CN110184349A - A kind of prostatic cancer early diagnosis kit - Google Patents

Abstract

The invention discloses a kind of prostatic cancer early diagnosis kits, include three kinds of reagents: serum prostate cancer specific antigen (PSA), prostate-specific antigen gene (PCA3), Human kallikrein (hK2).The present invention carries out half-quantitative detection to the multinomial molecular labeling in the peripheral blood in patients for receiving aspiration biopsy of prostatic gland by the method for real-time fluorescence quantitative PCR, filter out PCA3, hK2, miR-141 can increase the molecular marked compound of prostate cancer diagnosis susceptibility and specificity, particular on the patient of PSA gray area, the joint-detection of PCA3, hK2 and PSA can become the important means of prostatic cancer early diagnosis, and significantly be higher than the existing diagnosis based on PSA on the susceptibility and specificity diagnosed.

Description

A kind of prostatic cancer early diagnosis kit

Technical field

The invention belongs to field of biotechnology, are related to a kind of prostatic cancer early diagnosis kit.

Background technique

Prostate cancer is that the most common malignant tumour, disease incidence occupy generation in male malignancy in American-European countries male The 2nd, boundary, the prostate-cancer incidence of Chinese population is relatively low, but in rising trend in recent years.The main inspection of prostate cancer Checking method has digital rectal examination (DRE), and serum prostate cancer specific antigen (PSA) and transrectal ultrasonography prostate guided puncture Biopsy.Wherein digital rectal examination joint PSA inspection is the best approach of early stage generally acknowledged at present doubtful prostate cancer diagnosis, still PSA detection is high with sensibility, the relatively low feature of specificity, especially when PSA is between 4-10ng/mL, forefront The recall rate of gland cancer is only 25% or so, while PSA is easy to cause excessive diagnosis and the over-treatment of prostate cancer again.Therefore compel Be essential the New Set of prostatic cancer early diagnosis to be found, to improve the specificity and sensitivity of prostate cancer diagnosis to greatest extent Degree, while reducing the detection of clinical meaningless tumour and avoiding over-treatment.

Presently, there are a large amount of results of study for different molecular marker to show that novel molecular marker is especially Use in conjunction between different markers, it is possible to the key as prostatic cancer early diagnosis.Wherein prostate specific is anti- Protogene (PCA3), TMPRSS2:ERG fusion, Human kallikrein (hK2) and a variety of miRNA etc. are in cytology level Researches show that with clinical application potential.

Summary of the invention

In view of the above-mentioned deficiencies in the prior art, it is an object of the present invention to provide a kind of prostatic cancer early diagnosis kit.

The present invention adopts the following technical scheme: a kind of prostatic cancer early diagnosis kit, includes three kinds of reagents: before serum Column gland cancer specific antigen (PSA), prostate-specific antigen gene (PCA3), Human kallikrein (hK2).

The beneficial effects of the present invention are: the present invention carries out prostate cancer using the joint-detection of PCA3, hK2 and PSA Early diagnosis has higher Clinical significance of MG especially for the patient of PSA gray area.Mutually than before according to PSA, PSAD Monitoring method have higher susceptibility and accuracy.

Detailed description of the invention

Figure 1A is the ROC curve of Free PSA ratio；B is the ROC curve of PSA and PSAD；C is swum when being PSA4-10ng/ml ROC curve from PSA ratio；The ROC curve of PSA and PSAD value when D is PSA 4-10ng/ml.

Fig. 2 is table of the molecular marked compounds such as hK2, PCA3, miR-141 and PSA in prostate cancer group and hyperplasia of prostate group The ROC curve reached.

Fig. 3 is to return to establish the expected probability value based on 3 molecular marked compound indexs using logistics, and removal bone turns Move patient PSA, the ROC curve of hK2 and PCA3 and the prediction probability based on 3.

Fig. 4 is that PSA is located at the ROC song of PSA, hK2 and PCA3 and the prediction probability based on 3 in 4-10ng/ml patient Line.

Specific embodiment

The present invention is further analyzed with attached drawing combined with specific embodiments below.

Embodiment 1: using kit of the invention, carries out prostatic cancer early diagnosis:

1. research object: this research object is Zhejiang University Medical College The First Affiliated Hospital's in January, 2014 in July, 2015 Period, which is hospitalized, receives the patient of aspiration biopsy of prostatic gland, amounts to 100.

2. the method for sampling: receiving to acquire peripheric venous blood 5ml when aspiration biopsy of prostatic gland patient admission, it is anticoagulant that EDTA is added Guan Zhong.It is detected using chemiluminescence particulate immunodetection, using ARCHITECT Total PSA Reagent Kit reagent Box detects tPSA and fPSA.

3. clinical information is collected: including Date of Sampling, admission number, patient name, pathological number, age, contact method, identity Number, PSA when being admitted to hospital are demonstrate,proved, Free PSA ratio (is checked and completed on the day of being admitted to hospital), and prostate volume (intracavitary B ultrasound) punctures secondary Number, clinical symptoms, medication history, retention of urine history, prostate MRI (3.0T includes disperse phase), pathological examination (including puncture needle number, Gleason scoring), ECT is as a result, the information such as surgery Pathology.

4. cell line: human androgen independent prostate cancinoma cell line PC3 and DU-145 are purchased from Chinese Academy of Sciences Shanghai Cell biological research institute.

5. cell culture: then above two cell RPMI-1640 culture medium is added in RPMI-1640 culture medium 10% fetal calf serum, 100U/ml penicillin and 100mg/ml streptomysin, are placed in 37 DEG C, train in the constant incubator containing 5%CO2 It supports.

6.qRT-PCR detection: the expression water of PCA3, Hk2, mir-141 in 2 plants of cell lines are detected using qRT-PCR technology It is flat.The total serum IgE in cell is extracted using Trizol reagent, uses PrimeScript reverse transcription reagent box and SYBR Premix Ex Taq kit carries out qRT-PCR analysis, is as a result standardized using phosphoglycerate dehydrogenase (GAPDH).

Used PCR primer is as follows:

Gene	Sequence
		GAPDH-F	CGGAGTCAACGGATTTGGTCGTAT
U6-F	TGCGGGTGCTCGCTTCGGCAGC
		PCA3-F	GAGAACAGGGGAGGGAGAG
PCA3-R	ACGTTCTGGGATACATGTGC
		pri-mir-141-F	ACCCAGTGCGATTTGTCA
pri-mir-141-R	ACTGTACTGGAAGATGGACC
		Hk2-F	GGCTCTGGACAGGTGGTAAAGA
Hk2-R	CGGTAATGCACCACCTTGGTGT
		KLK3-F	CGCAAGTTCACCCTCAGAAGGT
KLK3-R	GACGTGATACCTTGAAGCACACC
		ERG-F	TAGGCGCGAGCTAAGCAGGAG
ERG-R	GTAGGCACACTCAAACAACGACTGG

PCR reaction condition are as follows: 95 DEG C of initial denaturation 30s；By 40 times: 95 DEG C of denaturation 3s of following parameter cyclic, 60 DEG C of annealing 30s；4 DEG C of stopping reactions.

PCR reaction carries out relative quantification detection in ABI 7500Fast Real-Time PCR instrument, is interior with GAPDH Ginseng compares it and is puncturing the differential expression in negative and positive patients peripheral blood, using 2- △ △ Ct method.

7. statistical analysis: for statistical analysis using 22.0 software of SPSS.Paired data compares is matched using Wilcoxon To rank sum test, P < 0.05 is thought with significant difference.All experimental results take the flat of 3 times or more independent repeated trials Mean value.Best critical value, area under the curve (AUC) are determined with Receiver operating curve (ROC), to the molecular labeling of screening The diagnostic of object is evaluated.As a result as follows:

(1) hK2 is filtered out, PCA3, miR-141 are the molecular labeling for having differential expression in prostate biopsy peripheral blood in patients Object.

The molecular marked compound received using RT-PCR 100 in the peripheral blood of aspiration biopsy of prostatic gland patient is sieved Choosing, the expression of discovery wherein hK2, PCA3, miR-141 etc. in prostate cancer group and hyperplasia of prostate group have differences (P < 0.05).The susceptibility of PSA is higher than other molecular marked compounds, and specificity is then lower than PCA3.

(2) the expected probability value based on 3 molecular marked compound indexs is established；

PSA is established using logistics recurrence, the united expected probability value of tri- molecular marked compound indexs of PCA3, hK2 is 0.789.The united expected probability value of PSA, PCA3, hK2 and three molecular marked compound indexs is distinguished after removing Bone tumour patient It is 0.692,0.682,0.587 and 0.756.

(3) the expected probability value of 3 molecular marked compound indexs of joint is established in tPSA gray area；

It is located at the gray area of 4-10ng/ml in tPSA, combines susceptibility and specificity of the prediction probability in diagnosis of 3 indexs It is all remarkably higher than PSA.When PCA3, hK2 are used alone, AUC-ROC is also significantly greater than PSA.

Above-described embodiment is not for limitation of the invention, and invention is not limited only to above-described embodiment, as long as meeting this Invention requires, and all belongs to the scope of protection of the present invention.

Claims (1)

1. a kind of prostatic cancer early diagnosis kit, which is characterized in that include three kinds of reagents: serum prostate cancer specific antigen (PSA), prostate-specific antigen gene (PCA3), Human kallikrein (hK2).