CN106497880A - The mescenchymal stem cell of genetic modification and its method for producing BsAb antibody - Google Patents
The mescenchymal stem cell of genetic modification and its method for producing BsAb antibody Download PDFInfo
- Publication number
- CN106497880A CN106497880A CN201510561483.7A CN201510561483A CN106497880A CN 106497880 A CN106497880 A CN 106497880A CN 201510561483 A CN201510561483 A CN 201510561483A CN 106497880 A CN106497880 A CN 106497880A
- Authority
- CN
- China
- Prior art keywords
- stem cell
- mescenchymal stem
- anticd3
- genetic modification
- antibody
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/10—Cells modified by introduction of foreign genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P21/00—Preparation of peptides or proteins
- C12P21/02—Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione
Abstract
The invention provides a kind of mescenchymal stem cell of genetic modification and its method for producing bispecific single-chain antibody (BsAb antibody), the mescenchymal stem cell of described genetic modification is obtained from the non-virus carrier transfection mescenchymal stem cell for carrying bispecific single-chain antibody gene.The present invention also specifically provides the method for producing bispecific single-chain antibody by genetic modification mescenchymal stem cell.
Description
Technical field
The present invention is a kind of method with regard to mescenchymal stem cell of genetic modification and its for producing BsAb antibody, specifically
For, the present invention relates to the mescenchymal stem cell of genetic modification, its preparation method and pass through genetic modification mesenchyme
The method that stem cell produces bispecific single-chain antibody.
Background technology
In the immune system of human body, cytotoxic T lymphocyte (Cytotoxic T Lymphocyte, CTL) and kill
Property T cell (Cytokine induced killer) plays important role, and they have φt cell receptor (T cell
Receptor, TCR), can carry out specific recognition and combination to target antigens expressed cell, and secrete perforin and
Granzyme, so that kill cause of disease target cell.But, the lesion region such as cancerous cell often shows as antigen presentation defect, lacks
Few material such as immunoadhesin molecule and costimulatory moleculeses so that immunity of organism identification function " is lost ".In recent years, according to
According to gene recombination method build double targeting antibodies (Bispecificantibody, BsAb), can at the same with T cell and
Cancer cell specific antigen is combined, and activates T cell immunologic mechanism, realizes that " double targeting antibodies mediate T cells are again fixed
To anticarcinogenic effect effect " (Anticancer effectors of BsAb-Retargeting T cell).This BsAb antibody association
Help functional T cell to reposition pathological changes target spot, recover autoimmune function.
At present in clinical treatment, the BsAb antibody for being used mainly is produced by outer-gene engineering, through protein purification after
Injected by human vein, can only finally rely on blood circulation by BsAb antibody deliveries to target region.This method is obtained
BsAb antibody is inactivated and the Therapeutic Method somewhat expensive easily under temperature change；Meanwhile, BsAb antibody half lives
Shorter, the contact probability with target cell is therefore reduced, so that it cannot form preferable therapeutic effect.
On the other hand, application stem cell produces cytokine and the existing relevant report of albumen.At present, the base to stem cell
Because in method of modifying, major part all selects viral vector, such as slow viruss, adenoviruss, retrovirus.Viral vector turns
Although dye can improve the efficiency of stem cell gene modification, due to the safety issue of virus so that this method is present
Certain limitation, the such as requirement to operating environment are strict, and the such as possible random integration of infection restrovirus gene is to cell base
Because of group, so as to destroy cellular genome, carcinogenic risk is caused, moreover viral vector is applied to its transfection effect in animal body
Rate is not high, because body itself can start the mechanism of silencing virus function.Additionally, existing application stem cell enters
Albumen and functional factor molecular weight produced by the research method of row gene transfection generation cytokine and albumen is relatively
Low, and application ribonucleotides (RNA) such as mRNA is more common in as genophore.
Have not yet to see the similar report of the larger bispecific single-chain antibody of application stem cell production molecular weight.
Content of the invention
The main object of the present invention is that application mescenchymal stem cell creates bioactive carrier, there is provided a kind of genetic modification
Mescenchymal stem cell and preparation method thereof and the method for producing BsAb antibody, so as to further dry using mesenchyme
The biological characteristicses of cell are migrated to area for treatment, are secreted BsAb antibody by cell itself and then are improved immunization therapy effect
Really.
Mescenchymal stem cell (Mesenchymal Stem Cell, MSC) from stroma, possess Multidirectional Differentiation,
Immunomodulating and self replication more New function.Also, under extraneous factor effect, show to tend to damage and canceration disease
Become the directional migration ability (performance of going back to the nest) of tissue.The present invention, will by carrying out genetic modification to mescenchymal stem cell
" production plant " and targeting delivery system of the stem cell constructing into BsAb antibody, realize passing antibody by stem cell
Lesion region is delivered to, cellular immunotherapy (the Stem-cell Driven of the stem cell mediation for the such as disease such as cancer are completed
Cancer-targeted Immunotherapy).
On the one hand, the invention provides a kind of mescenchymal stem cell of genetic modification, which is using carrying BsAb antibody bases
Obtained from the non-virus carrier transfection mescenchymal stem cell of cause.The mescenchymal stem cell of the genetic modification effectively can divide
Secrete bispecific single-chain antibody.
According to specific embodiments of the present invention, in the present invention, the mescenchymal stem cell can derive from fat, umbilicuss
Band, Placenta Hominiss, bone marrow, endometrium or dental pulp etc..
According to specific embodiments of the present invention, in the present invention, it is to carry BsAb antibody using non-viral genoid carrier
Gene, these non-virus carriers can be selected from plasmid DNA (Plasmid DNA, hereinafter, abbreviated as DNA) or micro-loop
Plasmid DNA (Minicircle Plasmid DNA, hereinafter, abbreviated as MCDNA) etc..
According to specific embodiments of the present invention, in the present invention, the BsAb antibody can be selected from antiCD19 ×
antiCD3、antiCD20×antiCD3、antiEGFR×antiCD3、antiGPC3×antiCD3、antiEpCAM
×antiCD3、anticMet×antiCD3、antiEGFRvIII×antiCD3、antiIGF1R×antiCD3、
AntiCD44v6 × antiCD3 or antiPDL-1 × antiCD3 etc..Above-described sequence pattern is not limited to, same suitable
Sequence pattern for antiCD3 × anti " target spot ".
On the other hand, present invention also offers the preparation method of the mescenchymal stem cell of described genetic modification, the method
Including：
The non-virus carrier for carrying BsAb antibody genes is transfected to mescenchymal stem cell, is completed to mescenchymal stem cell
Genetic modification, obtains the mescenchymal stem cell of genetic modification.
According to specific embodiments of the present invention, in the present invention, be using chemical transfection reagent chemical transfection methods,
Or electroporation transfection method realizes the genetic modification for stem cell.Specifically, the chemical transfection reagent can be wrapped
Include：Lipofectamine (such as the Lipofectamine2000 transfection reagents of Invitrogen companies), polycation turn
Transfection reagent (such as polyethyleneimine, poly- amino ester, shitosan etc.), or inorganic nanoparticles transfection reagent, organic
Nano-particle transfection reagent or inorganic-organic hybrid nano-particle transfection reagent are (as magnetic nanoparticle, phosphate are received
Rice grain etc.).The electroporation transfection method can be conventional electroporation operational approach.
On the other hand, present invention also offers the mescenchymal stem cell of described genetic modification is used for producing in BsAb antibody
Application.
On the other hand, present invention also offers a kind of method for producing BsAb antibody, the method includes：
The mescenchymal stem cell of genetic modification of the present invention is cultivated with secreting, expressing bispecific single-chain antibody.Specifically
Ground, the condition of culture are 37 DEG C, 5%CO2Quiescent culture.Wherein preferred culture medium is containing 10% hyclone
DMEM/F12 culture medium.Using the method for the present invention, generally sustainable in culture 72-96 hours or in the longer time
Expression bispecific single-chain antibody, achieves the sustainable supply of BsAb to a certain extent.
According to specific embodiments of the present invention, the method for the production BsAb antibody of the present invention also includes that will carry BsAb resists
The non-virus carrier of body gene transfects the process for completing the genetic modification to mescenchymal stem cell to mescenchymal stem cell.Such as
Front described, can be using chemical transfection reagent chemical transfection methods or electroporation transfection method realize for dry thin
The genetic modification of born of the same parents.The chemical transfection reagent can include：Lipofectamine is (such as Invitrogen companies
Lipofectamine2000 transfection reagents), polycationic transfection reagent is (as polyethyleneimine, poly- amino ester, shell gather
Sugar etc.), or inorganic nanoparticles transfection reagent, organic nanometer granule transfection reagent or inorganic-organic hybrid nanometer
Granule transfection reagent (such as magnetic nanoparticle, phosphate nano granule etc.).The electroporation transfection method can be
Conventional electroporation operational approach.
According to the more specific embodiment of the present invention, the method for the production BsAb antibody of the present invention can be by the following method
In any one carry out：
Method one：Plasmid DNA with antibody expressing genes or 4 μ g of micro-loop MCDNA are added to appropriate
In opti-MEM culture medium, final volume is 100 μ l, stands 5min；While Lipofectamine2000 gene transfection agents
During (Invitrogen companies) 10 μ l are added to appropriate opti-MEM culture medium, final volume is 100 μ l, stands 5min
Afterwards, with pipettor by soft to plasmid solution and transfection reagent solution pressure-vaccum mixing up and down, room temperature is placed 30min, is made
Lipofectamine2000 genophore complex.By mescenchymal stem cell with every hole 5 × 105The density of individual/ml is inoculated in 6
(per hole 5 × 10 in orifice plate5Individual cell), with the DMEM/F12 culture medium cellar cultures containing 10% hyclone, cell
70% is fused to, opti-MEM culture medium 800ul/ hole is changed, and 200 μ l genophore complex are then added per hole.?
37 DEG C, 5%CO2Under the conditions of after incubation 4 hours, change liquid with containing the DMEM/F12 culture medium of 10% hyclone, continue
Culture.
Method two：Plasmid DNA with antibody expressing genes or 4 μ g of micro-loop MCDNA are added to appropriate
In opti-MEM culture medium, final volume is 100 μ l, stands 5min；Appropriate polycation nano particle is taken simultaneously,
Such as the modified polyethyleneimine (number of patent application 201310390436.1) of 6-caprolactone modification, opti-MEM is dissolved in
In culture medium, final volume is configured to Transfectam solutions for 100 μ l, after standing 5min, with pipettor by plasmid solution and
The soft pressure-vaccum mixing up and down of transfection reagent solution, room temperature are placed 30min, make nano-complex.People's umbilical cord is originated
Mescenchymal stem cell is with every hole 5 × 105The density of individual/ml is inoculated in 6 orifice plates (per hole 5 × 105Individual cell), with containing
The DMEM/F12 culture medium culturings of 10% hyclone, cell fusion are replaced by opti-MEM culture medium to 70%
800 μ l/ holes, then add 200 μ l nano-complexes per hole.In 37 DEG C, 5%CO2Under the conditions of incubation 4 hours after,
Liquid is changed with the DMEM/F12 culture medium containing 10% hyclone, continues culture.
Method three：By 18 μ l Supplement solution [P3Primary Cell 4D-NucleofectorTMX Kit, Lonza
Company] and 82 μ l NucleofectorTM solution [P3Primary Cell 4D-NucleofectorTMX Kit, Lonza company]
Fully mix, constitute electricity and turn liquid (100 μ l systems/electricity revolving cup)；Mescenchymal stem cell is digested with pancreatin so as to from culture
Split away off on ware wall, be centrifuged (1000rpm, 5min), supernatant discarded, turning liquid with 100 μ l electricity will be dry for mesenchyme thin
Born of the same parents suspend again so as to which density reaches 1 × 107Individual/ml；To in 100ul mescenchymal stem cell re-suspension liquids, 6 μ g are added to have anti-
The plasmid DNA or micro-loop MCDNA of body expressing gene, is gently mixed with liquid-transfering gun, cell is fully mixed with plasmid；
Mixed liquor is added in electric revolving cup, the AmaxaTM4D-NucleofectorTM nucleus produced using Lonza companies
Transfection instrument, choosing transfection instrument U-023 programs carries out electricity turn；After electricity turns to terminate, the cell culture fluid for preheating in advance is added
In electric revolving cup, 5min is stood, is gently suctioned out with suction pipe, is added in 6 porose disc culture dishs in 37 DEG C, 5%CO2Culture
Quiescent culture in case, was changed with the DMEM/F12 culture medium containing 10% hyclone after 24 hours, continued culture.
Using the method for the present invention, apply stem cell as BsAb antibody producing factory, can persistently divide within the long term
Secrete expression BsAb antibody.
In sum, in the present invention, the non-virus carrier for carrying BsAb antibody genes is mainly used, is turned by chemistry
Transfection reagent and electrotransfection method, complete the genetic modification to mescenchymal stem cell, by stem cell constructing into BsAb antibody
" production plant " and delivery system and excretory system, of the invention compared with the clinical application technique of existing BsAb, which has
Beneficial effect is mainly shown as：
(1) in existing clinical practice, BsAb antibody is mainly produced by genetic engineering, for preventing immune thermal source etc. poisonous
The harm of material must be injected in vivo after protein purification, and BsAb antibody is easily inactivated under temperature change and therefore increased
Preservation difficulty is added.And transfected stem cell can be noted by present invention application stem cell as BsAb antibody producing factory
Penetrate, reduce purification link；
(2) in clinical practice, BsAb antibody can only rely on blood circulation by BsAb antibody deliveries to target region, but existing
There are some researches show that the microenvironment of the focuses such as tumor is sufficiently complex, such as entity tumor often shows the internal high pressure in tumor, this
So that the antibody in body fluid is difficult to enter focal area.And the present invention using stem cell as BsAb antibody producing factory, profit
With active chemotactic homing migration behavior of the mescenchymal stem cell to focuses such as tumors, target area is reached, realize that BsAb resists
The delivering of body；
(3) BsAb antibody Half-life in vivo shorter (less than 12 hours), therefore reduces the contact probability with target cell,
So that it cannot form preferable therapeutic effect；And present invention application stem cell is used as BsAb antibody producing factory, can be with
(testing inspection 72-96 hours) continuous expression, achieves the sustainable supply of BsAb to a certain extent over a period to come；
(4) present invention has abandoned the viral vector of routine, has selected non-viral gene vector to repair completing stem cell gene
Decorations, solve the problems, such as vivo applications feasibility；
(5) innovatively used plasmid DNA and micro-loop MCDNA as the genophore of BsAb to dry thin in the present invention
Born of the same parents carry out genetic modification, and DNA plasmid and micro-loop MCDNA are stable in properties, and micro-loop MCDNA biological safety is high simultaneously
And continually and steadily can express；
(6) realize antibody-secreting by stem cell in the present invention, stem cell as " production plant " produce molecular weight compared with
Big bispecific single-chain antibody, biological effect persistently, mobilize substantial amounts of immunocyte to complete the immune attack to target,
And stem cell can go back to the nest to tumor or lesions position, so as to the cellular immunotherapy of stem cell mediation can be formed
(Stem-cell Driven Cancer-targeted Immunotherapy).
Description of the drawings
Schematic flow sheets of the Fig. 1 for technical scheme.
Fig. 2 is used carrier SZ63.pMC.ZY781.CMVmax.intron.bpA gene mappings in the embodiment of the present invention 1.
Fig. 3 is to obtain recombiant plasmid after transformation in the embodiment of the present invention 1
SZ66.pMC.ZY781.CMVmax.intron.CD20Bite.bpA gene mappings.
Fig. 4 is that supernatant is trained after Lipofectamine2000/ plasmid DNA is transfected 96 hours to people source umbilical cord mesenchymal stem cells
The western blot testing results of antiCD20 × antiCD3 BsAb antibody in foster base.
Fig. 5 is for umbilical cord mesenchymal stem cells, mesenchymal stem cells MSCs, application Lipofectamine2000 mediation matter
Grain DNA and micro-loop MCDNA carry out gene transfection, after transfection 96 hours, to antiCD20 in supernatant culture medium ×
The western blot testing results of antiCD3 BsAb antibody.
Specific embodiment
In order to be more clearly understood that the essence of the present invention, below by specific embodiment and coordinate accompanying drawing further specifically
The bright present invention, but the present invention is not therefore subject to any restriction.The experiment of unreceipted actual conditions in the following example
Method, is generally carried out according to the routine operation of art or according to the condition proposed by manufacturer.
Shown in Figure 1, in technical scheme, mainly use chemical reagent-gene transfection method or
It is electroporation transfection method, the non-virus carrier for carrying BsAb antibody genes is transfected to mescenchymal stem cell, base is obtained
Because of the mescenchymal stem cell that modifies, the mescenchymal stem cell for then cultivating described genetic modification is double special with secreting, expressing
Property single-chain antibody.
Embodiment 1, the mescenchymal stem cell for people's umbilical cord source carry out chemical reagent transfection
(1) Lipofectamine2000/DNA transfection composites are prepared
A, the preparation of the plasmid DNA containing antiCD20 × antiCD3 antibody expressing genes
In the present embodiment, first with molecular biology method by antiCD20 × antiCD3 gene orders (SEQ ID No.
1, the sequence is that transformation forms bispecific single-chain antibody sequence on the basis of humanization monoclonal antibody anti-CD20 sequences.
AntiCD20 sequences are derived from：GA101 (Obinutuzumab, Roche Roche), antiCD3 is derived partly from patent
US008076459) carrier S Z63.pMC.ZY781.CMVmax.intron.bpA. is cloned into (by Chinese Academy of Sciences Shenzhen
Advanced technology academy medicine institute gene is provided with cell therapy research department, its detailed spectrogram as shown in Fig. 2 sequence such as
Shown in SEQ ID No.2 (artificial sequence), wherein drug selectable marker is kanamycin Kanamycin), transformation
After obtain recombiant plasmid SZ66.pMC.ZY781.CMVmax.intron.CD20Bite.bpA (6880bp) such as Fig. 3, should
Recombiant plasmid is and contains antiCD20 × antiCD3 antibody expressing genes plasmid DNA antiCD20 × antiCD3 sequences
Row.Concrete preparation process is as follows：
Using upstream and downstream primer, wherein PCR primer sequence：(5 ' -3 ') positive：
GAGCTAGCGCTACCGGTCGCCACCATGGGATGGAGCTGTATC(SEQ ID No.3)；Instead
To：TGAGTCGACCTAATGATGATGGTGATGA (SEQ ID No.4) and contain objective gene sequence
Template (antiCD20 × antiCD3 sequences：SEQ ID No.1) a large amount of using PCR (polymerase chain reaction) technology
The gene order is expanded, and the genes of interest for obtaining higher degree is then reclaimed using TaKaRa glue reclaims kits；
Carrier S Z63.pMC.ZY781.CMVmax.intron.bpA and genes of interest are processed using double digestion method,
Enzyme action is carried out under the conditions of 37 DEG C, and restriction enzyme site is Nhe I and Sal I, using TaKaRa glue reclaim reagents after enzyme action
Box obtains the higher carrier segments of purity and genes of interest fragment through glue reclaim；Carrier segments and genes of interest after enzyme action
Sequence, carrier segments compare 1 with genes of interest fragment by the amount of material:3 mix, by TAKARA T4 under the conditions of 16 DEG C
Ligase connection carrier segments and genes of interest；Acquisition obtains cloning recombinant plasmids DNA；Connection is obtained clone's restructuring
Plasmid DNA is converted, and 10ul recombiant plasmid is gently added to competent escherichia coli cell, and soft mixing, in ice
Upper place then be placed in 42 DEG C within 30 minutes under the conditions of 90 seconds, then be placed in 5 minutes on ice, add 500ul LB cultures
Base is mixed, and is placed in 37 DEG C, expands 1 hour, be finally coated in the LB culture plates containing kanamycin under the conditions of 220rpm
On, it is placed in incubation time in 37 DEG C of incubators and is less than 16 hours；Then, picking monoclonal on LB culture plates,
According to plasmid extraction kit method, shake bacterium and expand and extract plasmid, obtain containing antiCD20 × antiCD3 antibody tables
Up to the plasmid DNA of gene, i.e., recombiant plasmid shown in Fig. 3
SZ66.pMC.ZY781.CMVmax.intron.CD20Bite.bpA(6880bp)；
B, the preparation for preparing Lipofectamine2000/DNA transfection composites
4 μ g of plasmid DNA with antiCD20 × antiCD3 antibody expressing genes are added to appropriate opti-MEM
In culture medium, final volume is 100 μ l, stands 5min；While Lipofectamine2000 gene transfection agent (Invitrogen
Company) during 10 μ l are added to appropriate opti-MEM culture medium, final volume is 100 μ l, after standing 5min, with shifting
Soft to plasmid solution and transfection reagent solution pressure-vaccum mixing up and down, room temperature are placed 30min, are made by liquid device
Lipofectamine2000/ plasmid dna complex compounds.
(2) for the chemical reagent transfection of the mescenchymal stem cell in people's umbilical cord source
The mescenchymal stem cell (offer of Shenzhen South Mountain hospital) in people's umbilical cord source is with every hole 5 × 105The density of individual/ml connects
Plant in 6 orifice plates (per hole 5 × 105Individual cell), routinely trained with the DMEM/F12 culture medium containing 10% hyclone
Support, cell fusion to 70%, change opti-MEM culture medium 800ul/ hole, then add per hole 200 μ l to contain
Lipofectamine2000/ plasmid dna complex compounds.In 37 DEG C, 5%CO2Under the conditions of incubation 4 hours after, with contain 10%
The DMEM/F12 culture medium of hyclone changes liquid, and continuation is cultivated and collects within 96 hours cell conditioned medium culture fluid, 4 DEG C,
10000rpm be centrifuged 5min, take supernatant be stored in -80 DEG C standby.
Negative control group is set simultaneously according to the method described above, and application contains eGFP (green fluorescent protein) expressing gene
PMAX plasmids (numbering PMAX-eGFP is purchased in Lonza companies) build Lipofectamine2000/DNA
Transfection composite, transfects to stem cell, the supernatant culture fluid composition of the cell gathered after 96 hours, carries out albumen
Identification.
(3) to the mescenchymal stem cell transfection BsAb for people's umbilical cord source, to albumen in the supernatant culture fluid of cell
Carry out western blot detections.Its step is as follows：
(A) PAGE gel is prepared, first preparative separation glue, after gelling is solid, prepares concentration glue, according to following
Formula is prepared：
10% separation gel：
Concentration glue：
(B) sample preparation and electrophoresis
Cell conditioned medium sample is taken out from -80 DEG C of refrigerators, after 4 DEG C melt, 100 μ l supernatants is taken, is added 25 μ 5 × SDS-loading of l
Buffer, after mixing, 100 DEG C are boiled 10min.Room temperature is cooled to, in loading to well.80-120V electrophoresis 90min.
(C) transferring film rear enclosed incubation antibody
After PVDF is with methanol activation 5min, glue and film is fixed in the standardised wet methods membrane-transferring device of bio-Rad, is turned
Membrane current is 300mA, transferring film time 1h.Transferring film is finished, and takes the film out washing 1min in TBST cleaning mixture, plus
1h is closed in entering to 5% defatted milk powder.After the completion of closing, washed with TBST 3 times, after each 5min, added
MonoclonalM2antibody(1:500, sigma-aldrich) one resists in 4 DEG C of overnight incubations.
Next day, anti-3 times, each 5min is washed with TBST, Goat anti-mouse-HRP (1 are added:3000, Abcam)
Two corresponding anti-solution, incubated at room 1h wash anti-5 times, each 5min with TBST.
(D) ECL methods detection albumen
500 μ l Thermo Pierce ECL Western Blotting Substrate development substrate add on film, with gel into
As instrument catches chemiluminescence band, 30s-2min is imaged.
Testing result is as shown in Figure 4.Application ANTI-FLAG antibody (purchasing in Sigma-Aldrich companies) is to egg
It is identified in vain.Positive controls (Psitive control) are antiCD20 × antiCD3 BsAb antibody standard substances；
Negative control group (PMAX-eGFP), its are that application is carried containing eGFP (green fluorescent protein) expressing gene
PMAX plasmids (are purchased in Lonza companies), are built Lipofectamine2000/DNA complex and are turned for stem cell
Dye, the Identification of Fusion Protein of cell culture supernatant.Wherein transfection procedure is same as Example 1；Experimental group is to have
The plasmid DNA construction of antiCD20 × antiCD3 expressing genes is into Lipofectamine2000/DNA transfection composites
Transfect for mescenchymal stem cell, the Identification of Fusion Protein of cell culture supernatant.As a result show the antiCD20 of stem cell expression
× antiCD3 BsAb antibody occurs in same pillar location with standard substance, it was demonstrated that transfect successfully, stem cell can be divided
Secrete antibody.
Embodiment 2, the mescenchymal stem cell for people's umbilical cord source carry out electrotransfection
By 18 μ l Supplement solution [P3Primary Cell 4D-NucleofectorTMX Kit, Lonza company] with
82 μ l NucleofectorTM solution [P3Primary Cell 4D-NucleofectorTMX Kit, Lonza company] fully mixed
Even, constitute electricity and turn liquid (100 μ l systems/electricity revolving cup)；Mescenchymal stem cell (offer of Shenzhen South Mountain hospital) is digested with pancreatin,
Which is split away off from culture dish wall, be centrifuged (1000rpm, 5min), supernatant discarded, turning liquid with 100 μ l electricity will
Mescenchymal stem cell is suspended again so as to which density reaches 1 × 107Individual/ml；Add in 100 μ l mescenchymal stem cell re-suspension liquids
Enter 6 μ g have antiCD20 × antiCD3-BsAb antibody expressing genes plasmid DNA plasmid (plasmid prepare referring to reality
Apply example 1), gently mixed with liquid-transfering gun, cell is fully mixed with plasmid；Mixed liquor is added in electric revolving cup, is made
The AmaxaTM4D-NucleofectorTM nucleus transfection instrument produced with Lonza companies, chooses transfection instrument U-023 programs
Carry out electricity to turn；After electricity turns to terminate, the cell culture fluid for preheating in advance is added in electric revolving cup, 5min is stood, is used suction pipe
Gently suction out, be added in 6 porose disc culture dishs in 37 DEG C, 5%CO2Quiescent culture in incubator, uses after 24 hours and contains 10%
The DMEM/F12 culture medium of hyclone is changed, and then adds the DMEM/F12 culture medium of 10% hyclone,
37 DEG C, 5%CO2Under the conditions of continue culture 96 hours (period does not carry out changing liquid), then collect cell conditioned medium culture fluid,
4 DEG C, 10000rpm is centrifuged 5min, and collecting supernatant culture fluid carries out Identification of Fusion Protein.Testing result is referring to Fig. 5.
Embodiment 3, the mescenchymal stem cell for people's umbilical cord source carry out nano-complex mediated transfection
By the plasmid DNA plasmid with antiCD20 × antiCD3 antibody expressing genes, (plasmid is prepared referring to embodiment
1), during 4 μ g are added to appropriate opti-MEM culture medium, final volume is 100 μ l, stands 5min；Take simultaneously appropriate
6-caprolactone modification modified polyethyleneimine (number of patent application 201310390436.1) be dissolved in opti-MEM training
In foster base, final volume is configured to Transfectam solutions for 100 μ l, after standing 5min, and is turned plasmid solution with pipettor
The soft pressure-vaccum mixing up and down of transfection reagent solution, room temperature are placed 30min, make plasmid DNA nano-complex.
The mescenchymal stem cell in people's umbilical cord source is with every hole 5 × 105The density of individual/ml is inoculated in 6 orifice plates (per hole 5 × 105
Individual cell), with the DMEM/F12 culture medium culturings containing 10% hyclone, cell fusion to 70%, change
Weiopti-MEM culture medium 800ul/ hole, then adds 200 μ l to contain plasmid DNA nano-complex per hole.37 DEG C,
5%CO2Under the conditions of after incubation 4 hours, change liquid with containing the DMEM/F12 culture medium of 10% hyclone, then 37 DEG C,
5%CO2, containing 10% hyclone DMEM/F12 culture medium continue culture 96 hours (period does not carry out changing liquid),
Cell conditioned medium culture fluid is then collected, 4 DEG C, 10000rpm is centrifuged 5min, collecting supernatant culture fluid carries out Identification of Fusion Protein.
Testing result is referring to Fig. 5.
Embodiment 4, carry out for mesenchymal stem cells MSCs minicircle dna (MCDNA) and plasmid DNA mediation
Gene is transfected
(1) Lipofectamine2000/MCDNA transfection composites are prepared
A, the preparation of the MCDNA containing antiCD20 × antiCD3 antibody expressing genes
The MCDNA containing antiCD20 × antiCD3 antibody expressing genes used in the present embodiment, is for containing
The plasmid DNA of antiCD20 × antiCD3 antibody expressing genes obtains carrying antiCD20 × antiCD3 through induction
The MCDNA of antibody expressing genes.Its concrete preparation process is as follows：
The escherichia coli of the plasmid DNA of antiCD20 × antiCD3 antibody expressing genes that conventional method is successfully built
(strain name DH5 α, Quan Shi King Company) plants the TB culture medium (containing 50 μ g/ml of kanamycin) for adding 2ml,
At 37 DEG C, concussion and cultivate under the conditions of 250rpm, to wherein 1ml bacterium solutions according to plasmid extraction kit side after 5 hours
Method carries out plasmid extraction；
The remaining escherichia coli liquid 100ul of above-mentioned plasmid DNA is added in the TB culture medium of 400ml (containing card
50 μ g/ml of that mycin), in 37 DEG C, under the conditions of 250rpm, concussion and cultivate is overnight less than 16 hours；
And backward 400ml is carried in the escherichia coli liquid of above-mentioned plasmid DNA and is added micro-loop induction mix reagent (400ml
Containing 1N NaOH, 20%Arabinose in LB culture medium, then it is placed in 32 DEG C, 250rpm referring specifically to table 1)
Under the conditions of vibration shake bacterium 5-8 hours；Bacterium solution is placed in 6000-rpm, 4 DEG C, is centrifuged 10 minutes, then using Qiagen
The big extraction reagent kit of plasmid extraction carries out plasmid extraction, finally obtains containing antiCD20 × antiCD3 antibody expressing genes
MCDNA.
Table 1, micro-loop induction mix reagent (ml)
The preparation of b, Lipofectamine2000/MCDNA transfection composite
Plasmid MCDNA4 μ g with antiCD20 × antiCD3 antibody expressing genes are added to appropriate
In opti-MEM culture medium, final volume is 100 μ l, stands 5min；Lipofectamine2000 genes transfection simultaneously
During 10 μ l of reagent (Invitrogen companies) are added to appropriate opti-MEM culture medium, final volume is 100 μ l, quiet
After putting 5min, with pipettor by soft to plasmid solution and transfection reagent solution pressure-vaccum mixing up and down, room temperature places 30min,
Make Lipofectamine2000/MCDNA transfection composites.
(2) chemical reagent for people source mesenchymal stem cells MSCs is transfected
People source mesenchymal stem cells MSCs (offer of Shenzhen South Mountain hospital) are with every hole 5 × 105The density of individual/ml is inoculated in 6
(per hole 5 × 10 in orifice plate5Individual cell), use the DMEM/F12 culture medium culturings containing 10% hyclone, cell to melt
70% is bonded to, opti-MEM culture medium 800ul/ hole is changed, then, adds per hole 200 μ l to contain
The complex of Lipofectamine2000/MCDNA.In 37 DEG C, 5%CO2Under the conditions of after incubation 4 hours, with containing
The DMEM/F12 culture medium of 10% hyclone changes liquid, continues 96 hours (period does not carry out changing liquid) of culture, then
Cell conditioned medium culture fluid is collected, 4 DEG C, 10000rpm is centrifuged 5min, collecting supernatant culture fluid carries out western blot inspections
Experiment is surveyed, testing result is referring to Fig. 5.
Shown in Figure 5, western blot testing results, application ANTI-FLAG antibody are identified to albumen.
The detection of Western bands, is respectively 1. positive controls antiCD20 × antiCD3 BsAb antibody standards from left to right
Product；2. Lipofectamine2000/DNA transfection composites are applied, is had for umbilical cord mesenchymal stem cells transfection
The plasmid DNA of antiCD20 × antiCD3 antibody expressing genes, antiCD20 × antiCD3 BsAb protein expressions are tied
Really；3. application Lipofectamine2000/MCDNA transfection composites have for mesenchymal stem cells MSCs transfection
The plasmid DNA of antiCD20 × antiCD3 antibody expressing genes, antiCD20 × antiCD3 BsAb protein expressions are tied
Really；4. application Lipofectamine2000/DNA transfection composites have for mesenchymal stem cells MSCs transfection
The plasmid DNA of antiCD20 × antiCD3 antibody expressing genes, in the cell conditioned medium culture fluid of detection in 96 hours
AntiCD20 × antiCD3 BsAb protein expression results；5. application nano DNA transfection composite is directed to medulla mesenchyma
Stem Cell Transfection has the plasmid DNA of antiCD20 × antiCD3 antibody expressing genes, on the cell of detection in 96 hours
AntiCD20 × antiCD3 BsAb protein expression results in clear culture fluid.As a result show the antiCD20 of stem cell expression
× antiCD3 BsAb antibody occurs in same pillar location with standard substance, and card DNA and MCDNA is in transfection examination
Transfect under agent and nanoparticle system successfully, stem cell can be with secretory antibody.
Finally it should be noted that：Above example only in order to technical scheme to be described, rather than a limitation；To the greatest extent
Pipe has been described in detail to the present invention with reference to the foregoing embodiments, it will be understood by those within the art that：Its
Still the technical scheme described in foregoing embodiments can be modified, or which part technical characteristic is carried out
Equivalent；And these modifications or replacement, do not make the essence of appropriate technical solution depart from various embodiments of the present invention skill
The spirit and scope of art scheme.
Claims (10)
1. a kind of mescenchymal stem cell of genetic modification, its are turned using the non-virus carrier for carrying BsAb antibody genes
Obtained from dye mescenchymal stem cell.
2. the mescenchymal stem cell of genetic modification according to claim 1, wherein, the mescenchymal stem cell comes
Come from synovial membrane, skeleton, muscle, lungs, liver, pancreas, fat, umbilical cord, Cord blood, Placenta Hominiss, bone marrow, son
Endometrium or dental pulp；And the mescenchymal stem cell including being converted into iPS technological guide adult cells.
3. the mescenchymal stem cell of genetic modification according to claim 1, wherein, the carrying BsAb antibody
The non-virus carrier of gene is selected from：Plasmid DNA, micro-loop plasmid DNA or ribonucleic acid carrier.
4. the mescenchymal stem cell of genetic modification according to claim 1, wherein, the BsAb antibody is selected from
antiCD19×antiCD3、antiCD20×antiCD3、antiEGFR×antiCD3、antiGPC3×antiCD3、
antiEpCAM×antiCD3、anticMet×antiCD3、antiEGFRvIII×antiCD3、antiIGF1R×
AntiCD3, antiCD44v6 × antiCD3 or antiPDL-1 × antiCD3.
5. the preparation method of the mescenchymal stem cell of the genetic modification described in any one of Claims 1 to 4, the method include：
The non-virus carrier for carrying BsAb antibody genes is transfected to mescenchymal stem cell, is completed to mescenchymal stem cell
Genetic modification, obtain the mescenchymal stem cell of genetic modification.
6. method according to claim 5, wherein, the transfection is the chemical transfection using chemical transfection reagent
Method or electroporation transfection method.
7. method according to claim 6, wherein, the chemical transfection reagent includes：Lipofectamine,
Polycationic transfection reagent, or inorganic nanoparticles transfection reagent, organic nanometer granule transfection reagent or inorganic have
Machine hybrid nanomaterial transfection reagent.
8. the mescenchymal stem cell of the genetic modification described in any one of Claims 1 to 4 is used for producing in BsAb antibody
Application.
9. a kind of method for producing BsAb antibody, the method include：
The mescenchymal stem cell of the genetic modification described in culture any one of Claims 1 to 4 is with secreting, expressing bispecific list
Chain antibody.
10. method according to claim 9, wherein, the condition of culture is：37 DEG C, 5%CO2Stand training
Support；Preferred culture medium is the DMEM/F12 culture medium containing 10% hyclone.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510561483.7A CN106497880A (en) | 2015-09-06 | 2015-09-06 | The mescenchymal stem cell of genetic modification and its method for producing BsAb antibody |
| PCT/CN2015/099177 WO2017036026A1 (en) | 2015-09-06 | 2015-12-28 | Genetically modified mesenchymal stem cell and bsab producing method by using same |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510561483.7A CN106497880A (en) | 2015-09-06 | 2015-09-06 | The mescenchymal stem cell of genetic modification and its method for producing BsAb antibody |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106497880A true CN106497880A (en) | 2017-03-15 |
Family
ID=58186408
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510561483.7A Pending CN106497880A (en) | 2015-09-06 | 2015-09-06 | The mescenchymal stem cell of genetic modification and its method for producing BsAb antibody |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN106497880A (en) |
| WO (1) | WO2017036026A1 (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108251454A (en) * | 2017-12-26 | 2018-07-06 | 温州医科大学附属第医院 | A kind of acquisition methods of lipoxygenase genetic modification mescenchymal stem cell and its application |
| CN112941028A (en) * | 2019-12-09 | 2021-06-11 | 上海细胞治疗集团有限公司 | Nano antibody gene modified mesenchymal stem cell and preparation method and application thereof |
| CN112980888A (en) * | 2021-02-22 | 2021-06-18 | 广州市第一人民医院（广州消化疾病中心、广州医科大学附属市一人民医院、华南理工大学附属第二医院） | Mesenchymal stem cell secreting IL-6 antibody/CD 20 antibody, construction method and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104651305A (en) * | 2015-02-13 | 2015-05-27 | 沈阳澔源生物科技有限公司 | Method for acquiring bioactive proteins by utilizing umbilical cord mesenchymal stem cells |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103191445B (en) * | 2013-04-19 | 2015-05-27 | 吉林大学 | Use of mesenchymal stem cell and preparation method thereof |
-
2015
- 2015-09-06 CN CN201510561483.7A patent/CN106497880A/en active Pending
- 2015-12-28 WO PCT/CN2015/099177 patent/WO2017036026A1/en active Application Filing
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104651305A (en) * | 2015-02-13 | 2015-05-27 | 沈阳澔源生物科技有限公司 | Method for acquiring bioactive proteins by utilizing umbilical cord mesenchymal stem cells |
Non-Patent Citations (3)
| Title |
|---|
| MARTA COMPTE 等: ""Tumor Immunotherapy Using Gene-Modified Human Mesenchymal Stem Cells Loaded into Synthetic Extracellular Matrix Scaffolds"", 《STEM CELLS》 * |
| RICHARD T. FRANK 等: ""Concise Review: Stem Cells As an Emerging Platform for Antibody Therapy of Cancer"", 《STEM CELLS》 * |
| 陈观贵 等: ""非病毒载体介导脑源性神经营养因子基因转染骨髓间充质干细胞:脂质体及电穿孔转染法的比较"", 《中国组织工程研究与临床康复》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108251454A (en) * | 2017-12-26 | 2018-07-06 | 温州医科大学附属第医院 | A kind of acquisition methods of lipoxygenase genetic modification mescenchymal stem cell and its application |
| CN112941028A (en) * | 2019-12-09 | 2021-06-11 | 上海细胞治疗集团有限公司 | Nano antibody gene modified mesenchymal stem cell and preparation method and application thereof |
| CN112980888A (en) * | 2021-02-22 | 2021-06-18 | 广州市第一人民医院（广州消化疾病中心、广州医科大学附属市一人民医院、华南理工大学附属第二医院） | Mesenchymal stem cell secreting IL-6 antibody/CD 20 antibody, construction method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2017036026A1 (en) | 2017-03-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP6755284B2 (en) | Adeno-associated virus vector targeting oligodendrocytes | |
| EA004928B1 (en) | Polypeptides increasing gene introduction efficiency into target cells by a retrovirus and genes encoding them | |
| CN105950541B (en) | A kind of construction method of hFGF21 gene knockout human liver cell strain | |
| CN104910278B (en) | A kind of slow virus with high-efficiency transfection ability and biological activity for being used to prepare CART cells | |
| CN104774270B (en) | A kind of gland cancer specificity EpCAM GM CSF gene recombinant fusion proteins and preparation method thereof | |
| CN107236762A (en) | A kind of method that minicircle dna transfecting T cells prepare clinical grade CAR T cell preparations | |
| CN109504660A (en) | A kind of forth generation CAR-T cell and its construction method and application | |
| CN106497880A (en) | The mescenchymal stem cell of genetic modification and its method for producing BsAb antibody | |
| WO2020259151A1 (en) | Preparation method and application of ctl cell | |
| EA012520B1 (en) | Process for producing cytotoxic lymphocytes | |
| CN100588430C (en) | SARS-Cov gene vaccine based on epi-position and its contruction | |
| CN110358737A (en) | A method of Chimeric antigen receptor T lymphocyte is prepared using excretion body | |
| CN103360497A (en) | Novel antitumor fusion protein vaccine, and preparation method and application thereof | |
| CN105925544A (en) | Preparation method and application of 4-1BB-containing lentivirus | |
| US20230193256A1 (en) | System and method for gene editing by using engineered cell | |
| CN113226336A (en) | Method for delivering gene in cell | |
| CN102660579B (en) | HBx and human IL-12 double-gene recombinant vector and liver caner-resistant vaccine | |
| CN110331132A (en) | A method of external extensive induced NK cell amplification | |
| CN115737841A (en) | Gene nano-medicament for enhancing anti-tumor immune effect of T cells and preparation method and application thereof | |
| CN111117967A (en) | Method for preparing cell over expressing exogenous gene | |
| CN113388586A (en) | Oncolytic virus NDV-NRP1 and construction method and application thereof | |
| CN103497926B (en) | The recombinant BCG viable bacteria bacterial strain of expression-secretion mankind p53 albumen, live bacterial vaccines and construction process thereof and application | |
| CN113583953A (en) | Method for preparing cell over expressing exogenous gene | |
| CN105779480A (en) | Recombinant adeno-associated virus carrier carrying multi-site mutant EGFR (Epidermal Growth Factor Receptor) novel antigenic gene as well as construction method and application of recombinant adeno-associated virus carrier | |
| Fath-Bayati et al. | Tracking of intraperitoneally and direct intrahepatic administered mesenchymal stem cells expressing miR-146a-5p in mice hepatic tissue |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170315 |
|
| RJ01 | Rejection of invention patent application after publication |