CN102912030A - Primer pairs, probes and kit for early diagnosis of prostatic cancer (PC) - Google Patents
Primer pairs, probes and kit for early diagnosis of prostatic cancer (PC) Download PDFInfo
- Publication number
- CN102912030A CN102912030A CN2012104425016A CN201210442501A CN102912030A CN 102912030 A CN102912030 A CN 102912030A CN 2012104425016 A CN2012104425016 A CN 2012104425016A CN 201210442501 A CN201210442501 A CN 201210442501A CN 102912030 A CN102912030 A CN 102912030A
- Authority
- CN
- China
- Prior art keywords
- seq
- container
- nucleotide sequence
- early diagnosis
- sequence shown
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the immunology field and relates to three groups of primer pairs and probes and a kit for early diagnosis of the PC. The three groups of the primer pairs are provided with nucleotide sequences shown by SEQ ID NO: 1and SEQ ID NO: 4, SEQ ID NO: 2 and SEQ ID NO: 5 and SEQ ID NO: 3 and SEQ ID NO: 6 respectively. Three DNA probes are marked with biotin at 3' ends and are provided with nucleotide sequences shown by SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9, and luminophore is connected on amino acid radicals at * positions in the sequences. The kit for early diagnosis of the PC is provided with the three groups of the primer pairs, reverse transcriptase and RNA polymerase and streptavidin coated on the RNA polymerase, and solid phase carriers of the DNA probes are connected onto the streptavidin. According to primer pairs, probes and the kit for early diagnosis of the PC, expression levels of human body TMP RSS2: ERG, PCA3 and PSA genes to judge risks of the PC through transcription-mediated amplification techniques.
Description
Technical field
The invention belongs to field of immunology, relate to a kind of primer pair for prostatic cancer early diagnosis, probe and test kit.
Background technology
Prostate cancer is male sex's common disease and frequently-occurring disease.Prostatic cancer early diagnosis method commonly used has at present: rectal touch, ultrasonic guidance aspiration biopsy of prostatic gland and imaging diagnosis etc., all there is certain limitation in these methods, rectal touch is a kind of non-specific inspection method, can only be as a kind of screening method of prostate cancer; Part aspiration biopsy poor accuracy points out tumour negative and be diagnosed as the patient of prostate gland benign lesion such as tissue with hematoxylin-eosin staining method detected result, and reality but suffers from prostate cancer; There is defective equally in imaging diagnosis, is difficult to popularization and application such as the coherence check technical fee costliness of nuclear magnetic resonance, CT outstanding especially advantage etc. in the early diagnosis of prostate cancer.
The gene expression dose of Biological indicators has now become the new direction of medical diagnosis on disease.The most frequently used prostate cancer tumor markers is serum prostate specific antigen (PSA) clinically, although the detection of blood-serum P SA can be found early stage prostate cancer, but the method specificity that detects blood-serum P SA is not high, particularly the PSA value is in the patient that 4 ~ 10ng/mL detects gray area, and positive rates of biopsy only has 20.4%.
At present, prostate cancer antigen 3 genes (PCA3) are considered to the most special gene of prostate cancer, and it is low in normal prostate tissue expresses, and expression amount significantly increases in tumor of prostate, does not all express in other healthy tissuess, tumor tissues.Also have in addition the fusion gene (TMPRSS2:ERG) of transmembrane serine protease 2 genes and protoerythrocyte specificity transforming gene genes involved also very high to the specificity of diagnosing prostate cancer, just sensitivity is on the low side.Current, just turn to detection to gene expression doses such as the higher PCA3 of specificity, TMPRSS2:ERG by the detection to the not high PSA gene expression dose of specificity for the detection of the gene expression dose of prostate cancer Biological indicators.But the most frequently used real-time polymerase chain reaction technology that is still (RT-PCR), although the detection sensitivity of RT-PCR is high, equipment and diagnostic reagent are required relatively harshness, reagent cost is higher, and the personnel that need to have professional skill go to operate and the deciphering result, and popularization is poor.And general only with the expression level of single Biological indicators as the prostate cancer diagnosis foundation.This single index diagnosis exists easily fails to pinpoint a disease in diagnosis or erroneous judgement and the not high problem of accuracy.
Summary of the invention
First purpose of the present invention provides a kind of three groups of primer pairs for prostatic cancer early diagnosis, and these three groups of primer pairs be used for to adopt fusion (TMPRSS2:ERG), the prostate cancer antigen 3(PCA3 of transcriptive intermediate amplification technique human body transmembrane serine protease 2 genes and protoerythrocyte specificity transforming gene genes involved), the expression level of serum prostate specific antigen (PSA) gene.This three Biological indicators associating can improve the accuracy rate of prostatic cancer early diagnosis, can overcome that failing to pinpoint a disease in diagnosis easily appears in the gene expression dose that only detects single Biological indicators or erroneous judgement and the low problem of accuracy rate.
The present invention solves the technical scheme that above technical problem takes: described three groups of primer pairs for prostatic cancer early diagnosis, and its first group of primer pair has the nucleotide sequence shown in SEQ IDNO:1 and the SEQ ID NO:4; Second group of primer pair has the nucleotide sequence shown in SEQ IDNO:2 and the SEQ ID NO:5; The 3rd group of primer pair has the nucleotide sequence shown in SEQ IDNO:3 and the SEQ ID NO:6, described three groups of primer pairs come the expression level of TMPRSS2:ERG, PCA3 in the human body body, PSA gene by the transcriptive intermediate amplification technique, with the risk of judging that prostate cancer occurs.
Second purpose of the present invention provides three dna probes for prostatic cancer early diagnosis; be used for adopting the expression level of immobilization hybridization protection method detection by quantitative TMPRSS2:ERG, PCA3 or PSA gene, with the accuracy of Biological indicators expression level detection in the raising prostatic cancer early diagnosis and the accessibility of operation.
Solving the technical scheme that above technical problem takes is: three dna probes of described prostatic cancer early diagnosis, all be marked with vitamin H at 3 ' end, and has respectively the nucleotide sequence shown in SEQ IDNO:7, SEQ ID NO:8, the SEQ ID NO:9, and the * position is connected to amino acid radical in the nucleotide sequence shown in this SEQ IDNO:7, SEQ ID NO:8, the SEQ ID NO:9, and is connected to luminophore on this amino acid radical.
Above-mentioned luminophore is acridinium ester.
The 3rd purpose of the present invention provides the preparation method of above-mentioned dna probe for prostatic cancer early diagnosis.
Solving the technical scheme that above technical problem takes is: 3 ' end be marked with vitamin H and have SEQ IDNO:7, SEQ ID NO:8 or SEQ ID NO:9 shown in the dna probe of nucleotide sequence in the amino acid radical of * position connect luminophore---acridinium ester, concrete steps are as follows:
The first step is dissolved in dimethyl sulfoxide (DMSO) with acridinium ester;
Second step, in the presence of water, the acridinium ester that is dissolved with dimethyl sulfoxide (DMSO) be marked with vitamin H with dry above-mentioned 3 ' end and have SEQ IDNO:7, SEQ ID NO:8 or SEQ ID NO:9 shown in the dna probe of nucleotide sequence under 20 ~ 45 ° of C, pH6 ~ 9 conditions, react 20 ~ 60 min, use again the Methionin stopped reaction.
The 3rd step added sodium-acetate and glycogen, added dehydrated alcohol behind the mixing, and at 0 ° of 5 min ~ 10 h of reaction below the C, the centrifugal supernatant of removing keeps throw out.
The 4th the step, throw out with water dissolution after, use the RPLC purifying.
The 4th purpose of the present invention provides a kind of prostatic cancer early diagnosis kit, and this test kit enough transcriptive intermediate amplification technique of energy and immobilization hybridization protection method be the interior TMPRSS2:ERG of detection by quantitative body and PCA3 gene expression dose rapidly.Because TMPRSS2:ERG and PCA3 gene all are the high genes of prostatic cancer specific; therefore utilize this pair index to unite the diagnosis early prostate cancer and can improve the early stage accuracy rate of diagnosis of prostate cancer; and utilize transcriptive intermediate amplification technique and immobilization hybridization protection method to detect the expression level of TMPRSS2:ERG and PCA3 gene; need to be take the expression level of PSA gene as benchmark value, so also comprise the diagnostic reagent of PSA gene expression dose in the human body body in this test kit.
Solving the technical scheme that above technical problem takes is: described prostatic cancer early diagnosis kit contains,
Container a1 is equipped with the promoter primer for detection of the TMPRSS2:ERG gene expression dose among the container a1, this promoter primer has the nucleotide sequence shown in the SEQ IDNO:1;
Container a2 is equipped with the reverse primer for detection of the TMPRSS2:ERG gene expression dose among the container a2, this reverse primer has the nucleotide sequence shown in the SEQ ID NO:4;
Container b1 is equipped with the promoter primer for detection of the PCA3 gene expression dose among the container b1, this promoter primer has the nucleotide sequence shown in the SEQ ID NO:2;
Container b2 is equipped with the reverse primer for detection of the PCA3 gene expression dose among the container b2, this reverse primer has the nucleotide sequence shown in the SEQ ID NO:5;
Container c1 is equipped with the promoter primer for detection of the PSA gene expression dose among the container c1, this promoter primer has the nucleotide sequence shown in the SEQ ID NO:3;
Container c2 is equipped with the reverse primer for detection of the PSA gene expression dose among the container c2, this reverse primer has the nucleotide sequence shown in the SEQ ID NO:6;
Container d is equipped with the mixed solution of reversed transcriptive enzyme and RNA polymerase among the container d; And
Solid phase carrier scribbles streptavidin on this solid phase carrier, is connected to the above-mentioned dna probe that is marked with acridinium ester and vitamin H on this streptavidin.
The above-mentioned solid phase carrier can be 96 orifice plates.
Also comprise container e in the mentioned reagent box, the standard substance that the mRNA transcript by TMPRSS2:ERG, the PCA3 of known copy number or PSA forms are housed among the container e.
Also comprise container f in the mentioned reagent box, the contrast product that the mRNA transcript by TMPRSS2:ERG, the PCA3 of known copy number or PSA forms are housed among the container f.
Also comprise container g in the mentioned reagent box, the mRNA extracting solution is housed among the container g.
Also comprise container h in the mentioned reagent box, among the container h hybridization solution is housed.
Also comprise container i in the mentioned reagent box, selection liquid is housed among the container i.
Also comprise container j in the mentioned reagent box, among the container j nitrite ion is housed.
This prostatic cancer early diagnosis kit, utilization be transcriptive intermediate amplification technique and immobilization hybridization protection method.Compare RT-PCR, the transcriptive intermediate amplification technique can in vitro carry out the high mRNA that copies ground amplification TMPRSS2:ERG, PCA3 and PSA with one at low temperatures.The mRNA of the TMPRSS2:ERG that amplifies, PCA3 and PSA can again as the self form of next round amplification, can increase 10 with the mRNA of TMPRSS2:ERG, PCA3 and PSA like this in 15 ~ 30 min
10Doubly, thus the sensitivity that is conducive to improve TMPRSS2:ERG and PCA3 gene expression dose.MRNA after the transcriptive intermediate amplification is by hybridizing on the dna probe that is marked with acridinium ester and vitamin H, and is follow-up so just very convenient.When the TMPRSS2:ERG in the dna probe that is marked with acridinium ester and vitamin H and the patient body, PCA3 or PSA gene in conjunction with after forming two strands, the acridinium ester luminophore is protected; And the strand of not hybridizing remembers that the acridinium ester luminophore on the dna probe that acridinium ester and vitamin H are arranged is hydrolyzed, can't be luminous again.And the optical signal of double-stranded upper acridinium ester luminophore can be detected by the ordinary light detector, detection by the luminous signal power, with the PSA gene expression dose as benchmark value, can make things convenient for, sensitive, detect TMPRSS2:ERG in the patient body and the gene expression dose of PCA3 at low cost.Because this test kit can be diagnosed the expression level of PCA3 and two genes of TMPRSS2:ERG simultaneously, thereby has greatly improved the diagnostic accuracy of prostate cancer.
Embodiment
The invention will be further described below in conjunction with embodiment.
The present invention carries out detection by quantitative by the transcriptive intermediate amplification technique to the expression level of the PCA3 in the human body and two genes of TMPRSS2:ERG, and take the expression level of PSA gene as benchmark value, for early screening, prognosis and the formulation treatment plan of prostate cancer provides foundation.
Transcriptive intermediate amplification technique principle is as follows:
The transcriptive intermediate amplification technique is to utilize RNA polymerase and reversed transcriptive enzyme cloning RNA under 42 isothermal reaction conditions, this technology will design a pair of Auele Specific Primer-promoter primer and reverse primer for target sequence, the promoter sequence that wherein has t7 rna polymerase identification on the promoter primer, promoter primer is after target sequence is combined, under the effect of ThermoScript II, carry out reverse transcription reaction, form the RNA-DNA hybrid molecule.The ribonuclease H activity that ThermoScript II has can be hydrolyzed the RNA-DNA hybrid molecule, forms single stranded DNA, and this single stranded DNA contains the promoter sequence of t7 rna polymerase identification.Then reverse primer is combined with single stranded DNA, by the reverse transcription synthetic dsdna.T7 rna polymerase is combined on the promotor, transcribes take DNA as template, can obtain 100 ~ 1000 copy transcripts by a part dna profiling, and these transcripts enter again reaction, as the starting template of transcriptive intermediate amplification, repeat above-mentioned steps.In the transcriptive intermediate amplified reaction, product RNA is exponential growth, target sequence can be increased 10 in 15 ~ 30min
10Doubly.After reaction was finished, available hybridization protection test detected the RNA product.Detection method is to hybridize with dna probe and the product of acridinium ester mark first; can not hybridize with product such as probe; then can be removed by selectivity; so detect negative with photometer; if the hybridization of the target sequence in probe and the product, then the acridinium ester on the probe is protected by the dna double spiral and is not hydrolyzed, so the photometer test positive; and the chemiluminescence intensity of hybridization probe is directly proportional with the amount of target nucleic acid, can carry out quantitatively RNA thus.
Embodiment
One, primer pair
According to above-mentioned transcriptive intermediate amplification technique principle, and the reference sequences of the disclosed gene of GenBank GeneBank of the state-run biotechnology NCBI of information center of the U.S., design respectively the primer pair of expression level that is respectively applied to detect TMPRSS2:ERG, PCA3 or PSA gene of detection design, all have promoter primer and reverse primer, wherein:
Primer pair for detection of the TMPRSS2:ERG gene expression dose is:
Promoter primer (SEQ ID NO:1)
AAATTAATACGACTCACTATAGGGAGACGAGCGCGGCAGGAAGCCTTATCAGTT
Reverse primer (SEQ ID NO:4)
AGCCAGGTGTGGCGTTCCGTA
Primer pair for detection of the PCA3 gene expression dose:
Promoter primer (SEQ ID NO:2)
AAA?TTAA?TACGACTCACTAT?AGGGAGACTCCACACACACAGGAAGCACAA
Reverse primer (SEQ ID NO:5):
TCTAATGTCCTTCCCTCACAAGCG
Primer pair for detection of the PSA gene expression dose:
Promoter primer (SEQ ID NO:3)
AAATTAATACGACTCACTATAGGGAGACTGCCCACTGCATCAGGAACAAA
Reverse primer (SEQ ID NO:6):
AGCTGTGGCTGACCTGAAATACCT
Two, be marked with the dna probe of acridinium ester and vitamin H
The contriver is according to above-mentioned transcriptive intermediate amplification technique principle and immobilization hybridization protection method, designed the dna probe that is marked with acridinium ester and vitamin H of the expression level that is respectively applied to detect TMPRSS2:ERG, PCA3, PSA gene, and is as follows respectively:
The dna probe that is marked with acridinium ester and vitamin H (SEQ ID NO:7) for detection of the TMPRSS2:ERG gene expression dose:
GGCAGGAAG*CCTTATCAGTTGTGAGTaaaaaaaaaaaaaaa/iUniAmM//3Bio/
The dna probe that is marked with AE and vitamin H (SEQ ID NO:8) for detection of the PCA3 gene expression dose:
AAGGAAGCACAG*AGATCCCTGGGAGAAAaaaaaaaaaaaaaaa/iUniAmM//3Bio/
The dna probe that is marked with AE and vitamin H (SEQ ID NO:9) for detection of the PSA gene expression dose:
AGCTGCCCACT*GCATCAGGAACAAAAaaaaaaaaaaaaaaa/iUniAmM//3Bio/
The meaning of iUiAmM in above-mentioned three dna probes that are marked with acridinium ester and vitamin H be this nucleotide sequence through internal amino acid modification, the * position is connected to amino acid radical in sequence, is combined with the acridinium ester luminophore on this free radical.The 3Bio meaning in above-mentioned three dna probes that are marked with acridinium ester and vitamin H is that 3 ' end at the nucleotide sequence of above-mentioned dna probe is marked with vitamin H (Biotin), and this vitamin H can be combined by the streptavidin on being coated on the 96-orifice plate.
Three, be marked with the preparation method of the dna probe of acridinium ester and vitamin H
The described preparation method who is marked with the dna probe of acridinium ester and vitamin H, be respectively above-mentioned 3 ' end be marked with vitamin H and have SEQ IDNO:7, SEQ ID NO:8 or SEQ ID NO:9 shown in the dna molecular probe of nucleotides sequence in the amino acid radical of * position connect the luminophore acridinium ester, concrete steps are as follows:
The first step, the acridinium ester labeled reactant
3 ' end of drying is marked with dna probe and the 3 μ L distilled waters of vitamin H, 1 μ L 1mol/L 4-hydroxyethyl piperazine ethanesulfonic acid (pH 8.0) solution, 4 μ L dimethyl sulfoxide (DMSO), 2 μ L 25mmol/L acridinium ester dimethyl sulphoxide solutions are together behind the mixing, centrifugal 2 min, the supernatant liquor of collecting is behind reaction 20 min under 37 ° of C, add successively 3.0 μ L 25mmol/L acridinium ester dimethyl sulphoxide solutions, 1.5 μ L distilled water, 0.5 μ L 1mol/L 4-hydroxyethyl piperazine ethanesulfonic acid (pH 8.0), mixing and centrifugal 2 min, the supernatant liquor of collecting is behind reaction 20 min under 37 C, add 5 times to the lysine solution of above-mentioned reaction solution volume, at room temperature reaction 5 min to end the acridinium ester labeled reactant.
The compound method of above-mentioned lysine solution is: Methionin is mixed with the Methionin 4-hydroxyethyl piperazine ethanesulfonic acid solution of 0.125 mol/L with 0.1 mol/L 4-hydroxyethyl piperazine ethanesulfonic acid (pH 8.0), mixes with isopyknic dimethyl sulfoxide (DMSO).
Second step, the ethanol preliminary purification
Add 30 μ L, 3 mol/L sodium-acetates (pH 5.0), 245 μ L pure water, 5 μ L glycogens in the end reaction liquid in the above-mentioned the first step after the usefulness lysine solution stopped reaction, add again 640 μ L dehydrated alcohols after the vibration, put and react 5 ~ 10 min on ice, perhaps place 12 h at-20 C, centrifugal 5 min of 15,000 rpm give up supernatant again, add 200 μ L dissolved in purified water throw outs, obtain the dna probe sample that is marked with acridinium ester and vitamin H with the ethanol preliminary purification.
The 3rd step, the RPLC purifying
The dna probe sample RPLC purifying that is marked with acridinium ester and vitamin H of the preliminary purification that second step is collected, the Reversed Phase High Performance that uses is Vydac C4 reversed-phase column, it is the C4 bonded silica gel chromatographic column in the Vydac company 300A TP series chromatographic column of producing, elution buffer is 0.1 mol/L acetic acid triethylamine and acetonitrile, gradient is 10 ~ 15%(mass percent concentration) acetonitrile with flow velocity wash-out 25 min of 1 mL/min, elutriant detects at 260 nm.
The above-mentioned dna probe that is marked with acridinium ester and vitamin H for preparing is fixed on 96 orifice plates that scribble streptavidin, its method is: will dilute 1000 ~ 2000 times with hybridization solution from the dna probe sample that is marked with acridinium ester and vitamin H that Reversed Phase High Performance is collected, then the addition by every hole 1 ~ 5 μ L adds on 96 orifice plates that scribble streptavidin, at the slight vibration of 4 C 40 min, and then with hybridization solution flushing twice, air-dry getting final product.
Above-mentioned hybridization solution is: 230 mmol/L lithium hydroxides, 10 mmol/L ethylene glycol diethyl ether ethylenediamine tetraacetic acid (EDTA)s, 20 mmol/L ethylenediamine tetraacetic acid (EDTA)s, 100 mmol/L Succinic Acid, 1.2 mol/L lithium chlorides, 2% dialkyl group Lithium Sulphate, 15 mmol/L, two sulphur, two pyridines (pH 4.7).
Four, test kit
Test kit can enough transcriptive intermediate amplification techniques and the immobilization hybridization protection method expression level of TMPRSS2:ERG and PCA3 gene in the detection by quantitative body rapidly.
This test kit comprises:
Container a1 is equipped with the promoter primer for detection of the TMPRSS2:ERG gene expression dose among the container a1, this promoter primer has the nucleotide sequence shown in the SEQ ID NO:1;
Container a2 is equipped with the reverse primer for detection of the TMPRSS2:ERG gene expression dose among the container a2, this reverse primer has the nucleotide sequence shown in the SEQ ID NO:4;
Container b1 is equipped with the promoter primer for detection of the PCA3 gene expression dose among the container b1, this promoter primer has the nucleotide sequence shown in the SEQ ID NO:2;
Container b2 is equipped with the reverse primer for detection of the PCA3 gene expression dose among the container b2, this reverse primer has the nucleotide sequence shown in the SEQ ID NO:5;
Container c1 is equipped with the promoter primer for detection of the PSA gene expression dose among the container c1, this promoter primer has the nucleotide sequence shown in the SEQ ID NO:3;
Container c2 is equipped with the reverse primer for detection of the PSA gene expression dose among the container c2, this reverse primer has the nucleotide sequence shown in the SEQ ID NO:6;
Wherein promoter primer is mixed among the TMA mixture I with the concentration of 200 nmol/L, and this TMA mixture I comprises 40 mmol/L Tutofusin tris-hydrochloric acid (pH7.5), 20 mmol/L magnesium chlorides, 17.5 mmol/L Repone K, 2 mmol/L deoxyribonucleoside triphosphates, 50 g/L polyvidones.Reverse primer is mixed in the TMA mixture II with the concentration of 1.2 mmol/L, and this TMA mixture II comprises 80 mmol/L hydroxymethyl aminomethane-hydrochloric acid (pH 7.5), 32mmol/L magnesium chloride, 14.8 mmol/L Repone K, 16 mmol/L ribonucleotide triphosphates, 100 g/L polyvidones.
Container d is equipped with the mixed solution of reversed transcriptive enzyme and RNA polymerase among the container d, wherein reversed transcriptive enzyme is the moloney murine leukemia virus reverse transcriptase of 1000 units, and RNA polymerase is the t7 rna polymerase of 600 units; And
96 orifice plates are coated with stravidin on this 96 orifice plate, and this stravidin is connected with the dna probe that is marked with acridinium ester and vitamin H.
Container e is equipped with the standard substance that the mRNA transcript by TMPRSS2:ERG, the PCA3 of known copy number or PSA forms among the container e.
Container f is equipped with the contrast product that the mRNA transcript by TMPRSS2:ERG, the PCA3 of known copy number or PSA forms among the container f.
Container g is equipped with the mRNA extracting solution among the container g.This mRNA extracting solution comprises Trizol LS liquid, chloroform, Virahol, ethanol, DEPC water.Wherein Trizol LS liquid is for well known to a person skilled in the art reagent, and is formulated by phenol, guanidinium isothiocyanate, sarcosyl, sodium-acetate, Trisodium Citrate;
DEPC water is knowledge examination known in this field, and " DEPC " is the diethyl pyrocarbonate, and DEPC water refers to contain the water of 0.1%DEPC, namely adds DEPC stoste 1mL in the 1000mL distilled water, shakes up and spends the night.
Container h, among the container h hybridization solution is housed, this hybridization solution is 230 mmol/L lithium hydroxides, 10 mmol/L ethylene glycol diethyl ether ethylenediamine tetraacetic acid (EDTA)s, 20 mmol/L ethylenediamine tetraacetic acid (EDTA)s, 100 mmol/L Succinic Acid, 1.2 mol/L lithium chlorides, 2% dialkyl group Lithium Sulphate, 15 mmol/L, two sulphur, two pyridines (pH 4.7).
Container i is equipped with selection liquid among the container i, selecting liquid is 600 mmol/L boric acid, 182 mmol/L sodium hydroxide, 1% Triton X-100.
Container j is equipped with nitrite ion among the container j, and nitrite ion is 0.1% hydrogen peroxide, 0.001 mol/L nitric acid, 1mol/L sodium hydroxide.
When using the expression level of TMPRSS2:ERG, PCA3 gene in this test kit human body, detecting sample is urine, and feminine gender and positive control are all established in each check.Concrete detection method is:
The first step, the extraction of mRNA in the patient urine
In the 1.5mL Eppendorf tube, add patient urine 100 μ L ~ 500 μ L, add again Trizol LS liquid 500 μ L, abundant mixing, room temperature is placed 10 min, adds 200 μ L chloroforms, covers tightly the centrifuge tube lid, firmly shaking centrifuge tube makes solution fully emulsified, room temperature is placed 10 min, at 4 ° of C, with the centrifugal 15min of the speed of 13000 r/min, upper strata liquid is moved in another clean Eppendorf tube, add the equal-volume Virahol, put upside down gently centrifuge tube with abundant mixing, room temperature is placed 10 min, again at 4 ℃, with the centrifugal 15min of the speed of 13000 r/min, supernatant discarded, precipitation is the mRNA extract, and this precipitation adds 1 mL, 75% ethanol, and is frozen in-70 ° of C, can preserve 1 year, perhaps after adding 1 mL, 75% ethanol, continue at 4 ° of C with centrifugal 10 min of the speed of 8000r/min, supernatant discarded, be deposited in dry 5min in the super clean bench, add 1 mL DEPC and process water, in-20 ℃ of preservations, can preserve about 1 month.
It also is reagent known in this field that above-mentioned DEPC processes water, and DEPC processes water and refers to add DEPC 1 mL in 1L distilled water, is mixed with the water that contains 0.1% DEPC, after the fierce jolting, left standstill 4 hours in room temperature, then autoclaving, to remove degraded DEPC, DEPC can be decomposed into CO
2And ethanol.
Second step, transcriptive intermediate amplification mRNA
Get mRNA extract 2 μ L ~ 10 μ L and the above-mentioned TMA mixture of 48 μ l I in the first step, be mixed with the promoter primer of 200 nmol/L TMPRSS2:ERG, PCA3 or PSA gene among the TMA mixture I, then react 30 min at 20 ° of C; Add the above-mentioned TMA mixtures II of 25 μ L, be mixed with the reverse primer of 1.2 mmol/L TMPRSS2:ERG, PCA3 or PSA gene in the TMA mixtures II, react 5 min at 94 ° of C, cool to room temperature, after leaving standstill 5 min, add 25 μ L, 1000 unit Moloney (family name) murine leukemia virus reverse transcriptases and 600 T7 of unit RNA polymerase mixed solutions, at 40 ° of C expansion reaction 75 min.
The 3rd step, hybridization
With 96 orifice plates that are fixed with the dna probe that is marked with acridinium ester and vitamin H more than the amount cleaning of 10 mmol/L Tutofusin tris-hydrochloric acid (pH 7.0) according to 100 μ l/ holes, and triplicate.Then amplified material in the second step and the above-mentioned hybridization solution of 15 μ l are mixed, leave standstill 15min at 60 C, then each sample adds 75 μ l selection liquid, leaves standstill 10 min at 60 C, add at last 100 μ l nitrite ions in each sample, the signal of colour developing is by the photometer record.
In the 4th step, the result calculates
Standard substance and contrast product are comprised of the transcript of the mRNA of TMPRSS2:ERG, the PCA3 of known copy number and PSA.Be the Criterion curve, the PCA3/PSA of each concentration, perhaps TMPRSS2:ERG/PSA has three points, then is averaged.
Typical curve is: y=a+bX
Wherein: y is the photometer reading; X is the copy number of mRNA; A and b are constant, determine by standard substance.
By this typical curve can obtain PCA3 in the sample and TMPRSS2:ERG and PSA with respect to the copy number of mRNA.Use respectively again the mRNA copy numerical value of PCA3 and TMPRSS2:ERG to copy numerical value except the mRNA in PSA, its ratio multiply by 1000 again, be corresponding PCA3 and TMPRSS2:ERG diagnosis index, can judge that by the numerical value of these two diagnosis indexs patient gets the height of prostate cancer risk, namely
The PCA3 scoring=
The TMPRSS2:ERG scoring=
Wherein PCA3mRNA, TMPRSS2:ERGmRNA, PSAmRNA represent respectively the mRNA copy number of PCA3, TMPRSS2:ERG, PSA.
If the normal range of PCA3 scoring is: 25 ~ 35; The normal range of TMPRSS2/ERG scoring is: 27 ~ 40.If PCA3 scoring be higher than 25 ~ 35 and the TMPRSS2/ERG scoring be higher than 27 ~ 40, then patient's sample is positive, the possibility of suffering from prostate cancer is very high; Otherwise negative, the possibility of suffering from prostate cancer is low.
The advantage of invention is: this prostatic cancer early diagnosis kit, utilization to be the transcriptive intermediate amplification technique increase rapidly to the gene expression dose of the Biological indicators in the sick body, to improve detection sensitivity.Compare with RT-PCR, the operation of transcriptive intermediate amplification technique is simpler, and the condition milder can carry out the ground amplification of height copy at low temperatures, and amplification efficiency is high, can Biological indicators to be checked can be increased 10 in 15 ~ 30 min
10Doubly, the sensitivity that has therefore improved subsequent detection.
The present invention also detects the expression level of TMPRSS2:ERG, PCA3 gene in the patient body by immobilization hybridization protection method in addition, and take the expression level of PSA gene as benchmark value.This immobilization hybridization protection method is that the mRNA after the amplification is hybridized on the dna probe that is marked with acridinium ester and vitamin H, and this dna probe is fixed on 96 orifice plates, and this makes subsequent detection only need to get final product in 96 orifice plates, and is very convenient.When the TMPRSS2:ERG in the dna probe that is marked with acridinium ester and vitamin H and the patient body, PCA3 or PSA gene in conjunction with after forming two strands, the acridinium ester luminophore is protected; And the strand of not hybridizing remembers that the acridinium ester luminophore on the dna probe that acridinium ester and vitamin H are arranged is hydrolyzed, can't be luminous again.And the optical signal of double-stranded upper acridinium ester luminophore can be detected by the ordinary light detector, detection by the luminous signal power, with the PSA gene expression dose as benchmark value, can make things convenient for, sensitive, detect TMPRSS2:ERG in the patient body and the gene expression dose of PCA3 at low cost.
SEQ?ID?NO：1
AAATTAATACGACTCACTATAGGGAGACGAGCGCGGCAGGAAGCCTTATCAGTT
SEQ?ID?NO：2
AAA?TTAATACGACTCACTAT?AGGGAGACTCCACACACACAGGAAGCACAA
SEQ?ID?NO：3
AAATTAATACGACTCACTATAGGGAGACTGCCCACTGCATCAGGAACAAA
SEQ?ID?NO：4
AGCCAGGTGTGGCGTTCCGTA
SEQ?ID?NO：5
TCTAATGTCCTTCCCTCACAAGCG
SEQ?ID?NO：6
AGCTGTGGCTGACCTGAAATACCT
SEQ?ID?NO：7
GGCAGGAAG*CCTTATCAGTTGTGAGT
SEQ?ID?NO：8
AAGGAAGCACAG*AGATCCCTGGGAGAAA
SEQ?ID?NO：9
AGCTGCCCACT*GCATCAGGAACAAAA
Claims (10)
1. three groups of primer pairs that are used for prostatic cancer early diagnosis, it is characterized in that: first group of primer pair has the nucleotide sequence shown in SEQ IDNO:1 and the SEQ ID NO:4; Second group of primer pair has the nucleotide sequence shown in SEQ IDNO:2 and the SEQ ID NO:5; The 3rd group of primer pair has the nucleotide sequence shown in SEQ IDNO:3 and the SEQ ID NO:6, described three groups of primer pairs come the expression level of TMPRSS2:ERG, PCA3 in the human body body, PSA gene by the transcriptive intermediate amplification technique, with the risk of judging that prostate cancer occurs.
2. three dna probes that are used for prostatic cancer early diagnosis, it is characterized in that: described three dna probes have respectively the nucleotide sequence shown in SEQ IDNO:7, SEQ ID NO:8, the SEQ ID NO:9, and the * position that the nucleotides sequence shown in described SEQ IDNO:7, SEQ ID NO:8, the SEQ ID NO:9 lists is connected to amino acid radical, be connected to luminophore on the described amino acid radical, 3 ' end of the nucleotide sequence shown in described SEQ IDNO:7, SEQ ID NO:8, the SEQ ID NO:9 is marked with vitamin H.
3. three dna probes for prostatic cancer early diagnosis as claimed in claim 2, it is characterized in that: described luminophore is acridinium ester.
4. the preparation method of three dna probes for prostatic cancer early diagnosis as claimed in claim 3, it is characterized in that: 3 ' end be marked with vitamin H and have SEQ IDNO:7, SEQ ID NO:8 or SEQ ID NO:9 shown in the dna probe of nucleotide sequence in the amino acid radical of * position connect acridinium ester, concrete steps are as follows:
The first step is dissolved in dimethyl sulfoxide (DMSO) with acridinium ester;
Second step, in the presence of water, the described acridinium ester that is dissolved in dimethyl sulfoxide (DMSO) be marked with vitamin H with dry described 3 ' end and have SEQ IDNO:7, SEQ ID NO:8 or SEQ ID NO:9 shown in the dna probe of nucleotide sequence under 20 ~ 45 ° of C, pH6 ~ 9 conditions, react 20 ~ 60 min, use again the Methionin stopped reaction;
The 3rd step added sodium-acetate and glycogen second step described in the solution after the Methionin stopped reaction, and behind the described sodium-acetate of mixing and the glycogen, in adding dehydrated alcohol, and at 0 ° of 5 min ~ 10 h of reaction below the C, the centrifugal supernatant of removing keeps throw out;
The 4th the step, described throw out with water dissolution after, use the RPLC purifying.
5. prostatic cancer early diagnosis kit, it is characterized in that: described test kit contains
Container a1, be equipped with among the container a1 have the nucleotide sequence shown in the SEQ ID NO:1, for detection of the promoter primer of TMPRSS2:ERG gene expression dose;
Container a2, be equipped with among the container a2 have the nucleotide sequence shown in the SEQ ID NO:4, for detection of the reverse primer of TMPRSS2:ERG gene expression dose;
Container b1, be equipped with among the container b1 have the nucleotide sequence shown in the SEQ ID NO:2, for detection of the promoter primer of PCA3 gene expression dose;
Container b2, be equipped with among the container b2 have the nucleotide sequence shown in the SEQ ID NO:5, for detection of the reverse primer of PCA3 gene expression dose;
Container c1, be equipped with among the container c1 have the nucleotide sequence shown in the SEQ ID NO:3, for detection of the promoter primer of PSA gene expression dose;
Container c2, be equipped with among the container c2 have the nucleotide sequence shown in the SEQ ID NO:6, for detection of the reverse primer of PSA gene expression dose;
Container d is equipped with the mixed solution of reversed transcriptive enzyme and RNA polymerase among the container d; And
Solid phase carrier scribbles streptavidin on the described solid phase carrier, is connected to dna probe as claimed in claim 2 on the described streptavidin.
6. prostatic cancer early diagnosis kit as claimed in claim 5, it is characterized in that: described solid phase carrier is 96 orifice plates.
7. prostatic cancer early diagnosis kit as claimed in claim 5 is characterized in that: be connected to dna probe as claimed in claim 3 on the described streptavidin.
8. prostatic cancer early diagnosis kit as claimed in claim 5 is characterized in that: also comprise in the described test kit:
Container e is equipped with the standard substance that the mRNA transcript by TMPRSS2:ERG, the PCA3 of known copy number or PSA forms among the container e; With
Container f is equipped with the contrast product that the mRNA transcript by TMPRSS2:ERG, the PCA3 of known copy number or PSA forms among the container f.
9. prostatic cancer early diagnosis kit as claimed in claim 5 is characterized in that: also comprise in the described test kit:
Container g is equipped with the mRNA extracting solution among the container g.
10. prostatic cancer early diagnosis kit as claimed in claim 5 is characterized in that: also comprise in the described test kit:
Container h is equipped with hybridization solution among the container h;
Container i is equipped with selection liquid among the container i;
Container j is equipped with nitrite ion among the container j.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210442501.6A CN102912030B (en) | 2012-11-08 | 2012-11-08 | Primer pairs, probes and kit for early diagnosis of prostatic cancer (PC) |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210442501.6A CN102912030B (en) | 2012-11-08 | 2012-11-08 | Primer pairs, probes and kit for early diagnosis of prostatic cancer (PC) |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102912030A true CN102912030A (en) | 2013-02-06 |
| CN102912030B CN102912030B (en) | 2014-07-30 |
Family
ID=47610605
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210442501.6A Active CN102912030B (en) | 2012-11-08 | 2012-11-08 | Primer pairs, probes and kit for early diagnosis of prostatic cancer (PC) |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102912030B (en) |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103966352A (en) * | 2014-05-29 | 2014-08-06 | 上海度微医学技术有限公司 | Application of PCA3, CST1 and CST4 to preparation of prostate gland cancer marker and kit of PCA3, CST1 and CST4 |
| CN104611430A (en) * | 2015-01-26 | 2015-05-13 | 钱学庆 | Detection method and primers for TMPRSS2-ERG gene in human urine |
| CN104878077A (en) * | 2014-02-28 | 2015-09-02 | 谭巍 | PCA3 mRNA/ACPP mRNA RT-PCR detection primer and detection kit thereof |
| CN105102636A (en) * | 2013-03-14 | 2015-11-25 | 尼欧基因组学实验室股份有限公司 | Compositions and methods for detecting and determining a prognosis for prostate cancer |
| CN107604096A (en) * | 2017-10-13 | 2018-01-19 | 杭州迪安医学检验中心有限公司 | A kind of nucleotide sequence and kit for hepatitis type B virus detection |
| CN110184349A (en) * | 2019-05-17 | 2019-08-30 | 浙江大学 | A kind of prostatic cancer early diagnosis kit |
| CN111394455A (en) * | 2020-03-09 | 2020-07-10 | 皖南医学院 | Kit for detecting prostate cancer and preparation method thereof |
| CN114410787A (en) * | 2022-01-24 | 2022-04-29 | 上海康黎医学检验所有限公司 | Primer-probe combination and kit for early diagnosis, metastasis early warning and prognosis evaluation of prostate cancer and application of primer-probe combination and kit |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102308004A (en) * | 2008-10-30 | 2012-01-04 | 卡里斯生命科学卢森堡控股有限责任公司 | Methods for assessing RNA patterns |
-
2012
- 2012-11-08 CN CN201210442501.6A patent/CN102912030B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102308004A (en) * | 2008-10-30 | 2012-01-04 | 卡里斯生命科学卢森堡控股有限责任公司 | Methods for assessing RNA patterns |
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105102636A (en) * | 2013-03-14 | 2015-11-25 | 尼欧基因组学实验室股份有限公司 | Compositions and methods for detecting and determining a prognosis for prostate cancer |
| CN105102636B (en) * | 2013-03-14 | 2019-08-13 | 尼欧基因组学实验室股份有限公司 | For detecting and measuring the composition and method of prostate cancer prognosis |
| CN104878077A (en) * | 2014-02-28 | 2015-09-02 | 谭巍 | PCA3 mRNA/ACPP mRNA RT-PCR detection primer and detection kit thereof |
| CN103966352A (en) * | 2014-05-29 | 2014-08-06 | 上海度微医学技术有限公司 | Application of PCA3, CST1 and CST4 to preparation of prostate gland cancer marker and kit of PCA3, CST1 and CST4 |
| CN103966352B (en) * | 2014-05-29 | 2015-07-29 | 苏州工业园区为真生物医药科技有限公司 | PCA3, CST1 and CST4 are at the application prepared in prostate cancer marker and test kit thereof |
| CN104611430A (en) * | 2015-01-26 | 2015-05-13 | 钱学庆 | Detection method and primers for TMPRSS2-ERG gene in human urine |
| CN107604096A (en) * | 2017-10-13 | 2018-01-19 | 杭州迪安医学检验中心有限公司 | A kind of nucleotide sequence and kit for hepatitis type B virus detection |
| CN107604096B (en) * | 2017-10-13 | 2019-09-03 | 杭州迪安医学检验中心有限公司 | A kind of nucleic acid sequence and kit for hepatitis type B virus detection |
| CN110184349A (en) * | 2019-05-17 | 2019-08-30 | 浙江大学 | A kind of prostatic cancer early diagnosis kit |
| CN111394455A (en) * | 2020-03-09 | 2020-07-10 | 皖南医学院 | Kit for detecting prostate cancer and preparation method thereof |
| CN114410787A (en) * | 2022-01-24 | 2022-04-29 | 上海康黎医学检验所有限公司 | Primer-probe combination and kit for early diagnosis, metastasis early warning and prognosis evaluation of prostate cancer and application of primer-probe combination and kit |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102912030B (en) | 2014-07-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102912030B (en) | Primer pairs, probes and kit for early diagnosis of prostatic cancer (PC) | |
| Guo et al. | Diagnostic and prognostic value of circulating miR-221 for extranodal natural killer/T-cell lymphoma | |
| CN106434870A (en) | ncRNA and uses thereof | |
| US20090291438A1 (en) | Methods for Analysis of Extracelluar RNA Species | |
| CN104152452B (en) | A kind of blood miRNA marker relevant to hepatocarcinoma and application thereof | |
| CN114672568B (en) | Kit for detecting cervical cell gene methylation | |
| CN104789664A (en) | Primer set, method and kit for Long-range PCR (polymerase chain reaction) detection of BRCA (breast cancer susceptibility gene) 1 and BRCA 2 | |
| CN103834638A (en) | Single nucleotide polymorphic site rs7574865 related to liver cancer susceptibility and application thereof | |
| CN110616229A (en) | Fusion gene of FGFR1 translocation blood disease and detection primer and application thereof | |
| CN111826446A (en) | Primer, probe and kit for early screening and auxiliary diagnosis of bladder cancer | |
| CN109055555B (en) | Lung cancer early stage metastasis diagnosis marker and kit and application thereof | |
| CN107447042B (en) | Molecular marker for diagnosing active tuberculosis diseases and application thereof | |
| CN113215257B (en) | Nucleic acid composition, kit and detection method for detecting breast cancer related gene methylation | |
| CN109880825A (en) | A kind of circular rna hsa_circ_0012152 and its application | |
| CN101880715A (en) | Recurrence predicting reagent kit for liver cancer liver transplantation postoperation | |
| US20190360050A1 (en) | Methods of Detecting Bladder Cancer | |
| CN101665834A (en) | Ki67mRNA real-time fluorescence quantitative RT-PCR detection reagent kit | |
| CN110499368B (en) | SNP marker related to oral cancer prognosis prediction and application thereof | |
| CN103502469A (en) | Ankylosing spondylitis susceptibility and mononucleotide polymorphism detection method, kit and use thereof | |
| CN110373457A (en) | A kind of mRNA marker and its application for ulcerative colitis diagnosis | |
| CN112391478B (en) | Application of exosome mRNA in diagnosis of breast diseases | |
| RU2451937C2 (en) | Diagnostic technique for breast cancer by blood plasma interleukin il-8 and/or il-18 rna level | |
| CN113186294A (en) | Nucleic acid composition, kit and detection method for detecting ovarian cancer related gene methylation | |
| CN112921090B (en) | Application of extracellular vesicle circRNAs as gastric cancer diagnosis marker | |
| CN112980949A (en) | SNP marker for identifying nasopharyngeal carcinoma high risk group, kit and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |