobacco variety K326 and a PVY-resistant sun-cured tobacco variety Yang-developing small black tobacco are used as materials, and the gDNA and cDNA complete sequence of tobacco eIF4E-1 are amplified through PCR and RT-PCR technologies respectively (figure 2 and figure 3).

Sequencing the amplified gene, and comparing the sequenced gene with data of a safflower large gold (PVY susceptible material containing wild type eIF4E-1 gene) in a Chinese tobacco genome database to find that a conserved single-base insertion mutation exists in an eIF4E-1 gene region of sun-cured tobacco, namely sun-cured small black tobacco (figure 4). Further, the eIF4E-1 gene mRNA of flue-cured tobacco variety K326 is completely consistent with the major principal gene of safflower through coding region prediction and amino acid sequence deduction (FIG. 5); the sun-cured tobacco variety has two mRNA splice isomers, and due to the insertion of a single base T or caused frame shift mutation, a termination code appears in the downstream in advance, so that the protein is cut off, or variable shearing appears, so that a large fragment is deleted in the middle of the protein sequence (figure 6).

2. Tobacco eIF4E-1 mutation site specific codominant molecular marker and application thereof

2.1 molecular marker primer design

A F1, F2 and BC population is constructed by crossing anti-PVY tobacco Yang-opening small black tobacco and susceptible tobacco K326, and site-specific co-dominant molecular markers ASM-W and ASM-m are developed based on genome re-sequencing, and are co-separated from PVY disease-resistant phenotype as shown in SEQ ID No.1 and 2.

The primers are designed according to the difference between molecular markers ASM-W and ASM-m in the anti-and sensing materials, the reverse primers are fixed as RWM (shown as SEQ ID NO. 5), the forward primers are respectively Fm (shown as SEQ ID NO. 4) (a mismatched base A is introduced at the third position of the 3 'end) and FW (shown as SEQ ID NO. 3) (a mismatched base A is introduced at the second position of the 3' end), the nucleotide sequences, annealing temperatures and amplified fragment lengths of the primers are shown as follows:

primer name	Primer sequence (5 '-3')	Tm value	Fragment size
				RWm	AAAATTTTTAAAACAAGATAGACATTTGTGTG	55.96℃
Fm	ACTTTTTCCACTGTCGAAGATTTTATG	55.96℃	543bp
				FW	CACTTTTTCCACTGTCGAAGATTTTAG	56.48℃	543bp

2.2 tobacco DNA extraction

The CTAB method is adopted to prepare plant genome DNA, and the specific method is as follows:

1) taking 0.2-0.5 g of fresh and tender tobacco leaves, and grinding the fresh and tender tobacco leaves into powder in liquid nitrogen;

2) the powder was transferred to a 1.5ml centrifuge tube and 600. mu.l of 65 ℃ pre-heated CTAB extraction buffer (2% CTAB, 100mM Tris-HCl pH8.0, 20mM EDTA pH8.0, 1.4M NaC1) was immediately added;

3) inverting for several times, mixing, and water-bathing at 65 deg.C for more than 2 hr;

4) cooling at room temperature for 5min, adding 600 μ l 24:1(v/v) chloroform and isoamyl alcohol;

5) inverting for several times, mixing, and centrifuging at 12000rpm for 10 min;

6) collecting supernatant, adding 600 μ l of 24:1 chloroform and isoamylol;

7) inverting for several times, mixing, and centrifuging at 12000rpm for 10 min;

8) taking the supernatant, adding 1.5 μ l of RNase (10mg/ml), and standing at room temperature for 30 min;

9) adding isovolumetric isopropanol (-20 deg.C), inverting for more than 15 times, and standing at-20 deg.C for more than 0.5 hr;

10) centrifuging at 12000rpm for 10 min;

11) drying the precipitate, and dissolving in proper amount of double distilled water;

12) taking 2 mul of DNA sample with DNA, carrying out electrophoresis on 1% agarose gel, and carrying out electrophoresis at 100V for 30min to detect the quality of the DNA; a1. mu.l sample was taken and the DNA concentration was determined by Nanodrop.

2.3PCR amplification

1) PCR reaction (20. mu.l):

2) PCR reaction cycling program:

3) 5ul of the amplification product was electrophoretically detected on a 2% agarose gel.

In order to develop a molecular marker of a PVY recessive disease-resistant gene aiming at the small black tobacco capable of developing sun exposure, primers are designed aiming at mutation sites of eIF4E-1 of the tobacco variety according to an allele primer design principle, and through screening, two pairs of primers consisting of allele specific primers Fm and FW designed according to SNP sites and a downstream common primer Rwm thereof can respectively amplify a specific strip with the length of about 550bp in disease-resistant tobacco varieties containing mutant eIF4E-1 genes and K326, safflower macrogol, Yunyan 87, Zhenyan small tobacco and guicheng sun-cured tobacco and the like containing wild type eIF4E-1 genes (figure 7).

2.4F2 generation population PVY resistance identification

And in the seedling stage, performing PVY resistance identification on an F2 population of 500 single plants constructed by the black tobacco and K326 in the sun-opening period by adopting a virus sap friction inoculation method, investigating the disease resistance condition of the single plants after inoculating for 20 days, identifying that the susceptible single plant in the population is 371 plants and the disease-resistant single plant is 129 plants, and according with the separation ratio of 3:1, proving that the PVY resistance of the black tobacco in the sun-opening period is controlled by a recessive single gene (expressed by r genes).

2.5 identification of genotype of Individual F2 population strains by molecular markers

The results of PCR amplification of DNA from different individuals within the F2 generation population using the FW/Rwm and Fm/Rwm primer pairs are shown in FIG. 8, where the Fm/Rwm primer pair amplified the R genotype and the FW/Rwm primer pair amplified the R genotype. The disease-resistant material (homozygous mutant type) in the F2 population has only one genotype rr, and the amplification bands are Fm/Rwm with specific bands and FW/Rwm without bands. The susceptible material has 2 genotypes: RR (wild type), the amplification band condition is that FW/Rwm has a specific band, and Fm/Rwm has no band; rr (hybrid mutant), and the amplified bands are specific to FW/Rwm and Fm/Rwm.

2.6 application of molecular marker in tobacco PVY resistance backcross improvement

Backcross progeny (such as BC1F1, BC2F1 and BCnF1) seeds prepared by the parents for resisting and sensing PVY are grown by a conventional method, genome DNA is extracted by a CTAB method and the like when 4-5 leaves are planted, PCR amplification is carried out by a molecular marker ASM-W (FW/Rwm) and ASM-m (Fm/Rwm) primer pair, a PCR reaction system and a reaction program are as described above, and a PCR product is subjected to agarose gel electrophoresis, photographed and recorded (FIG. 9).

Then, whether the individual plant of the tobacco BCnF1 generation carries the PVY resistance gene (r gene) is judged according to the following standard: the Fm/Rwm primer pair has a specific amplification band of 543bp, and the single plant is preliminarily judged to carry the PVY resistance gene. The results showed that the BCnF1 generation individuals had 2 genotypes: RR, the amplification band condition is that FW/Rwm has a specific band, and Fm/Rwm has no band; rr, the amplification band condition is that FW/Rwm and Fm/Rwm have specific bands. The screened individual strain (the genotype is Rr) carrying the PVY resistance gene can be backcrossed with K326 continuously or used for the next breeding, which shows that the molecular marker can be used for the improvement of tobacco PVY resistance backcross. Compared with the conventional backcross improvement breeding (fig. 9, by taking the open-positive small black tobacco and the K326 as examples), the molecular marker assisted selective breeding (fig. 10, by taking the open-positive small black tobacco and the K326 as examples) can directly perform genotype identification on the BCnF1 single plant by using the molecular marker, select the single plant carrying the PVY resistance gene, do not need the first generation of selfing, shorten the improvement progress by one time, and omit the work of inoculation identification of the single plant PVY after selfing. The identification of resistance by molecular markers has the following advantages: the breeding process can be obviously shortened; the detection accuracy rate reaches 100%; the pollution of artificial inoculation diseases to other experimental materials is reduced; the requirement of artificial inoculation diseases on temperature conditions is reduced; the DNA of the same progeny individual plant can be used for detecting other molecular markers and can be used for molecular marker-assisted selection of other characters.

List of nucleotide series:

SEQUENCE LISTING

sequence listing

<110> Guizhou province tobacco science research institute

<120> tobacco eIF4E-1 mutation site specific codominant molecular marker and application thereof

<160> 7

<210> 1

<211> 543

<212> DNA

<213> tobacco

<400> 1

CACTTTTTCC ACTGTCGAAG ATTTTTGGGG GTAAGTTATT TCATATTCCC TCGGTTCCAA 60

TTTAGGTTAC AGTCTTTCCT TTTTAGTCAA CTTTTAGTCT CCTTAAATGA TATATTTCTA 120

TATTTAGTAA TAATTTAATA TTTATAGTGA CACAAATGTA TCACTCATTT TAGATGAATT 180

TTTTTTTTCT TAAACTCCGT ACCAAATCAA ACACTACTAA TGTAAATTGG GACGAAGCGA 240

GTATTATATT TCGTGTTAAG CTGTTGTGTT CTTTGGTTGT AAATAAATCA TGGGGTTTTA 300

TTTTACTGTT CAAGAATTTT GTGGGTGCTG TAGGATTTTG TTGAATTATG GTTTTGAATA 360

GCTCCTGAAT ATCTTGCCTT CATATAGGGA AAATTGGGTA AAATCTTCAA TTTTATGTGA 420

CACTAATTCT GTTAAAAAAA ACACCTTTAT ATATTTCGAA ATAATTTAAC TTTAAACTTC 480

TCATTGTACT GTTAATGTGA TGATTTGTAG TCACACAAAT GTCTATCTTG TTTTAAAAAT 540

TTT 543

<210> 2

<211> 543

<212> DNA

<213> tobacco

<400>2

ACTTTTTCCA CTGTCGAAGA TTTTTTGGGG GTAAGTTATT TCATATTCCC TCGGTTCCAA 60

TTTAGGTTAC AGTCTTTCCT TTTTAGTCAA CTTTTAGTCT CCTTAAATGA TATATTTCTA 120

TATTTAGTAA TAATTTAATA TTTATAGTGA CACAAATGTA TCACTCATTT TAGATGAATT 180

TTTTTTTTCT TAAACTCCGT ACCAAATCAA ACACTACTAA TGTAAATTGG GACGAAGCGA 240

GTATTATATT TCGTGTTAAG CTGTTGTGTT CTTTGGTTGT AAATAAATCA TGGGGTTTTA 300

TTTTACTGTT CAAGAATTTT GTGGGTGCTG TAGGATTTTG TTGAATTATG GTTTTGAATA 360

GCTCCTGAAT ATCTTGCCTT CATATAGGGA AAATTGGGTA AAATCTTCAA TTTTATGTGA 420

CACTAATTCT GTTAAAAAAA ACACCTTTAT ATATTTCGAA ATAATTTAAC TTTAAACTTC 480

TCATTGTACT GTTAATGTGA TGATTTGTAG TCACACAAAT GTCTATCTTG TTTTAAAAAT 540

TTT 543

<210>3

<211>27

<212> DNA

<213> Artificial sequence

<400>3

CACTTTTTCC ACTGTCGAAG ATTTATG 27

<210>4

<211>27

<212> DNA

<213> Artificial sequence

<400>4

ACTTTTTCCA CTGTCGAAGA TTTTATG 27

<210>5

<211>32

<212> DNA

<213> Artificial sequence

<400>5

AAAATTTTTA AAACAAGATA GACATTTGTG TG 32

<210>6

<211>35

<212> DNA

<213> Artificial sequence

<400>6

CTAAAATCTA TAACTAAGTA CATAGAAAAC ACACG 35

<210>7

<211>35

<212> DNA

<213> Artificial sequence

<400>7

GGTACTTAAA CTGTCAAGTG GCAGC 25

Claims (4)

1. A tobacco eIF4E-1 mutation site specific codominant molecular marker, which is characterized in that: the marker related to the detection of the wild type locus is named as ASM-W, the fragment size is 543bp, and the marker is shown as SEQ ID No. 1; the corresponding marker related to the detection of the base insertion mutation site is named as ASM-m, the fragment size is 543bp, and the marker is shown as SEQ ID No. 2.

2. A primer combination for identifying a mutation site specific co-dominant molecular marker of claim 1, wherein: the primer combination comprises the following two combinations:

a combination of a forward primer FW and a reverse primer Rwm for amplifying a molecular marker ASM-W;

a combination of a forward primer Fm and a reverse primer Rwm for amplifying a molecular marker ASM-m;

wherein the sequence of the forward primer FW is as follows:

5'-CACTTTTTCCACTGTCGAAGATTTATG-3'；

the sequence of the forward primer Fm is as follows:

5'-ACTTTTTCCACTGTCGAAGATTTTATG-3'；

the sequence of the reverse primer Rwm is as follows:

5'-AAAATTTTTAAAACAAGATAGACATTTGTGTG-3'。

3. use of the primer combination of claim 2 to identify the genotype of the tobacco eIF4E-1 locus.

4. Use according to claim 3, characterized in that: the specific application mode is as follows: performing PCR amplification on the genome DNA of an individual to be detected twice by using the combination of the primers FW and Rwm and the combination of the primers Fm and Rwm, detecting whether amplified fragments exist, and if the combination of the primers Fm and Rwm amplifies a 543bp specific amplified band, the combination of the primers FW and Rwm cannot amplify, determining the amplified fragments as homozygous mutant; if the 543bp specific amplification band is amplified by the combination of the primers FW and Rwm, and the wild type band is obtained if the 543bp specific amplification band is not amplified by the combination of the primers Fm and Rwm; if the combination of the primers FW and Rwm and the combination of the primers Fm and Rwm can amplify a 543bp specific amplification band, the mutant type is the heterozygous mutant type.

Images