CN102899344A - Recombinant plasmid containing VEGFA (Vascular Endothelial Growth Factor) gene 3'UTR (Untranslated Region) and reporter gene - Google Patents
Recombinant plasmid containing VEGFA (Vascular Endothelial Growth Factor) gene 3'UTR (Untranslated Region) and reporter gene Download PDFInfo
- Publication number
- CN102899344A CN102899344A CN2012104611147A CN201210461114A CN102899344A CN 102899344 A CN102899344 A CN 102899344A CN 2012104611147 A CN2012104611147 A CN 2012104611147A CN 201210461114 A CN201210461114 A CN 201210461114A CN 102899344 A CN102899344 A CN 102899344A
- Authority
- CN
- China
- Prior art keywords
- gene
- utr
- vegfa
- recombinant plasmid
- reporter gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a recombinant plasmid containing a VEGFR (Vascular Endothelial Growth Factor) gene 3'UTR (Untranslated Region) and a reporter gene, wherein the reporter gene is a firefly luciferase gene. A preparation method of the recombinant plasmid comprises the steps of: 1, amplifying and extracting a carrier plasmid; 2, cloning, digesting and purifying a 3'UTR sequence of the VEGFR gene; 3, connecting the 3'UTR sequence of the VEGFR gene with the carrier plasmid; and 4, screening a recombinant. The recombinant containing the VEGFR gene and the 3'UTR reporter gene, provided by the invention, has excellent application prospect on the aspects of screening angiogenesis related microRNA of, researching an action mechanism of angiogenesis and the microRNA, and researching the mechanism of tumor cell angiogenesis.
Description
Technical field
The present invention relates to a kind of recombinant plasmid, particularly, relate to the recombinant plasmid of a kind of VEGFA of containing gene 3 ' UTR and reporter gene.
Background technology
The full name of VEGFA is vasc μ lar endothelial growth factor A, and its Chinese name is VEGF-A.The vasculogenesis stimulus includes the cytokine that a class is called " angiogenesis factor (antigenic growth factors) ", plays a part to stimulate neovascularization.Some vasculogenesis stimulating factors have been had been found that at present, such as platelet-derived growth factor (PDGF), fibroblast growth factor (bFGF), conversion growth factor (TGF), Vascular endothelium growth factor A (VEGFA) etc., that wherein play a crucial role in tumor-blood-vessel growth is VEGFA.
VEGFA albumen is by secretions such as tumour cell, scavenger cell and fibroblasts, be distributed widely in the many tissues of human body, such as body of gland, lung, liver, kidney, cardiac muscle etc., but expression level is extremely low, normal blood vessels density and basic infiltration function are only kept in its effect, keep nutritive substance.After tumour cell occurring, its expression level generally can rise greatly.There are some researches show that VEGFA is relevant with the tumors invading metachromia, also relevant with tumor susceptibility.
The major function of VEGFA comprises: (1) selectivity strengthens vascular endothelial cell mitotic division, and stimulating endothelial cell propagation also promotes vascularization.(2) the rising blood vessel perviousness of tiny blood vessels is especially exosmosed the blood plasma macromole and is deposited in the blood vessel epimatrix, for the growth of tumour cell and the foundation of new capillary vessel net provide nutrition.
The carrying out with the Model organism genome plan of finishing along with the Human Genome Project, people strengthen day by day for the research that accounts for the non-coding sequence of human genome more than 95%, research finds that in them much be the fragment with biological function and meaning, among these researchs, then be one of focus the most for the research of the microRNA of the strand microRNA of the about 21-23 of a size base.In the research of the tumour in recent years, be one of focus of therapeutic field of tumor relevant for microRNA for the function of tumour and the research of regulation and control always, also obtained very large breakthrough and progress simultaneously.Studies show that at present microRNA mainly is regional by the 3 ' UTR that is attached to target gene, and then suppresses transcribing of target gene, so the inhibition degree of 3 ' UTR of gene can indicate this gene to be subject to the level that microRNA suppresses.Yet, present stage is actually rare for the correlative study report of vasculogenesis and microRNA, and just more rare for the research of VEGFA albumen and microRNA, the while does not have a kind of easy at present yet, and method is screened the microRNA that can suppress Mdr-p efficiently.
Summary of the invention
The purpose of this invention is to provide a kind of blood vessel endothelium growth factor A(VEGFA that contains) recombinant plasmid of gene 3 ' UTR sequence and reporter gene, can be used for the screening of the relevant microRNA of vasculogenesis.
In order to achieve the above object, the invention provides the recombinant plasmid of a kind of VEGFA of containing gene 3 ' UTR and reporter gene, wherein, described reporter gene is firefly luciferase gene.
The above-mentioned recombinant plasmid that contains VEGFA gene 3 ' UTR and reporter gene, wherein, the preparation method of described recombinant plasmid comprises: step 1, increase and extracting to vector plasmid; Step 2, to 3 ' UTR sequence of VEGFA gene clone, enzyme is cut and purifying; Step 3 is carried out 3 ' UTR sequence of described VEGFA gene and being connected of described vector plasmid; Step 4, the screening recon.
The above-mentioned recombinant plasmid that contains VEGFA gene 3 ' UTR and reporter gene, wherein, described step 1 comprises: transform competent escherichia coli cell with described vector plasmid, increase; Then adopt the alkaline lysis extracting to prepare described vector plasmid, the purity of the described vector plasmid of electrophoresis detection and content; With NcoI and HindIII described vector plasmid is carried out enzyme again and cut, the test kit gel reclaims the enzyme of large fragment and cuts product.
Alkaline lysis is the most frequently used also effective means that extracts plasmid, is based on chromosomal DNA and reaches with the difference of renaturation with the sex change of plasmid DNA and separate purpose.Its principle is that high pH makes plasmid DNA and chromosomal DNA sex change, simultaneously precipitating proteins.Again the pH value is transferred to neutrality, plasmid DNA is less, is easy to renaturation and becomes double-stranded.And chromosomal DNA is larger, can renaturation, and tangle and reticulate insoluble substance, thereby can remove by centrifugal.Then concrete grammar carries out centrifugal: solution 1 for adding successively following three kinds of solution: glucose 50 mmol/L, and EDTA 100 mmol/L, Tris-Cl 25 mmol/L, N,O-Diacetylmuramidase 5mg/ml, adjusting pH is 8.0; Solution 2:NaOH 0.2 mol/L, SDS 1%; Solution 3:5 mol/L KAc 60 ml, glacial acetic acid 11.5 ml, redistilled water 28.5 ml.Wherein solution 1 effect mainly is the suspension thalline, and solution 2 effects are cracking thalline, discharge intracellular organic matter, and solution 3 is precipitation chromosomal DNAs.
The above-mentioned recombinant plasmid that contains VEGFA gene 3 ' UTR and reporter gene, wherein, described step 2 comprises: step 2.1,3 ' UTR region sequence design two ends primer according to people's VEGFA gene: primer 1 is upstream 5 ' end primer, 3 ' UTR the complementary base that wherein comprises 19 VEGFA genes, a HindIII recognition site, 3 protection bases; Primer 2 is downstream 3 ' end primer, wherein comprises 19 VEGFA gene 3 ' UTR complementary bases, a NcoI recognition site, 4 protection bases.Step 2.2 take genomic dna as template, utilizes conventional PCR reaction to increase; Step 2.3, reaction is got 5 μ l reaction product and is detected with agarose gel electrophoresis after finishing; Step 2.4, product is answered in negate, behind the agarose gel electrophoresis, cuts glue, reclaims test kit with gel and reclaims; Step 2.5, PCR product NcoI and HindIII double digestion with reclaiming again reclaim in order to connecting and use.
The above-mentioned recombinant plasmid that contains VEGFA gene 3 ' UTR and reporter gene, wherein, described primer 1 is: 5 '-CCC
AAGCTTCTCACCAGGAAAGACTGAT-3 ', wherein
AAGCTTBe the HindIII recognition site.
The above-mentioned recombinant plasmid that contains VEGFA gene 3 ' UTR and reporter gene, wherein, described primer 2 is: 5 '-CATG
CCATGGAACTCAAGTCCACAGCAGT-3 ', wherein
CCATGGBe the NcoI recognition site.
The above-mentioned recombinant plasmid that contains VEGFA gene 3 ' UTR and reporter gene, wherein, described PCR reaction, adopt the ExTaq archaeal dna polymerase, reaction conditions is: at 95 ℃ of denaturation 3min, again at 95 ℃ of sex change 30s, then at 55 ℃ of annealing 45s, extend 1min at 72 ℃ again; Carry out 40 circulations, at 72 ℃ of final 5min that extend, it is rear in 4 ℃ of long-term heat preservations to have increased at last.
The above-mentioned recombinant plasmid that contains VEGFA gene 3 ' UTR and reporter gene, wherein, the connection of described step 3 is that dna ligation kit is adopted in the connection of described step 3, carries out ligation, 16 ℃ are spent the night.
The above-mentioned recombinant plasmid that contains VEGFA gene 3 ' UTR and reporter gene, wherein, described step 4 comprises: get the direct transformed competence colibacillus intestinal bacteria of connection product; Cultivate through selecting in the LB substratum that contains penbritin; Picking colony at random from the culture plate, for subsequent use with the alkaline lysis method of extracting plasmid after the amplification cultivation; Enzyme is cut finally by crossing, PCR, order-checking identify.
The above-mentioned recombinant plasmid that contains VEGFA gene 3 ' UTR and reporter gene, wherein, described recombinant plasmid can suppress for detection of microRNA the function influence of VEGFA genetic expression.
The recombinant plasmid of the VEGFA of containing gene 3 ' UTR provided by the invention and reporter gene has the following advantages:
(1) the present invention is in subsequent applications, have highly sensitive, detection speed is fast, expense is low, need not use the advantages such as radio isotope.
(2) the present invention has the characteristics of targeting simultaneously, can be used for the activity of specific detection microRNA suppressor gene 3 ' UTR.
(3) the present invention can also overcome transfection efficiency to result's impact.
Description of drawings
Fig. 1 is the electrophoresis synoptic diagram of VEGFA gene 3 ' UTR sequence clone product of the present invention.
Fig. 2 is the recombinant plasmid NcoI of VEGFA gene 3 ' UTR and reporter gene and the electrophoresis synoptic diagram that the HindIII double digestion detects of containing of the present invention.
Fig. 3 is the sequencing result of recombinant plasmid of the VEGFA of containing gene 3 ' UTR of the present invention and reporter gene and the comparison chart of sequence that gene pool is looked into.
Embodiment
Below in conjunction with accompanying drawing the specific embodiment of the present invention is further described.
Embodiment one
One. the preparation of bacterial strain, plasmid and reagent etc.
Bacterial strain: intestinal bacteria E.coli competent cell DH5 α is frozen by the laboratory.
Plasmid: pGL3-promoter is that preserve in the laboratory.
Reagent:
The ExTaq archaeal dna polymerase, restriction enzyme HindIII, NcoI and dna ligation kit (DNA Ligation Kit) are available from TaKaRa company.
DL2000 molecule marker (DL2000 marker) and λ DNA/Hind III molecule marker (λ DNA/Hind III marker) are available from Shanghai MajorBio company.
Plasmid reclaims test kit and dna fragmentation reclaims test kit available from Beijing TIANGEN company.
All the other reagent are available from Shanghai MajorBio company.
The preparation of LB substratum:
Prepare 1000 ml LB substratum: take by weighing microbial culture Tryptones 10 g, microbial culture yeast extract 5 g, NaCl 10 g also are dissolved in the 950 ml deionized waters.Regulate pH value to 7.0 with 5 M NaOH.High pressure steam sterilization 20 min.The substratum of paved flat board should first according to top method configuration liquid LB substratum, add agar 15 g/L before the sterilization.In Bechtop, not solidified substratum is poured in the culture dish.
Contain ammonia benzyl LB substratum namely behind above-mentioned substratum autoclave sterilization, be cooled to about 60 ℃.Per 1000 mlLB substratum add 1ml Ampicillin(100mg/ml), 4 ℃ of preservations.
Two. the structure of recombinant plasmid.
Step 1: the conversion of pGL3-promoter plasmid, a large amount of amplification, extracting.
1. with pGL3-promoter plasmid transformation escherichia coli DH5 α competent cell.
(1) in advance the temperature of thermostat water bath is transferred to 42 ℃.
(2) take out pipe (200 a μ L) competence bacteria from-80 ℃ of very low temperature refrigerator-freezers, ice bath melts.(3) add 5 μ l plasmids (dna content is no more than 100ng), place gently 30min on ice behind the mixing.
(4) from ice, take out, put into 42 ℃ of thermostat water bath water-baths and carry out heat shock 1.5min, then put back to rapidly in the ice, leave standstill 5min.
(5) in Bechtop, add gently mixing of 1ml LB substratum (not containing antibiotic) in the aforementioned tube, then be fixed to 37 ℃ of concussion 1h on the spring support of shaking table.
(6) in Bechtop, get above-mentioned conversion mixed solution 200 μ L, drip in the dull and stereotyped culture dish of the solid LB that contains suitable antibiotic, evenly (note: wait a moment after the alcohol on the glass spreading rod extinguishes, after its cooling, be coated with again) with the glass spreading rod coating that spirit lamp burnt.
(7) do mark at the culture dish that coats, be placed on first 30-60min in 37 ℃ of constant incubators until after the liquid on surface all is penetrated in the substratum, be inverted again and come to put into 37 ℃ of constant incubators and spend the night.
(8) observe the colony clone that grows on the flat board, with can be separated from each other between the bacterium colony for well.
2. the single full bacterium colony of picking increases in a large number.
, in 7ml LB substratum (containing Ampicillin), then be fixed on the spring support of shaking table 37 ℃ of concussions and spend the night at the single bacterium colony of picking on the above-mentioned flat board.
3. the extracting of pGL3-promoter plasmid, concrete steps are seen lower.
(1) with centrifugal 15 seconds of the 1.5mlDH5a bacterium 10000rpm of above incubated overnight, thoroughly removes supernatant.
(2) add the 100ml solution I, with rifle head or the vibrator bacterium that fully suspends, ice bath 2 minutes.
(3) add 200 ml solution II, gentle mixing makes bacteria lysis immediately, and room temperature is placed 1 min.
(4) add the 350ml solution III, turn upside down immediately for several times, make it abundant neutralization, room temperature was placed 1 minute.
(5) 12000rpm, centrifugal 5 minutes.
(6) supernatant is transferred to cover and be put in the EZ-10 post in the 2.0ml collection tube, placed centrifugal 1 minute of 8000rpm room temperature two minutes.
(7) abandon waste liquid in the collection tube, centrifugal column is put into same collection tube, draw the 500ml rinsing liquid in centrifugal column, centrifugal 1 minute of 8,000rpm room temperature.
(8) repeat previous step.
(9) abandon waste liquid in the collection tube, centrifugal column is put into same collection tube, centrifugal 30 seconds of 10000rpm room temperature is with thorough removal rinsing liquid.
(10) centrifugal column is put into new clean 1.5ml centrifuge tube, added 50ml elution buffer (Elution Buffer), room temperature was placed after 2 minutes, centrifugal 1 minute of 10000rpm room temperature.Solution in the centrifuge tube is the plasmid DNA of institute's extracting.
4. 1% agarose gel electrophoresis detects purity and the content of plasmid.
(1) accurately takes by weighing agarose 0.5g and distilled water 49ml pours in the Erlenmeyer flask, add 1ml 50 * TAE and be mixed with 1% solution.
(2) in microwave oven, be heated to liquid boiling, take out Erlenmeyer flask and rock and drives bottom and sidewall bubble out of, again put back in the microwave oven and heat, three times like this, dissolve fully to agarose.
(3) solution room temperature in the Erlenmeyer flask is cooled to warm, splashes into an EB, rock mixing, solution is incarnadine.
(4) the comb insertion of suitable size is cleaned in the rubber moulding that dries, the solution that more than configures is slowly poured in this rubber moulding.Gel thicknesses is about between 3 to 5 mm, comb apart from plate at the bottom of 0.5-1.0 mm.
(5) after gel solidifies fully (about 30min) removes comb carefully.
(6) gel is put into electrophoresis chamber, add the 1 * TAE electrophoretic buffer that did not just have about 1 mm of glue face.
(7) sample is used micropipet with after required sample loading buffer mixes, and it is added in the sample cell.
(8) energising, 110 V stabilized voltages.Electrophoresis dyestuff tetrabromophenol sulfonphthalein is moved out of suitable distance in gel.
(9) cut off the electricity supply, take out gel.
(10) under ultraviolet lamp, check gel, and record the result with gel imaging system.
5. with NcoI and HindIII plasmid is carried out double digestion, system is as follows:
Plasmid: 3 μ l
NcoI (10U/ μl): 1μl
Hind III (10U/ μl): 1μl
10×k Buffer: 2μl
BSA： 1μl
ddH
2O: 12μl
Totally 20 μ l.
By above double digestion system preparation and centrifugal mixing, 37 ℃ of enzymes are cut and are spent the night.
6. the test kit gel reclaims enzyme and cuts product.
(1) enzyme cut in the product add 5 times of volumes in conjunction with liquid BD, abundant mixing.
(2) adsorption column is put into collection tube, with pipettor previous step gained solution is transferred in the adsorption column, centrifugal 30 seconds of 12000rpm room temperature is outwelled filtrate.
(3) will add 600 μ l rinsing liquid WB in the adsorption column, centrifugal 1 minute of 12000rpm room temperature is outwelled filtrate.
(4) with adsorption column in the 12000rpm room temperature centrifugal 2 minutes, remove residual rinsing liquid WB, the adsorption column room temperature was placed several minutes, thoroughly to dry rinsing liquid residual in the sorbing material.The residual purifying yield that can affect DNA of rinsing liquid WB.
(5) take out adsorption column, put into a new 1.5ml centrifuge tube, drip 7.5 μ l elutriant EB to the adsorption column middle portion, room temperature left standstill 1 minute.Centrifugal 1 minute eluted dna of 12000rpm room temperature repeats this operation once, solution in the collection tube.
Step 2: clone, the enzyme of 3 ' UTR sequence of VEGFA gene are cut and purifying.
3 ' UTR region sequence design two ends primer according to people's VEGFA gene:
Primer 1:5 '-CCC
AAGCTTCTCACCAGGAAAGACTGAT-3 '.
Primer 2: 5 '-CATG
CCATGGAACTCAAGTCCACAGCAGT-3 '.
Take genomic dna as template, utilize conventional PCR reaction to increase.
Reaction conditions is: at 95 ℃ of denaturation 3min, again at 95 ℃ of sex change 30s, then at 55 ℃ of annealing 45s, extend 1min at 72 ℃ again; Carry out 40 circulations, at 72 ℃ of final 5min that extend, it is rear in 4 ℃ of long-term heat preservations to have increased at last.
Reaction is got 5 μ l reaction product and is detected with 1.0% agarose gel electrophoresis after finishing; Get 100 μ l PCR products, agarose gel electrophoresis.The result as shown in Figure 1, the mark band (Marker) among the figure is DL5000,1-5 is VEGFA gene 3 ' UTR fragment (279bp).
Cut glue, reclaim test kit with gel and reclaim; With PCR product NcoI and the HindIII double digestion that reclaims.
It is as follows that enzyme is cut system:
The PCR product that reclaims: 15 μ l
NcoI (10U/ μl): 1μl
Hind III (10U/ μl): 1μl
10×k Buffer: 2μl
BSA： 1μl
Totally 20 μ l.
By above double digestion system preparation and centrifugal mixing, 37 ℃ of enzymes are cut and are spent the night.
Again reclaim in order to connecting and use.
Step 3: ligation.
To carry out ligation in the centrifuge tube of 0.2ml through pGL3-promoter carrier and VEGFA gene 3 ' UTR fragment of double digestion, 16 ℃ are spent the night.
Reaction system is as follows:
VEGFA gene 3 ' UTR enzyme cuts back to close product: 15 μ l
The pGL3-promoter enzyme cuts back to close product: 2 μ l
10×buffer: 2μl
T4 DNA ligase (5u/μl, Fermentas) : 1μl
Totally 20 μ l.
Step 4: screening recon.
Get 10 μ l and connect directly conversion 100 μ L competence intestinal bacteria of product.
Cultivate through selecting in the LB substratum that contains penbritin.10 bacterium colonies of picking immediately from the flat board of transformant, it is for subsequent use to extract on a small quantity plasmid with alkaline lysis after the amplification cultivation; Through enzyme cut, PCR, order-checking identify.
Wherein enzyme is cut referring to Fig. 2, and the mark band (Marker) among the figure is DL5000, and 1-5 is pGL3-VEGFA-3 ' UTR-promoter/HindIII+NcoI.The result shows, contains the sequence alignment that VEGFA gene 3 ' UTR fragment of insertion and sequencing result and gene pool (GENEBANK) are looked in the recombinant vectors, and referring to shown in Figure 3, discovery only has place's base mutation except the primer place is inconsistent, be reasonable sudden change.
The recombinant plasmid that contains VEGFA gene 3 ' UTR and reporter gene provided by the invention, by clone's blood vessel endothelium growth factor A(VEGFA) 3 ' nontranscribed domain of gene (3 ' UTR) specific sequence and restructuring in Photinus pyralis LUC Reporter gene vector initiating sequence, thereby makes up 3 ' UTR Reporter gene vector of VEGFA gene.This recombinant plasmid between the relevant microRNA of screening vasculogenesis, research vasculogenesis and microRNA the mechanism of action and the aspects such as mechanism of study tumor cell vasculogenesis splendid application prospect is just arranged.
Although content of the present invention has been done detailed introduction by above preferred embodiment, will be appreciated that above-mentioned description should not be considered to limitation of the present invention.After those skilled in the art have read foregoing, for multiple modification of the present invention with to substitute all will be apparent.Therefore, protection scope of the present invention should be limited to the appended claims.
＜110〉Putuo Affiliated Hospital Of Shanghai University Of Chinese Medicine
＜120〉a kind of recombinant plasmid that contains VEGFA gene 3 ' UTR and reporter gene
〈160〉2
〈210〉1
〈211〉28
〈212〉DNA
＜213〉artificial sequence
〈220〉
＜223〉the upstream primer sequence in 3 ' UTR district of pcr amplification people VEGFA gene
〈400〉1
CCCAAGCTTC TCACCAGGAA AGACTGAT 28
〈210〉2
〈211〉29
〈212〉DNA
＜213〉artificial sequence
〈220〉
＜223〉the downstream primer sequence in 3 ' UTR district of pcr amplification people VEGFA gene
〈400〉2
CATGCCATGG AACTCAAGTC CACAGCAGT 29
Claims (9)
1. a recombinant plasmid that contains VEGFA gene 3 ' UTR and reporter gene is characterized in that, described reporter gene is firefly luciferase gene.
2. the recombinant plasmid that contains VEGFA gene 3 ' UTR and reporter gene as claimed in claim 1 is characterized in that, the preparation method of described recombinant plasmid comprises:
Step 1 increases and extracting to vector plasmid;
Step 2, to 3 ' UTR sequence of VEGFA gene clone, enzyme is cut and purifying;
Step 3 is carried out 3 ' UTR sequence of described VEGFA gene and being connected of described vector plasmid;
Step 4, the screening recon.
3. the recombinant plasmid that contains VEGFA gene 3 ' UTR and reporter gene as claimed in claim 2 is characterized in that, described step 1 comprises:
Transform competent escherichia coli cell with described vector plasmid, increase; Then adopt the alkaline lysis extracting to prepare described vector plasmid, the purity of the described vector plasmid of electrophoresis detection and content; With NcoI and HindIII described vector plasmid is carried out enzyme again and cut, the test kit gel reclaims the enzyme of large fragment and cuts product.
4. the recombinant plasmid that contains VEGFA gene 3 ' UTR and reporter gene as claimed in claim 2 is characterized in that, described step 2 comprises:
Step 2.1, according to 3 ' UTR region sequence design two ends primer of people's VEGFA gene: primer 1 be upstream 5 ' end primer, wherein comprises 3 ' UTR complementary base of 19 VEGFA genes, and a HindIII recognition site is protected bases for 3; Primer 2 is downstream 3 ' end primer, wherein comprises 19 VEGFA gene 3 ' UTR complementary bases, a NcoI recognition site, 4 protection bases;
Step 2.2 take genomic dna as template, utilizes the PCR reaction to increase;
Step 2.3, reaction is got 5 μ l reaction product and is detected with agarose gel electrophoresis after finishing;
Step 2.4, product is answered in negate, behind the agarose gel electrophoresis, cuts glue, reclaims test kit with gel and reclaims;
Step 2.5, PCR product NcoI and HindIII double digestion with reclaiming again reclaim in order to connecting and use.
5. the recombinant plasmid that contains VEGFA gene 3 ' UTR and reporter gene as claimed in claim 4 is characterized in that, described primer 1 is:
5’- CCC
AAGCTTCTCACCAGGAAAGACTGAT-3’。
6. the recombinant plasmid that contains VEGFA gene 3 ' UTR and reporter gene as claimed in claim 4 is characterized in that, described primer 2 is:
5’- CATG
CCATGGAACTCAAGTCCACAGCAGT -3’。
7. the recombinant plasmid that contains VEGFA gene 3 ' UTR and reporter gene as claimed in claim 4, it is characterized in that the reaction conditions of described PCR reaction is: at 95 ℃ of denaturation 3min, again at 95 ℃ of sex change 30s, then at 55 ℃ of annealing 45s, extend 1min at 72 ℃ again; Carry out 40 circulations, at last at 72 ℃ of final 5min that extend, afterwards in 4 ℃ of insulations.
8. the recombinant plasmid that contains VEGFA gene 3 ' UTR and reporter gene as claimed in claim 2 is characterized in that, dna ligation kit is adopted in the connection of described step 3, carries out ligation.
9. the recombinant plasmid that contains VEGFA gene 3 ' UTR and reporter gene as claimed in claim 2 is characterized in that, described step 4 comprises:
Get and connect the direct transformed competence colibacillus intestinal bacteria of product; Cultivate through selecting in the LB substratum that contains penbritin; Picking colony at random from the culture plate, for subsequent use with the alkaline lysis method of extracting plasmid after the amplification cultivation; Enzyme is cut finally by crossing, PCR, order-checking identify.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012104611147A CN102899344A (en) | 2012-11-16 | 2012-11-16 | Recombinant plasmid containing VEGFA (Vascular Endothelial Growth Factor) gene 3'UTR (Untranslated Region) and reporter gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012104611147A CN102899344A (en) | 2012-11-16 | 2012-11-16 | Recombinant plasmid containing VEGFA (Vascular Endothelial Growth Factor) gene 3'UTR (Untranslated Region) and reporter gene |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102899344A true CN102899344A (en) | 2013-01-30 |
Family
ID=47571833
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2012104611147A Pending CN102899344A (en) | 2012-11-16 | 2012-11-16 | Recombinant plasmid containing VEGFA (Vascular Endothelial Growth Factor) gene 3'UTR (Untranslated Region) and reporter gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102899344A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103882055A (en) * | 2013-12-03 | 2014-06-25 | 杭州拜善晟生物科技有限公司 | Preparation and purification method of human epidermal growth factor |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101250552A (en) * | 2008-03-21 | 2008-08-27 | 厦门大学 | Reporter plasmid for tumor necrosis factor alpha gene as well as constructing method and use thereof |
| CN102492712A (en) * | 2011-12-23 | 2012-06-13 | 华东理工大学 | Recombinant plasmid containing MRP (Multidrug Resistance-associated Protein)-2 genes 3' UTR (Untranslated Region) and reporter genes and application thereof |
-
2012
- 2012-11-16 CN CN2012104611147A patent/CN102899344A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101250552A (en) * | 2008-03-21 | 2008-08-27 | 厦门大学 | Reporter plasmid for tumor necrosis factor alpha gene as well as constructing method and use thereof |
| CN102492712A (en) * | 2011-12-23 | 2012-06-13 | 华东理工大学 | Recombinant plasmid containing MRP (Multidrug Resistance-associated Protein)-2 genes 3' UTR (Untranslated Region) and reporter genes and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| TAKUYA AWATA ET AL.: "A Common Polymorphism in the 5"-Untranslated Region of the VEGF Gene Is Associated With Diabetic Retinopathy in Type 2 Diabetes", 《DIABETES》 * |
| ZHONG HUA ET AL.: "MiRNA-Directed Regulation of VEGF and Other Angiogenic Factors under Hypoxia", 《PLOS ONE》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103882055A (en) * | 2013-12-03 | 2014-06-25 | 杭州拜善晟生物科技有限公司 | Preparation and purification method of human epidermal growth factor |
| CN103882055B (en) * | 2013-12-03 | 2016-06-01 | 杭州拜善晟生物科技有限公司 | The preparation of a kind of human epidermal growth factor and purification process |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103382505B (en) | Luciferase reporter gene is utilized to detect the method for promoter activity | |
| CN1824774B (en) | Culturing method of auxilliary bud less tobacco after topping | |
| JP2020534021A (en) | Gene therapy DNA vector VTvaf17 and production method; Escherichia coli strain SCS110-AF and production method; Escherichia coli strain SCS110-AF / VTvaf17 carrying gene therapy DNA vector VTvaf17 and production method | |
| CN107974455A (en) | Rubber tree powdery mildew endogenesis promoter WY7 and application thereof | |
| CN107760681A (en) | Promoter WY195 and application thereof | |
| CN110878315B (en) | Bacterial effector factor and coding gene and application thereof | |
| CN109266650B (en) | Inducible promoter, recombinant vector and transformant thereof, method for inducing gene expression and application of inducible promoter | |
| CN107881172A (en) | A kind of adverse circumstance inducible promoter, adverse circumstance inducible promoter plant expression vector and induction target gene expression | |
| CN104342441B (en) | Plant non-endosperm expression promoter SAFE S1 and acquiring method thereof | |
| CN102899344A (en) | Recombinant plasmid containing VEGFA (Vascular Endothelial Growth Factor) gene 3'UTR (Untranslated Region) and reporter gene | |
| CN107937398A (en) | Sweet wormwood glandular hairs predominant expression AaTCP15 gene promoters and application | |
| CN106978418A (en) | The shRNA interference sequences of people's PYCR1 genes and its application | |
| CN107400663A (en) | The purple back of the body six hydroxyl oxygen transmethylases of yellow tongue fur ketone of blunt squama and its encoding gene and application | |
| CN102127545A (en) | Skeletal muscle specificity CKM (Creatine Kinase Muscle) promoter and applications thereof | |
| CN106497880A (en) | The mescenchymal stem cell of genetic modification and its method for producing BsAb antibody | |
| CN106467917B (en) | A kind of carrier construction method of strawberry ARF4 promoter fusion gus gene | |
| CN112494643B (en) | Porcine CSFV-PCV bivalent DNA vaccine and preparation method thereof | |
| CN111471715A (en) | Adenovirus vector and construction method and application thereof | |
| CN101955975A (en) | Construction of si RNA expression vector of tissue inhibitor of metalloproteinases (TIMPs) and application in treatment of cirrhosis | |
| CN102241756A (en) | High expression of tenebrio molitor antibacterial peptide TmAMP3m in escherichia coli and application of TmAMP3m | |
| CN113583953A (en) | Method for preparing cell over expressing exogenous gene | |
| CN109913448B (en) | Promoter pSSP2 specifically expressed in rice stamen and application thereof | |
| CN101851638A (en) | Cow fetus fibroblast cell containing Iprl macrophage metamerism expression vector | |
| CN114540354B (en) | Expression vector containing hot pickled mustard tuber IFL1 promoter fusion GUS gene and application thereof | |
| CN109997693A (en) | A kind of genetic transforming method of alfalfa |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20130130 |