CN103103187A - Specific molecular marker of Brassica rapa L.ssp pekinensis eIF (iso) 4E.a locus large fragment deletion mutation and application thereof - Google Patents
Specific molecular marker of Brassica rapa L.ssp pekinensis eIF (iso) 4E.a locus large fragment deletion mutation and application thereof Download PDFInfo
- Publication number
- CN103103187A CN103103187A CN2013100583015A CN201310058301A CN103103187A CN 103103187 A CN103103187 A CN 103103187A CN 2013100583015 A CN2013100583015 A CN 2013100583015A CN 201310058301 A CN201310058301 A CN 201310058301A CN 103103187 A CN103103187 A CN 103103187A
- Authority
- CN
- China
- Prior art keywords
- iso
- eif
- chinese cabbage
- marker
- mutant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a locus specific co-dominant ASM (allele specific marker) directly related to identification of Brassica rapa L.ssp pekinensis eIF (iso) 4E.a wild type and mutant. The marker related to wild type locus detection is named as ASM-iso4E.a, has fragment size of 1636bp, and is shown as a SEQ ID No.1. The corresponding mutation locus detection related marker is named as ASM-iso4e.a, has fragment size of 640bp, and is shown as a SEQ ID No.2. In the invention, by making use of a homology based cloning technology, a mutant of the eIF (iso) 4E.a locus is discovered, and the molecular marker for identifying the locus is developed. The marker can be utilized for accurate selection of the genotype of backcrossing transformation progenies. Meanwhile, the marker also can be used for screening Brassica rapa L.ssp pekinensis germplasm resources so as to seek mutant materials with more abundant genetic backgrounds.
Description
Technical field
The present invention relates to a kind of exploitation of mutant and related locus specific molecular marker thereof of gene, relate in particular to sudden change and locus specificity molecular markers development and the application of a kind of Chinese cabbage eukaryotic translation initiation factor 4E isomer eIF (iso) 4E.a.Mutant can provide for the antiviral Chinese cabbage germplasm that seed selection contains this mutational site the variation source, the site-specific molecule marker can directly apply to the Chinese cabbage material that molecular mark selects to contain this mutational site, improve the efficiency of selection of eIF (iso) 4E mutant, belong to biological technical field.
Background technology
Chinese cabbage (Brassica rapa L.ssp pekinensis) is the important vegetable crop of Cruciferae, originates in China, and plantation is all arranged all over the world at present.Especially become the important component part that vegetable products is supplied with in the year-round provisions of China vegetables and s are adjusted, thereby people's life has been had material impact.China Chinese cabbage produces Common Diseases virus disease, oidium and soft rot, and wherein the harm of virus disease is the most serious, and there is no blanket viral diseases medicament or other effective control techniques.Cultivate antiviral New Chinese Cabbage Variety and be the harm of reply virus disease first-selected approach [Wang Xue, Liu Yumei, Li Hanxia, make widely known brave, Fang Zhiyuan. Advance in Research on TuMV-resistance Breeding of Brassica Crops. gardening journal .2005,32 (5): 939-946].Vertical strong [the Miao Liqiang that waits of seedling, Zhang Yaowei, Cui Chongshi. China's progress of study on Chinese cabbage breeding for diseases resistance. the journal .2008 of Northeast Agricultural University, 37 (4): 529-533] research is found, in the pathogen separation thing of China's Chinese cabbage virus disease, 70% is Brassica 2 et 4 (Turnip Mosaic Virus, TuMV), also has a small amount of cucumber mosaic virus (Cucumber Mosaic Virus, CMV) and other virus.Therefore the main goal of attack of China's Chinese cabbage viral diseases breeding is anti-TuMV.
Two key elements cultivating anti-TuMV New Chinese Cabbage Variety are to have abundant anti-TuMV germ plasm resource and efficient breeding efficiency.China is the Chinese cabbage country of origin, and germ plasm resource is very abundant, wherein is no lack of the good resource of anti-TuMV, and how best in quality but not antiviral resource is also arranged simultaneously.In the conventional breeding practice, often the means by backcross transformation obtain the abundant resistant material of more genetic backgrounds.Along with the rise of molecular marking technique and going deep into of research, marker assisted selection has become in the conventional breeding operation and has improved efficiency of selection, the Main Means of shortening the breeding cycle.Some transnational breedings group spares no high price especially innovation resources and exploitation and the closely linked molecule marker of the Main Agronomic Characters main contents as breeding project.
Generally speaking, seek and the closely linked molecule marker of certain economical character, often need first to be chosen in the parent that there is significant difference in the objective trait aspect, and structure segregating population (F2, RI, BC1, DH etc.), adopt to mix hive off (BSA) and traditional molecule marker (as RAPD, SRAP, AFLP, SSR etc.) technology analyzes, linkage distance with corresponding software analysis gained mark and proterties finally obtains the molecule marker chain with objective trait.The molecule marker with Turnip mosaic virus resistance in Chinese cabbage (TuMV) linkage of characters of report adopts aforesaid method to obtain just at present.Because different investigator's material therefors are different with selected labeling pattern, the chain marking path of resulting and ntiviral characteristic is also different, between 3.8-15.36cM.Due to the linkage degree undertighten of these marks and proterties, thereby it still has certain distance for the anti-TuMV assistant breeding of Chinese cabbage.
On the other hand, because Arabidopis thaliana and Chinese cabbage belong to Cruciferae together, its antiviral correlation function gene has more deep research; The whole genome sequence of Chinese cabbage is announced (Wang et al., 2011, the genome of the mesopolyploid crop species Brassica rapa.Nature Genetics.43 (10): 1035-1039) simultaneously.So result and the Chinese cabbage genome sequence column information of Arabidopis thaliana functional gene research can be combined, directly start with from the angle of antiviral correlation function gene, by Chinese cabbage natural population is started with in the natural variation of some critical function gene locuss, seek the mutant of antiviral correlation function gene; For mutational site exploitation locus specificity molecule marker (Allele specific marker, ASM), this mark itself is directly related with proterties, and this can make marker assisted selection more accurate undoubtedly.
Find aspect the antiviral functions gene studies in recent years, how relevant with the sudden change of eukaryotic translation initiation factor 4E and isomer (iso4E) thereof by the antiviral proterties of recessive Dominant gene.[the Wittmann S such as Wittmann, Chatel H, Fortin MG, Laliberte JF.Interaction of the viral protein genome linked of Turnip mosaic virus with the translational eukaryotic initiation factor (iso) 4E of Arabidopsis thaliana using the yeast two-hybrid system.Virology.1997, 234:84-92] and [the L é onard S such as L é onard, Plante D, Wittmann S, Daigneault N, Fortin MG, Lalibert é JF.Complex formation between potyvirus VPg and translation eukaryotic initiation factor4E correlates with virus infectivity.J.Virol.2000, 74:7730-7737] prove respectively: Arabidopis thaliana eIF4E and eIF (iso) 4E can interact in conjunction with albumen (VPg) with the viral genome of TuMV.The required key amino acid site of this interactional key amino acid and eukaryote self mRNA translation is different, so some amino acid mutations of eIF4E and eIF (iso) 4E do not affect grow, but cause virus and the host of plant self, mutual work can not occur, thereby make the host show the characteristic of opposing virus infection.Ryder is at romaine lettuce [Ryder EJ.1970.Inheritance of resistance to common lettuce mosaic.Am Soc Horticult Sci.95:378 – 379], Ruffel is at capsicum [Ruffel S, Dussault MH, Palloix A, Moury B, Bendahmane A, Robaglia C, Caranta is natural recessive resistance gene against potato virus Y in peper corresponds to the eukaryotic initiation factor4E (eIF4E) .Plant Dec J.2002 C.2002.A, 32 (6): 1067-75], Nieto is at muskmelon [Nieto C, Piron F, Dalmais M, Marco CF, Moriones E, Gomez-Guillamon ML, Truniger V, Gomez P, Garcia-Mas J, Aranda MA, Bendahmane is for the identification of allelic variants of melon eIF4E A.2007.EcoTILLING, a factor that controls virus susceptibility.BMC Plant Biology.7, 34-42] etc. important vegetables had been found that on many such mutant resources, [the Yeam I such as Yeam, Kang BC, Lindeman W, Frantz JD, Faber N, and Jahn MM.2005.Allele-specific CAPS markers based on point mutations in resistance alleles at the pvr1 locus encoding eIF4E in Capsicum.Theor.Appl.Genet.NNO, 178-186] assisted Selection when having developed corresponding locus specificity CAPs mark and being used for antiviral material transformation for the mutational site in capsicum.
China's Chinese-cabbage Germplasm is very abundant, eIF4E and eIF (iso) 4E sudden change and the supposition of the effect antiviral thereof from other crops, also may have the mutant of eIF4E and eIF (iso) 4E in Chinese cabbage natural population, and this sudden change may be relevant with the ntiviral characteristic of Chinese cabbage.At present, both at home and abroad about the research of Chinese cabbage ntiviral characteristic and eIF4E and eIF (iso) 4E relation seldom, the material that relates to is very limited.[the Rusholme RL such as Rusholme, Higgins EE, Walsh JA, Lydiate DJ.Genetic control of broad-spectrum resistance to turnip mosaic virus in Brassica rapa (Chinese cabbage) .Journal of General Virology.2007,88:3177 – 3186] take the Chinese cabbage inbred lines RLR22 of high resistance TuMV and viral sensitive material R-O-18 as the parent, build BC1F1 colony, carry out anti-TuMV (CDN 1 and CZE1 strain) genetic research.Found that the antiviral recessive inheritance of a Chinese cabbage site retr01 and a dominant locus ConTR01, the association analysis of RFLP mark has been found respectively and the chain mark pN202e1 of retr01 and the mark pO85e1 chain with ConTR01.Further adopt the means of southern hybridization to find that the eIF4E (laying respectively at karyomit(e) N1, N3 and N8) of 3 copies and eIF (iso) 4E (laying respectively at karyomit(e) N4, N5 and N8) of 3 copies are arranged respectively in the A genome.The author infer that the eIF4E that is positioned on the 8th karyomit(e) may be relevant with ConTR01 with eIF (iso) 4E, and eIF (iso) 4E that is positioned on the 4th karyomit(e) may be relevant with retr01 according to results of hybridization.There is no the sequence information report about two genes in literary composition.[the Jenner CE such as Jenner, Nellist CF, Barker GC, Walsh JA.Turnip mosaic virus (TuMV) is able to use alleles of both eIF4E and eIF (iso) 4E from multiple loci of the diploid Brassica rapa.Mol Plant Microbe Interact.2010, 3 (11): 1498-1505] clone has obtained eIF4E and each three copies of eIF (iso) 4E from viral sensitive material R-O-18, difference called after BraA.eIF4E.a, BraA.eIF4E.b, BraA.eIF4E.c and BraA.eIF (iso) 4E.a, BraA.eIF (iso) 4E.b, BraA.eIF (iso) 4E.c.except BraA.eIF4E.b and BraA.eIF (iso) 4E.b, all the other 4 genes are arabidopsis thaliana transformation At.eIF (iso) 4E afunction mutant [Duprat A respectively, Caranta C, Revers F, Menand B, Browning KS, Robaglia is Arabidopsis eukaryotic initiation factor (iso) 4E is dispensable for plant growth but required for susceptibility to potyviruses.The Plant Journal C.2002.The, 32:927 – 934], then to all transgenic line inoculation TuMV Canada strain CDN1, carry out viral susceptibility complementation test.According to disease index and ELISA result, find that four genes that turn all can make mutant recover wholly or in part the susceptibility that TuMV is infected.This shows, when TuMV infected Chinese cabbage group, eIF4E and eIF (iso) 4E may participate in virus and host's interaction.The author points out simultaneously, wants the acquisition antiviral material relevant with eIF (iso) 4E with eIF4E in Chinese cabbage, and these genes need loss of function simultaneously.Up to now, Chinese cabbage has no report both at home and abroad in the sudden change of above-mentioned two gene locuss and the marker development of related mutants detection.
Given this, be necessary to the Chinese cabbage of China's abundant anti-/ sense TuMV material in the polymorphism in eIF4E and eIF (iso) 4E each site carry out extensive examination, with the mutation type of finding that each site may exist; For the sequence difference of mutational site and wild-type, exploitation detects relevant locus specificity molecule marker with mutant simultaneously.The potential benefit that the following aspects is arranged: 1. this mark can be used for examination Chinese cabbage population, efficient Chinese cabbage mutant detection means is provided; 2. when mutation type is found in other sites, can adopt the exploitation mark that uses the same method; 3. when the sudden change in a plurality of sites is arranged in different materials, can multisite mutation be condensed together by the marker assisted selection means, create the anti-TuMV Chinese cabbage of wide spectrum new germ plasm; 4. when cultivating the anti-TuMV New Chinese Cabbage Variety of wide spectrum, can realize marker assisted selection, improve breeding efficiency.Because this mark is located immediately at functional gene inside, the rate of accuracy reached 100% of therefore selecting.
Summary of the invention
For above-mentioned prior art, for present Chinese cabbage in the blank aspect eIF4E and the evaluation of eIF (iso) 4E gene point mutation body, at first the present invention has obtained the mutant in an eIF (iso) 4E.a site, next is according to the sequence characteristic in mutational site, the design primer has been developed the ASM codominant marker who identifies wild-type and mutant and has been used for marker assisted selection.
The present invention is achieved by the following technical solutions:
A kind of and Chinese cabbage eIF (iso) 4E.a wild-type and mutant are identified directly related locus specificity codominance ASM mark: detect relevant mark called after ASM-iso4E.a with the wild-type site, clip size 1636bp is as shown in SEQ ID No.1; Relevant mark called after ASM-iso4e.a is detected in corresponding mutational site, and clip size 640bp is shown in SEQ ID No.2.
A kind of primer be used to differentiating above-mentioned locus specificity codominant marker is:
Forward primer Fd:5 '-GACAATTTCGCATCTGGTAATGACATGTTTT-3 ';
Reverse primer Rd:5 '-GGTTTGTTCCACTTTATCTAAATGAAG-3 ' is as shown in SEQ ID NO.3,4.
The present invention adopts Homology-based cloning to be cloned into respectively eIF (iso) 4E.a gene complete sequence from 4 parts of Chinese cabbage inbred lines material He102 and 06-247, eIF (iso) 4E.a of the B.rapa self-mating system R-O-18 that reported in 2 sequences and GenBank is found more afterwards, the eIF of 06-247 (iso) 4E.a only has the small segment disappearance at the intron place, the ORF forecast analysis has obtained the encoder block fully known with R-O-18, and we are called wild-type; The eIF of He102 (iso) 4E.a makes this gene the 4th, the 5th whole disappearance of exon from the have an appointment large fragment deletion of 1kb of the 3rd intron partial sequence backward, causes this gene to become a pseudogene, and we are called mutant.for the ease of distinguish wild-type and mutant on sepharose, for later molecular marker assisted selection facilitates, we have designed primer at the gene conservative region, carried out pcr amplification in two materials, result is as expection, obtained the large fragment of 1636bp in wild-type, obtain the small segment of 640bp and only increase in mutant, in order to verify the operability of this mark, we with the design primer amplification (the F1BC1 colony of He102 * 06-247) * He102, result shows that this mark is to homozygous wildtype, the rate of accuracy reached 100% of the discriminating of mutant and heterozygous.
The screening process of described ASM mark is as follows:
(1) take Chinese cabbage anti-TuMV self-mating system He102 and 06-247 as material, adopt the CTAB method, extract both genomic dnas.
(2) according to eIF (iso) the 4E.a sequence of the B.rapa self-mating system R-O-18 that has reported in GenBank, design primer in the coding region upstream and downstream.Adopt Homology-based cloning, the clone has obtained its eIF (iso) 4E.a and has checked order from susceptible material, has obtained its eIF (iso) 4E.a genom sequence.
(3) both eIF (iso) 4E.a and eIF (iso) the 4E.a sequence of R-O-18 are compared, found outside many places SNPs and small segment insertion/deletion, found simultaneously the approximately large fragment deletion of 1kb in the eIF of He102 (iso) 4E.a sequence.Find when further utilizing NCBI splign tool analysis exon, the eIF of 06-247 (iso) 4E.a genome sequence comprises complete coding region, the coded product amino-acid sequence is fully consistent with the coded product of R-O-18, and the eIF of He102 (iso) 4E.a has lacked fourth, fifth two exons.Given this, we will be called wild-type from eIF (iso) 4E.a of 06-247, and eIF (iso) 4E.a of He102 is called mutant, represent with lowercase, i.e. eIF (iso) 4e.a.Sequence according to gained, at large fragment deletion position upstream and downstream conserved regions design primers F d and Rd, wild-type and mutant gene group DNA are carried out pcr amplification, result is as expection, obtained larger fragment in wild-type, mutant is due to the disappearance of the 1kb that has an appointment, obtained less fragment, this is the codominant marker.
Described mark can be used as molecule marker and is applied to Chinese-cabbage Germplasm evaluation and breeding assist-breeding, selects to contain germplasm materials or the transformation offspring of eIF in He102 (iso) 4e.a mutation type.Concrete application mode is: utilizing the genomic dna of two primer pair individualities to be measured of ASM mark to carry out pcr amplification one time, detect the size of amplified fragments, if amplified production is 1636bp, is wild-type; Being 640bp as amplified production, is mutant; If amplify above-mentioned two bands, it is heterozygous.
The invention has the beneficial effects as follows: due to the control that is subjected to a plurality of genes on Chinese cabbage eIF (iso) 4E site, the frequency of polygene simultaneous mutation is lower in a material.If can identify respectively mutant separately in each site, exploitation can be passed through convergent cross and binding molecule marker assisted selection for the locus specificity molecule marker that each mutant detects, and a plurality of mutational sites are aggregated in in a material.The present invention utilizes Homology-based cloning to find a mutant in eIF (iso) 4E.a site and developed the molecule marker of identifying this site.Utilize this mark accurately to select backcross transformation offspring's genotype.This mark also can be used for Chinese-cabbage Germplasm is carried out examination simultaneously, to seek the more abundant mutant material of genetic background.Its advantage is specific as follows:
1. the mark directly related with eIF (iso) 4E.a site mutation that obtain of the present invention, result is stable, accurate, easy and simple to handle.Being applicable to the screening of different genetic background Chinese cabbage materials, is a ubiquity mark.It can the precise Identification Chinese-cabbage Germplasm in the genotype in this site, greatly improved the screening efficiency of Chinese-cabbage Germplasm at eIF (iso) 4E.a site mutation body.
2. aspect Chinese cabbage eIF (iso) 4E gene order and mutant research, only Jenner etc. (2010) has reported the sequence of the self-mating system R-O-18 of B.rapa, and other mutant has no report.For the specific mark in this mutational site, can identify for germ plasm resource, provide the assisted Selection instrument by the means such as backcross transformation screenings and the mutant material of cultivating different genetic backgrounds.Application of the present invention can greatly be simplified the screening means, shorten the transformation time limit, has avoided the blindness of selecting in the conventional breeding method.
Description of drawings
Fig. 1: the amplification of genome specific primer in He102 and 06-247, M are DNA molecular amount standard DL2000.
Fig. 2: eIF (iso) the 4E.a genome sequence comparison of the R-O-18 that retrieves from He102 and 06-247 and GenBank.
Fig. 3: the amplification of the described primer of the exploitation of ASM mark and mark in He102 and 06-247.
Fig. 4: the ASM of exploitation is marked at that (in He102 * 06-247) * He102 backcross population, to the qualification result of part individual plant, according to the amplified fragments judgement, in A, 1-4 is heterozygous, and 5-10 is mutant, and in B, 11-21 is wild-type.
Embodiment
The present invention is further illustrated below in conjunction with embodiment.Experimental technique in embodiment if no special instructions, is ordinary method.
The clone of eIF4E.a in embodiment 1, different Chinese cabbage inbred lines material
1.1 Chinese cabbage extracting genome DNA
(1) the Seedling of Chinese Cabbage blade is put into the mortar of Liquid nitrogen precooler, abundant grind into powder in liquid nitrogen;
(2) treat that the liquid nitrogen volatilization is dried, transfer to immediately in the centrifuge tube of 2ml, every 100mg material approximately adds 0.6ml to be preheated to the CTAB extracting solution of 65 ℃, after thawing, and thermal agitation mixing sample, 65 ℃ of water-baths are placed and were made lysis in 40-60 minute;
(3) after cracking finishes, take out sample and make it be cooled to room temperature fully.Add isopyknic chloroform (chloroform), put upside down gently and make mixing, room temperature was placed 10 minutes;
(4) room temperature, centrifugal 15 minutes of 12000rpm;
(5) with the careful sucking-off of pipettor upper strata water, add in the centrifuge tube of new 1.5ml, add the Virahol (1:1 volume) of 500 μ l, abundant mixing, precipitation at room temperature 10min;
(6) 4 ℃, the centrifugal 10min of 12000rpm, careful abandoning supernatant;
(7) DNA precipitation 75% washing with alcohol of 1ml.4 ℃, the centrifugal 10min collecting precipitation of 8000rpm;
(8) repeat with DNA precipitation of 75% washing with alcohol;
(9) remove supernatant, DNA is deposited in and dries approximately 10-15 minute on aseptic operating platform, and it is transparent that DNA shows slightly, and adds the Tris.HCl of the 10mM of proper volume (30-50 μ l), and pH8.0 makes resolution of precipitate (can be placed on 4 ℃ of refrigerator dissolvings spends the night);
(10) ultraviolet spectrophotometer and 1%Agrose detected through gel electrophoresis DNA concentration and quality.
1.2 clone and the sequential analysis of eIF (iso) 4E.a
(1) eIF (iso) the 4E.a gene complete sequence (GenBank:HM131209.1) of retrieval B.rapa self-mating system R-O-18, design respectively forward and reverse primer at upstream of coding region and downstream,
Forward primer: 5 ' GAGTGCGATGGCGACAGAGGAT3 '
Reverse primer: 5 ' GGTTTGTTCCACTTTATCTAAATGAAG3 ' entrusts Jinan Bo Shang Bioisystech Co., Ltd synthetic.
Primer sequence is as shown in SEQ ID NO.5,4.
(2) pcr amplification: in 20 μ l reaction systems, comprise 1 * TransStart FastPfu buffer; The genomic dna of 20ng; 0.4 the forward and reverse primer of μ M; 0.25mM dNTPmix; The TransStart FastPfu archaeal dna polymerase (TransGen AP221) of 1 unit.PCR cycling condition: 95 ℃ of denaturations 5 minutes; Be then 95 ℃ of sex change 30 seconds, annealed 30 seconds for 57.5 ℃, 72 ℃ were extended 1 minute, 35-38 circulation, and last 72 ℃ were extended 10 minutes.
(3) electrophoresis detection of PCR product:
PCR gets 10 μ lPCR amplified productions and adds 1 μ l 10 * loading buffer after finishing, and carries out electrophoresis on 1% sepharose, EB dyeing after electrophoresis finishes, and gel imaging system is observed and is taken pictures automatically.The results are shown in Figure 1.
(4) cloning and sequencing of PCR product
After electrophoresis confirms that the purpose band is amplified, get 1 μ l pcr amplification product and add 1 μ l pEasy-Blunt (TransGen CB101) carrier room temperature connection 10 minutes, transform competent escherichia coli cell Trans1-T1 (TransGen:CD501), transformed bacteria was cultivated about 16 hours in 37 ℃ of inversions on the LB solid plate that contains Kan 50 μ g/ml.After bacterium colony PCR detects, the picking positive colony entrusts Beijing China large gene company limited to carry out the mensuration of DNA sequence dna.
Chinese cabbage eIF (iso) 4E.a sequential analysis and the name of (5) cloning
To be BraeIF (iso) 4E.a from the unnamed gene of TuMV sensitive material 06-247, its sequence be as shown in SEQ ID NO.6; To be BraeIF (iso) 4e.a from the unnamed gene of anti-TuMV material He102, its sequence be as shown in SEQ ID NO.7.In they and GenBank, the homologous gene sequence of R-O-18 relatively reaches the significant difference part as shown in Figure 2.
The exploitation of embodiment 2 codominance ASM marks
2.1 design of primers
Carefully compare the genome sequence of BraeIF (iso) 4E.a (wild-type) and BraeIF (iso) 4e.a (mutant), its difference is mainly the latter's 3 ' end disappearance, for such difference, at disappearance regional upstream conservative region design forward primer (as shown in SEQ ID NO.3), the primer when reverse primer Rd just increases with genome sequence (as shown in SEQ ID NO.4).Primer entrusts Jinan Bo Shang Bioisystech Co., Ltd synthetic.
2.2 the acquisition of ASM mark:
(1) utilize the amplification of forward and reverse combination of primers in He102 and 06-247: the preparation of PCR reaction solution and amplification condition are as described in 1.2 (2) bars.
(2) detection of amplification is as described in 1.2 (3) bars.
(3) amplification as shown in Figure 3, two primers can amplify the band of 1636bp in wild-type 06-247, its sequence expands the band that 640bp in mutant He102 as shown in SEQ ID NO.1, its sequence is as shown in SEQ ID NO.2.This is codominance ASM mark.
(identify by the individual plant in He102 * 06-247) * He102 to backcross population for embodiment 3 ASM marks
(1) extracting genome DNA of the different individual plants of backcross population is as described in 1.1.
(2) pcr amplification: the preparation of PCR reaction solution and amplification condition are as described in 1.2 (2) bars.
(3) detection of PCR product is as described in 1.2 (3) bars.Detected result as shown in Figure 4,1-21 is 21 parts of Chinese cabbage materials, M is DNA molecular amount standard DL2000.As can be seen from the figure, in Fig. 4 A, 1-4 is heterozygous, and 5-10 is mutant, and in Fig. 4 B, 11-21 is wild-type.
Claims (6)
1. the specific molecular marker of a Chinese cabbage eIF (iso) 4E.a site large fragment deletion sudden change is characterized in that: detect relevant mark called after ASM-iso4E.a to the wild-type site, clip size 1636bp is as shown in SEQ ID No.1; Relevant mark called after ASM-iso4e.a is detected in corresponding mutational site, and clip size 640bp is shown in SEQ ID No.2.
2. the primer of the specific molecular marker of Chinese cabbage eIF claimed in claim 1 (iso) 4E.a site large fragment deletion sudden change, it is characterized in that: primer sequence is as follows:
Forward primer Fd:5 '-GACAATTTCGCATCTGGTAATGACATGTTTT-3 ';
Reverse primer Rd:5 '-GGTTTGTTCCACTTTATCTAAATGAAG-3 ';
As shown in SEQ ID NO.3,4.
3. the application of specific molecular marker in the genotype of differentiating Chinese cabbage eIF (iso) 4E.a gene locus of Chinese cabbage eIF claimed in claim 1 (iso) 4E.a site large fragment deletion sudden change.
4. the application of primer claimed in claim 2 in the genotype of differentiating Chinese cabbage eIF (iso) 4E.a gene locus.
5. according to claim 3 or 4 described application is characterized in that: concrete application mode is: utilizing the genomic dna of two primer pair individualities to be measured to carry out pcr amplification one time, detect the size of amplified fragments, if amplified production is 1636bp, is wild-type; Being 640bp as amplified production, is mutant; If amplify above-mentioned two bands, it is heterozygous.
6. application according to claim 5 is characterized in that: described pcr amplification is specially: in 20 μ l reaction systems, comprise 1 * TransStart FastPfu buffer; The genomic dna of 20ng; 0.4 the forward and reverse primer of μ M; 0.25mM dNTPmix; The TransStart FastPfu archaeal dna polymerase (TransGen AP221) of 1 unit;
PCR cycling condition: 95 ℃ of denaturations 5 minutes; Be then 95 ℃ of sex change 30 seconds, annealed 30 seconds for 57.5 ℃, 72 ℃ were extended 1 minute, 35-38 circulation, and last 72 ℃ were extended 10 minutes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2013100583015A CN103103187A (en) | 2013-02-22 | 2013-02-22 | Specific molecular marker of Brassica rapa L.ssp pekinensis eIF (iso) 4E.a locus large fragment deletion mutation and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2013100583015A CN103103187A (en) | 2013-02-22 | 2013-02-22 | Specific molecular marker of Brassica rapa L.ssp pekinensis eIF (iso) 4E.a locus large fragment deletion mutation and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103103187A true CN103103187A (en) | 2013-05-15 |
Family
ID=48311384
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2013100583015A Pending CN103103187A (en) | 2013-02-22 | 2013-02-22 | Specific molecular marker of Brassica rapa L.ssp pekinensis eIF (iso) 4E.a locus large fragment deletion mutation and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103103187A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103290126A (en) * | 2013-05-29 | 2013-09-11 | 山东省农业科学院蔬菜研究所 | Molecular marker for distinguishing cabbage eIF (iso) 4G gene wild type and mutant and application thereof |
| CN113862392A (en) * | 2021-11-15 | 2021-12-31 | 西北农林科技大学 | SSR molecular marker primer linked with Chinese cabbage yellow cotyledon gene Bryc and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102703445A (en) * | 2012-05-31 | 2012-10-03 | 山东省农业科学院蔬菜研究所 | Specific molecular markers of eIF4E.a mutation site of Chinese cabbage and application of Specific molecular markers |
| CN102925437A (en) * | 2012-11-13 | 2013-02-13 | 山东省农业科学院蔬菜研究所 | Specific molecular marker of deletion mutation of base at site of eIF(iso) 4E.c of Chinese cabbage and application thereof |
-
2013
- 2013-02-22 CN CN2013100583015A patent/CN103103187A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102703445A (en) * | 2012-05-31 | 2012-10-03 | 山东省农业科学院蔬菜研究所 | Specific molecular markers of eIF4E.a mutation site of Chinese cabbage and application of Specific molecular markers |
| CN102925437A (en) * | 2012-11-13 | 2013-02-13 | 山东省农业科学院蔬菜研究所 | Specific molecular marker of deletion mutation of base at site of eIF(iso) 4E.c of Chinese cabbage and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| 刘栓桃: "大白菜eIF4E基因家族cDNA克隆及序列分析", 《中国园艺学会十字花科分会第十届学术研讨会论文集》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103290126A (en) * | 2013-05-29 | 2013-09-11 | 山东省农业科学院蔬菜研究所 | Molecular marker for distinguishing cabbage eIF (iso) 4G gene wild type and mutant and application thereof |
| CN103290126B (en) * | 2013-05-29 | 2014-12-24 | 山东省农业科学院蔬菜研究所 | Molecular marker for distinguishing cabbage eIF (iso) 4G gene wild type and mutant and application thereof |
| CN113862392A (en) * | 2021-11-15 | 2021-12-31 | 西北农林科技大学 | SSR molecular marker primer linked with Chinese cabbage yellow cotyledon gene Bryc and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101801175B (en) | Methods to identify soybean aphid resistant quantitative trait loci in soybean and compositions thereof | |
| US10577623B2 (en) | Quantitative trait loci (QTL) associated with shatter resistant capsules in sesame and uses thereof | |
| CN102703445B (en) | Specific molecular markers of eIF4E.a mutation site of Chinese cabbage and application of Specific molecular markers | |
| Smith et al. | The development of a STS marker linked to a yellow rust resistance derived from the wheat cultivar Moro | |
| US11445692B2 (en) | Quantitative trait loci (QTL) associated with shatter resistant capsules in sesame and uses thereof | |
| EP1765056A1 (en) | Markers for salinity tolerance in wheat plants and the use thereof in breeding programs | |
| EP2164970A2 (en) | F. oxysporum f.sp. melonis race 1,2-resistant melons | |
| JP5908834B2 (en) | Pathogen resistant plant | |
| AU2016270918A1 (en) | Genetic locus associated with phytophthora root and stem rot in soybean | |
| AU2011349148C1 (en) | QTLs associated with and methods for identifying whole plant field resistance to Sclerotinia | |
| CA2867535A1 (en) | Molecular markers for low palmitic acid content in sunflower (helianthus annus), and methods of using the same | |
| CN102925437B (en) | Specific molecular marker of deletion mutation of base at site of eIF(iso) 4E.c of Chinese cabbage and application thereof | |
| CN103103187A (en) | Specific molecular marker of Brassica rapa L.ssp pekinensis eIF (iso) 4E.a locus large fragment deletion mutation and application thereof | |
| Lee et al. | Development of a single-nucleotide polymorphism marker for the Sw-5b gene conferring disease resistance to Tomato spotted wilt virus in tomato | |
| US9840744B2 (en) | Markers linked to reniform nematode resistance | |
| Gao et al. | Marker-assisted selection of Fusarium wilt-resistant and gynoecious melon (Cucumis melo L.) | |
| CN105695589B (en) | Detect wheat whether reagent set and molecular labeling containing haynaldia villosa 6V#4S chromosome arm | |
| CN102994497B (en) | Chinese cabbage eIF (iso) 4E.c site transposon degenerated hull | |
| Petrash et al. | Effect of translocations from Aegilops speltoides Tausch on resistance to fungal diseases and productivity in common wheat | |
| CN103290126B (en) | Molecular marker for distinguishing cabbage eIF (iso) 4G gene wild type and mutant and application thereof | |
| JP4366494B2 (en) | Microsatellite marker for detection of resistance genes against clubroot clubroot and its utilization | |
| CN103103188A (en) | Molecular markers for distinguishing two new haplotypes of Brassica rapaL. ssp pekinensis eIF4E.c and application thereof | |
| CN114763579B (en) | Molecular marker related to melon fruit shape, and method and application thereof | |
| Nakitandwe et al. | Genetic mapping of Solanum caripense, a wild relative of pepino dulce, tomato and potato, and a genetic resource for resistance to potato late blight | |
| AU2014386227B2 (en) | Markers linked to reniform nematode resistance |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20130515 |