CN106978418A - The shRNA interference sequences of people's PYCR1 genes and its application - Google Patents
The shRNA interference sequences of people's PYCR1 genes and its application Download PDFInfo
- Publication number
- CN106978418A CN106978418A CN201710067075.5A CN201710067075A CN106978418A CN 106978418 A CN106978418 A CN 106978418A CN 201710067075 A CN201710067075 A CN 201710067075A CN 106978418 A CN106978418 A CN 106978418A
- Authority
- CN
- China
- Prior art keywords
- pycr1
- people
- genes
- cell
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/713—Double-stranded nucleic acids or oligonucleotides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
- C12N2310/141—MicroRNAs, miRNAs
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
- C12N2740/15041—Use of virus, viral particle or viral elements as a vector
- C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Virology (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses the purposes of people's PYCR1 genes and its related related drugs.The invention discloses purposes of the people PYCR1 genes in oncotherapy, diagnosing tumor and medicine preparation.The present invention also further constructs people's PYCR1 genes small molecules interference RNA, people's PYCR1 gene RNAs construct, people PYCR1 genes interference slow virus, and discloses their purposes.The siRNA that the present invention is provided or the nucleic acid construct comprising the siRNA sequence, slow virus are capable of the expression of specificity suppression people's PYCR1 genes, especially slow virus, target cell can efficiently be infected, high efficiency suppresses the expression of PYCR1 genes in target cell, and then suppress the growth of tumour cell, promote apoptosis of tumor cells, it is significant in oncotherapy.
Description
Technical field
The invention belongs to field of biological medicine, and in particular to a kind of shRNA interference sequences of people PYCR1 genes and its should
With.
Background technology
With human lives be accustomed to and behavior pattern change, and the environmental pollution that brings of agro-industry evolution and people
The reasons such as mouth aging, malignant tumour turns into the lethal principal disease of the mankind.IARC of the World Health Organization
(IARC/WHO) latest data shows that the incidence of disease of the malignant tumour in the whole world is in rising trend, and 7,600,000 people die from evil within 2008
Property tumour, wherein 64% occur in developing country.In China, the situation that treatment and prevention of tumour faces is also extremely severe, newest report
It has been shown that, between Past 30 Years, the morbidity and mortality of China's malignant tumour are in obvious ascendant trend;It was predicted that in future
Between 20-30, the trend that China's Cancer Mortality and the death rate constantly rise will be continued to.Therefore, tumour is ground
It is one of lasting study hotspot of life science and medical domain to study carefully.
The limitation of malignant tumour traditional remedies such as radiotherapy, chemotherapy and operative treatment promotes people to find new antitumor side
Method.With going deep into tumor development molecular mechanism understanding, people have appreciated that tumour is a kind of genopathy, correct and occur
The gene of defect can provide new hope for the treatment of tumour.Many gene therapy methods for being directed to tumour are developed in recent years
Research, but the clinical efficacy so far into several genomic medicines of clinical practice is limited, and with potential, long-term
, the side effect of delay, therefore, seek the novel targets for the treatment of and develop new gene therapy method to turn into domestic and international tumour base
Because of the research direction for the treatment of.
RNA interference (RNA interference, RNAi) is a Gene silence, is a kind of double-stranded RNA
(double-stranded RNA, dsRNA) molecule blocks the expression of specific gene in mRNA level in-site or makes the mistake of its silence
The PTGS (Post-transcriptional gene silencing, PTGS) of journey, i.e. sequence-specific.Closely
Nian Lai, RNAi turn into the available strategy of therapy of tumor.It can suppress proto-oncogene, the suppression being mutated using RNAi technology
Oncogene, Cell cycle-related genes, anti-apoptotic related gene etc. express to suppress the occurrence and development of tumour.
PYCR1 is located at No. 17 chromosomes, and coding pyrrolin -5 carboxylate reductase 1 belongs to the carboxylate reductase man of pyrrolin -5
Race, its major function is that the carboxylic acid of pyrrolin -5 is reduced into proline, and PYCR1 is widely present in eucaryote, adjusts cell
Interior signal transduction, and then a variety of extracellular stimulations are responded.
Multiple members of PYCR families are related to cancer generation development, and PYCR1 genes are considered as and age and/or aging
Relevant gene, such as its in treatment as by genetic modification or modified it in animal in cutis laxa, wrinkly skin syndrome disease
Internal expression carried out research, but only showed the tendency of experimental level.
The content of the invention
The invention discloses the purposes of people's PYCR1 genes and its related related drugs.The invention discloses people's PYCR1 bases
Because of the purposes in oncotherapy, diagnosing tumor and medicine preparation.The present invention also further constructs people's PYCR1 gene small molecules
RNA interfering, people's PYCR1 gene RNAs construct, people PYCR1 genes interference slow virus, and disclose their purposes.
The siRNA that the present invention is provided or the nucleic acid construct comprising the siRNA sequence, slow virus being capable of specificity suppression people's PYCR1 bases
The expression of cause, especially slow virus, can efficiently infect target cell, and high efficiency suppresses the expression of PYCR1 genes in target cell, entered
And suppress the growth of tumour cell, and promote apoptosis of tumor cells, it is significant in oncotherapy.
Therefore, the first object of the present invention is to provide a kind of shRNA interference sequences of people PYCR1 genes, including
DNAoligo positive strand sequences and anti-chain sequence, wherein, the positive strand sequence is:
5’-CCGGCACAGTTTCTGCTCTCAGGAACTCGAGTTCCTGAGAGCAG AAACTGTGTTTTTG-3’(SEQ
ID NO1);
The anti-chain sequence is:
5’-AATTCAAAAACACAGTTTCTGCTCTCAGGAACTCGAGTTCCTGA GAGCAGAAACTGTG-3’(SEQ
ID NO2)。
Preferably, in the shRNA interference sequences of people PYCR1 genes of the present invention, the DNA oligo normal chain sequences
Row include siRNA target sequences with anti-chain sequence:
5’-CAGTTTCTGCTCTCAGGAA-3’(SEQ ID NO3)。
Present invention also offers a kind of shRNA slow virus carriers of people PYCR1 genes, the people PYCR1 genes
ShRNA slow virus carriers are for the siRNA target sequences of people's PYCR1 genes:
5’-CAGTTTCTGCTCTCAGGAA-3’。
Another object of the present invention also resides in a kind of people PYCR1 gene siRNAs of offer, wherein, encode the people PYCR1 bases
Because the siRNA siRNA target sequences for including being directed to people's PYCR1 genes are:
5’-CAGTTTCTGCTCTCAGGAA-3’。
A further object of the present invention also resides in offer people's PYCR1 gene siRNA nucleic acid carriers, wherein the people PYCR1 bases
Because the siRNA target sequences that siRNA nucleic acid carriers include being directed to people's PYCR1 genes are:
5’-CAGTTTCTGCTCTCAGGAA-3’。
Preferably, in people PYCR1 gene siRNA nucleic acid carriers of the present invention, the people PYCR1 gene siRNAs
Nucleic acid carrier is SEQ ID NO4:
5’-GTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTG
AAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACA
CCGGCACAGTTTCTGCTCTCAGGAACTCGAGTTCCTGAGAGCAGAAACT
GTGTTTTTGAATTCTCGACCTCGAGACAAATGGCAGTATTCATCCACGAA
TTCGGATCCATTAGGCGGCCGCGTGGATAACCGTATTACCGCCATGCATT
AGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATG
GAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGC
CCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTA
ACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTA
AACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCC
CTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTAC
ATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATC GCTATTACCA-3’。
It is including following another aspect of the invention is the construction method that slow virus is disturbed there is provided a kind of people PYCR1 genes
Step:
1) synthesis is for the DNAoligo normal chains and anti-chain of the RNA interfered target sequences of people's PYCR1 genes, the normal chain sequence
It is classified as:
5’-CCGGCACAGTTTCTGCTCTCAGGAACTCGAGTTCCTGAGAGCAG AAACTGTGTTTTTG-3’;
The anti-chain sequence is:
5’-AATTCAAAAACACAGTTTCTGCTCTCAGGAACTCGAGTTCCTGA GAGCAGAAACTGTG-3’;
2) double-stranded DNA of positive strand sequence and anti-chain the sequence anneals formation with cohesive end;
3) vector linearization being made by digestion, makes linearized vector and step 1) obtained double-stranded DNA is connected;
4) connection product is converted into competent escherichia coli cell, performing PCR identification is entered to obtained positive colony;
5) plasmid extraction, virus packaging.
Preferably, the present inventor PYCR1 genes interference slow virus construction method in, the step 3) in endonuclease reaction
To add AgeI and EcoRI double digestions.
Preferably, in the construction method of the present inventor PYCR1 genes interference slow virus, the step 4) connection product turn
Change competent escherichia coli cell specific method be:
Connection product is added in competent escherichia coli cell, ice bath;Heat shock, ice bath;Add the LB of antibiotic-free
Fluid nutrient medium, shaking table concussion and cultivate;Bacterium solution is taken uniformly to be applied on the LB solid mediums containing Amp, in 37 DEG C of incubators
Middle incubated overnight;Positive colony enters in performing PCR qualification process
What is used identifies primer for identification primer-F:5’-CCTATTTCCCATGATTCCTTCATA -3’(SEQ ID
) and identification primer-R NO5:5 '-GTAATACGGTTATCCACGCG-3 ' (SEQ ID NO6), detailed process is:Picking single bacterium colony
Enter performing PCR amplification, electrophoresis, sequencing.
Built present invention also offers the shRNA interference sequences of above-mentioned people PYCR1 genes, people's PYCR1 genes RNA
Body, people PYCR1 genes interference slow virus are preparing the growth of suppression tumour cell, promote apoptosis of tumor cells, prevent or treat
Application in the medicine of tumour.
From subsequent embodiment upper and of the present invention, method of the invention and the sequence of offer, carrier and slow virus are extremely
Rare advantages below:
PYCR1 genes are typically considered the gene relevant with age and/or aging, such as its treatment as cutis laxa,
By genetic modification or modify its expression in animal body in the diseases such as wrinkly skin syndrome and carried out research, and only show
The tendency of experimental level, does not embody the effect for suppressing related gene expression in cellular level.Secondly, PYCR1 genes
RNAi suppressing methods are influenceed in cellular level by multilevel factor, in particular how select for people's PYCR1 genes
SiRNA target sequences, how application lentivirus mediated RNAi methods realize suppress related gene expression all the time for puzzlement
The Major Difficulties of related researcher.
And present inventors discovered unexpectedly that, using specific siRNA target sequences for people's PYCR1 genes,
And the RNAi methods of suitable carrier and suitably lentivirus mediated, in expression of the reduction PYCR1 genes in tumour cell
Afterwards, the propagation of tumour cell can effectively be suppressed.The study show that, PYCR1 genes are a proto-oncogenes, can promote tumour
Cell breed, in tumour occurrence and development have important biological function, PYCR1 genes can as oncotherapy target
Mark, the PYCR1 gene specifics silence of lentivirus mediated can as oncotherapy a kind of new tool.
Brief description of the drawings
Fig. 1 is one embodiment of the invention linear carrier restriction enzyme digestion and electrophoresis figure;
Fig. 2 is rna interference vector structure and positive clone identification schematic diagram in one embodiment of the invention;
Fig. 3 is one embodiment of the invention positive clone identification restriction enzyme digestion and electrophoresis figure;
Fig. 4 is linear carrier GV115 collection of illustrative plates figures in one embodiment of the invention;
Fig. 5 infects human liver cancer BEL-7404 cells after 3 days for PYCR1-RNAi slow virus in one embodiment of the invention,
PYCR1mRNA expression block diagrams;
Fig. 6 infects human liver cancer SMMC-7721 cells after 3 days for PYCR1-RNAi slow virus in one embodiment of the invention,
PYCR1mRNA expression block diagrams;
Fig. 7 infects human liver cancer BEL-7404 cells after 5 days for PYCR1-RNAi slow virus in one embodiment of the invention,
Cause cell inhibitory effect figure;
Fig. 8 infects human liver cancer SMMC-7721 cells after 5 days for PYCR1-RNAi slow virus in one embodiment of the invention,
Cause cell inhibitory effect figure;
Fig. 9 is infected after human liver cancer BEL-7404 cells for PYCR1-RNAi slow virus in one embodiment of the invention, cell
Clonality declines signal block diagram;
Figure 10 is infected after human hepatocarcinoma BEL-7402 for PYCR1-RNAi slow virus in one embodiment of the invention, carefully
Born of the same parents' clonality declines signal block diagram;
Figure 11 is infected after human liver cancer BEL-7404 cells for PYCR1-RNAi slow virus in one embodiment of the invention, is promoted
Enter Apoptosis signal block diagram;
Figure 12 is infected after human liver cancer BEL-7404 cells for PYCR1-RNAi slow virus in one embodiment of the invention, is promoted
Enter Apoptosis signal block diagram.
Embodiment
Further technical scheme is illustrated below by way of specific embodiment, it should be understood that be only this hair below
Bright exemplary illustration, is not intended to limit the invention scope of the claims.
Embodiment 1:For the preparation of people PYCR1 gene RNAi slow virus
1RNA disturbance target points are designed and prepared by double-stranded DNA oligo
(1) effective siRNA target spot of the design synthesis for people's PYCR1 genes
PYCR1 (NM_153824) gene information is transferred from Genbank;Effective siRNA of the design for PYCR1 genes
Target spot.Table 1 is effective siRNA target sequences for PYCR1 genes.
Table 1 targets effective siRNA target sequences of people's PYCR1 genes
(2)) DNA oligo sequent synthesis
According to having selected target sequence to design shRNA interference sequences, and suitable digestion with restriction enzyme is added at two ends
Site is to complete vector construction.In addition, in the end of normal chain 3 ' addition TTTTT termination signals, and the addition of the end of anti-chain 5 ' terminates letter
Number complementary series.Synthesizing single-stranded DNA oligo.
Single DNA Oligo of two ends I containing Age and EcoR the I restriction enzyme site cohesive ends of table 2
* CCGG:AgeI restriction enzyme sites;AATTC:EcoRI restriction enzyme sites;G:EcoRI restriction enzyme site complementary series.
(3) prepared by double-stranded DNA oligo
The single stranded DNA oligo dry powder of synthesis is dissolved in annealing buffer (20 μM of final concentration), 90 DEG C of water-baths
15min.Naturally cool to after room temperature, form the double-strand with cohesive end.
(4) prepared by linearized vector
50 μ l reaction systems are prepared according to NEB specifications, using AgeI and EcoRI double digestion GV115 carriers (such as Fig. 4 institutes
Show) linearize it.
Reaction system
37 DEG C (optimum temperature) reacts 1h, afterwards gel extraction purpose fragment.
As shown in figure 1, swimming lane 1:1kb Marker:10kb, 8kb, 6kb, 5kb, 4kb, 3.5kb are followed successively by from top to bottom,
3kb, 2.5kb, 2kb, 1.5kb, 1kb, 750bp, 500bp, 250bp;
Swimming lane 2:Vector plasmid after the linearisation of Age I and EcoR I double digestions;
Swimming lane 3:There is no the vector plasmid of digestion, electrophoresis result illustrates that linearized vector is successfully constructed.
2RNA interference slow virus carriers are built
(1) connect
20 μ l reaction systems are prepared according to Fermentas T4DNA Ligase specifications, by double-stranded DNA oligo and line
Property carrier be connected.
1h-3h is reacted in 16 DEG C, connection product is named as psc45562, transformation experiment is carried out afterwards.
(2) convert
Connection product is converted into competent escherichia coli cell, Detailed operating procedures are as follows:
1) 10 μ l connection products psc45562 are added in 100 μ l competent escherichia coli cells, ice bath 30min.
2) 42 DEG C of heat shock 90sec, ice bath 2min.
3) the LB fluid nutrient mediums of 500 μ L antibiotic-frees are added, 200rpm is in 37 DEG C of shaking table concussion and cultivate 1hr.
4) take 150 μ l bacterium solutions to be uniformly applied on the LB solid mediums containing Amp, trained overnight in 37 DEG C of incubators
Support.
(3) the PCR identifications of positive colony
1. rna interference vector is built and positive clone identification
As shown in Fig. 2 multiple cloning sites carrier (MCS) is cut to linear carrier by double enzymes (AgeI and EcoRI), pass through
It is connected by T4DNAligase with dsDNA, and connection product is converted into competent escherichia coli cell, cultivates laggard performing PCR amplification
With identification positive colony.
2. primer
3. PCR is expanded
According to the form below prepares 20 μ l PCR reaction systems, is template with sterile pipette tips picking single bacterium colony, enters performing PCR amplification,
Reaction condition is:94℃3min;94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 30s, 22 circulations;72℃5min.After PCR terminates, 5 μ l are taken
Product, 1% agarose gel electrophoresis test strip.
4. electrophoresis loading explanation
As shown in figure 3, swimming lane 1:Negative control (ddH2O), external source pollution of nucleic acid causes false positive results in removal system;
Swimming lane 2:From even control (empty carrier connects control group certainly);Swimming lane 3:250bp Marker:5kb, 3kb are followed successively by from top to bottom,
2kb, 1.5kb, 1kb, 750bp, 500bp, 250bp, 100bp;Swimming lane 4-8:Monoclonal psc45562-1,2,3,4,5, as a result say
It is bright:The nonvisualization of swimming lane 1, illustrates system pollution of nucleic acid;The empty carrier clone PCR clip size not connected into shRNA fragments is:
307bp (swimming lane 2).The positive colony PCR fragment size connected into shRNA fragments is:380bp (swimming lane 4-8), thus judges
Psc45562-1,2,3,4,5 be positive colony, preserves qualification result and correctly clones, and is sequenced.
(4) positive colony sequencing interpretation of result
To identify that primer-F carries out positive colony sequencing, selecting the sequencing result clone completely the same with target sequence is used for
Next step is tested.
Psc45562 sequencing results:
GTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGA
AAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACAC
CGGCACAGTTTCTGCTCTCAGGAACTCGAGTTCCTGAGAGCAGAAACT
GTGTTTTTGAATTCTCGACCTCGAGACAAATGGCAGTATTCATCCACGAA
TTCGGATCCATTAGGCGGCCGCGTGGATAACCGTATTACCGCCATGCATT
AGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATG
GAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGC
CCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTA
ACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTA
AACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCC
CTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTAC
ATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATC GCTATTACCA
* shRNA interference sequences Insert Fragment is marked with red font, and wherein AgeI restriction enzyme sites are destroyed.
3 plasmid extractions
Correct bacterium solution will be sequenced to transfer in the LB fluid nutrient mediums of 150ml antibiotic containing Amp, 37 DEG C of shaking table concussion trainings
Support overnight.Plasmid is extracted according to EndoFree Maxi PlasmidKit specifications, the qualified plasmid of quality inspection enters down stream train.
Detailed operating procedures are as follows:
1.8000rpm centrifuging 4min collects thalline.
2. adding 7ml P1, concussion is mixed;
3. adding 7ml P3, overturn and mix 6~8 times, stand 5min;
4. adding 7ml P4, overturn and mix 6~8 times, ice bath 10min;
5.9000rpm centrifuges 10min, and supernatant is transferred in filter CS, and 10ml isopropanols are added after filtering and are mixed;
6. adding 2.5ml equilibrium liquid BL, 8000rpm centrifugation 2min into adsorption column, the waste liquid in collecting pipe is outwelled, will
Pillar is put back to standby;
7. supernatant is poured into adsorption column in two times, 8000rpm centrifugation 2min abandon waste liquid;
8. adding 10ml rinsing liquids PW (having added absolute ethyl alcohol) into adsorption column, same rotational speed centrifugation 2min abandons useless
Liquid, repeats the step once;
10. adding 3ml absolute ethyl alcohols into adsorption column, 8000rpm centrifugation 2min abandon waste liquid;
11.9500rpm skies get rid of 5min, remove the rinsing liquid of residual;
Adsorption column is transferred to a new Bai Guanzhong, 800 μ l elution buffers TB (first preheating), room temperature are added dropwise at post center
5min is placed, then 9500rpm centrifuges 2min;
12. the eluent in pipe is transferred in a clean 1.5mlEP pipes, -20 DEG C of preservations;
13. sampling electrophoresis, plasmid concentration, quality inspection are determined using spectrophotometer (Thermo_Nanodrop 2000).
14. the qualified plasmid of quality inspection is subjected to viral packaging.
4 slow virus are packed
Human embryonic kidney cells 293T, the incasing cells of slow virus, be anchorage dependence type into epithelioid cell, growth medium is
DMEM (contains 10%FBS), and attached cell is through cultivating growing multiplication formation cell monolayer.Coli strain DH5 α, for expanding
Slow virus carrier and auxiliary package carrier plasmid.
Three kinds of DNAs in RNAi plasmids, slow virus packaging system are extracted with the plasmid extraction kit of Qiagen companies
(GV vector plasmids, the vector plasmids of pHelper 1.0, pHelper2.0 vector plasmids), is configured to 100ng/ul storing liquids.
24h before transfection, with the 293T cells of Trypsin Induced exponential phase, to be adjusted containing the culture medium of 10% serum
Cell density about 5x 106Cell/15ml, is re-seeded into 10cm Tissue Culture Dish, 37 DEG C, the interior culture of 5%CO2 incubators.
24h can be used to transfection when cell density is up to 70%~80%;2h is replaced by serum free medium before transfection;To one sterilize from
Prepared each DNA solution (the μ g of GV vector plasmids 20, pHelper 1.0 vector plasmid 15 μ g, pHelper is added in heart pipe
μ g of 2.0 vector plasmid 10), the transfection reagent of respective volume is not well mixed, and adjustment cumulative volume is 1ml, is incubated at room temperature
15min;Mixed liquor is slowly added dropwise into 293T cell culture fluids, is mixed, and is cultivated in 37 DEG C, 5%CO2 cell culture incubators;Training
Support and the culture medium containing transfection mixture is discarded after 6h, the PBS liquid cleaning for adding 10ml once, softly rocks culture dish to wash
Abandoned after the transfection mixture for washing remnants;The cell culture medium 20ml containing 10% serum is slowly added to, is trained in 37 DEG C, 5%CO2
Support and continue to cultivate 48-72h in case.
Slow virus concentrates and purifying:According to cell state, the 293T for collecting 48h after transfection (transfection can be calculated as 0h) is thin
Born of the same parents' supernatant;In 4 DEG C, 4000g centrifugation 10min, cell fragment is removed;Exceeded the speed limit with 0.45 μm of filter filtering supernatant in 40ml
In centrifuge tube;Trim sample, the ultracentrifugation pipe with vial supernatant is put into Beckman ultracentrifuges one by one respectively
Interior, setting parameter of noncentricity is 25000rpm, and centrifugation time is 2h, and centrifuging temperature is controlled at 4 DEG C;After centrifugation terminates, supernatant discarding,
The liquid remained on tube wall is removed as far as possible, is added virus and is preserved liquid (can guard against cell culture medium with PBS to substitute), gently blows repeatedly
Beat and be resuspended;After fully dissolving, after high speed centrifugation 10000rpm, 5min, supernatant is taken to dispense.
Embodiment 2RT-PCR detects the silence efficiency of PYCR1 genes
Human liver cancer BEL-7404, SMMC-7721 cell in exponential phase carries out pancreatin digestion, and cell suspension is made
(cell number is about 5 × 104/ ml) 6 orifice plates are inoculated in, culture to cell fusion degree reaches about 30%.Add appropriate embodiment 1
The virus of preparation, culture changes culture medium after 6 hours, after time of infection reaches 3 days, collects cell.
RNA is extracted and cDNA synthesis:1. sample, Trizol cracking are collected:Cell is collected, 2000rpm centrifugation 5min are gone
Clearly, 1mLTrizol is added in cell precipitation, is stored at room temperature 5min after fully mixing, is then transferred in new 1.5mL EP pipes;
2. often pipe adds 200 μ L chloroforms, is turned upside down EP pipe 15s with hand, is stored at room temperature 10min.3. 4 DEG C, 12800rpm, centrifugation
15min.4. draw supernatant liquid and move to new 1.5mLEP pipes, add the isopropanol of isometric precooling, 4 DEG C of standings after mixing
10min.5. 4 DEG C, 12800rpm centrifugation 12min after, abandon supernatant.6. 1mL, 75% ethanol (with DEPC water Fresh) are added,
Washing precipitation.7. 4 DEG C, 11800rpm centrifugation 5min, discard most of supernatant.8. 4 DEG C, 11800rpm centrifuge 5min again, abandon
Remove supernatant, drying at room temperature.9. when RNA precipitates substantially transparent, add RNase-free water (add volume regard RNA precipitate amount and
It is fixed) to being completely dissolved, Nanodrop 2000/2000C spectrophotometric analysis determines the concentration and quality of institute's extracting RNA.10. will
RNA reverse transcriptions acquisition cDNA (then above-mentioned system inactivates RT enzymes in 42 DEG C of water-bath 1h in 70 DEG C of water-bath 10min, will
The reverse transcription product cDNA arrived).(reverse transcription reaction system is shown in Table 4).
Table 4RNA reverse transcription reaction systems
Reagent | Every pipe addition |
5×RT buffer | 5μl |
10mM dNTPs | 2μl |
Rnasin(40U/μL) | 0.4μl |
M-MLV-RTase(200U/μl) | 1μl |
RNase-Free H2O | 5.6μl |
RT-PCR:Real_time quantitative detection is carried out using the Real time PCR of the MX3000p types of Agilent companies.
The primer of PYCR1 genes is as follows:- the GGCTGCCCACAAGATAATGGC-3 ' of sense primer 5 ' and anti-sense primer 5 '-
CAATGGAGCTGATGGTGACGC-3’.Using house-keeping gene GAPDH as internal reference, primer sequence is as follows:Sense primer 5 '-
TGACTTCAACAGCGACACCCA-3 ' and-the CACCCTGTTGCTGTAGCCAAA-3 ' of anti-sense primer 5 '.In the ratio in table 5
Configure reaction system.
Table 5RT-PCR reaction systems
Reagent | Every pipe addition |
SYBR premix ex taq | 10.0μL |
Sense primer (2.5 μM) | 0.5μL |
Anti-sense primer (2.5 μM) | 0.5μL |
cDNA | 1.0μL |
RNase-Free H2O | 8.0μL |
Setting program is two-step method Real-time PCR:95 DEG C of pre-degeneration, 30s, afterwards each 95 DEG C of step denaturation, 5s;
60 DEG C of annealing extension, 30s;45 circulations are carried out altogether.Every time light absorption value is read in the extension stage.After PCR terminates, 95 DEG C of denaturation
1min, is subsequently cooled to 55 DEG C, DNA double chain is fully combined.To 95 DEG C since 55 DEG C, each step increases by 0.5 DEG C, keeps
4s, while reading light absorption value, makes melting curve.Using 2-ΔΔCtAnalytic approach calculates the gene expression abundance for infecting PYCR1 mRNA.It is real
Test result to show, PYCR1 mRNA expression has lowered 77.9% (Fig. 5) in BEL-7404 human liver cancer cell;Human liver cancer
PYCR1 mRNA expression has lowered 95.7% (Fig. 6) in SMMC-7721 cells.
Embodiment 3 detects the multiplication capacity for the tumour cell for infecting PYCR1-siRNA slow virus
Human liver cancer BEL-7404, SMMC-7721 cell in exponential phase carries out pancreatin digestion, and cell suspension is made
(cell number is about 5 × 104/ ml) 6 orifice plates are inoculated in, culture to cell fusion degree reaches about 30%.Add appropriate embodiment 1
The virus of preparation, culture changes culture medium after 6 hours, after time of infection reaches 5 days, collects cell.Complete medium is resuspended
Into cell suspension (2 × 104/ ml), it is about 2000/hole with cell density, is inoculated in 96 orifice plates.Every group of 3 multiple holes, per hole
100ul.Complete after plate, put cell culture incubator culture.Since after bed board second day, read plate is detected once with Celigo daily,
Continuous detection read plate 3-5 days;By adjusting analysis settings input parameter, each scanning holes is calculated exactly
The quantity of the cell with green fluorescence in plate;Statistics drawing is carried out to data, the cell growth curve of 5 days is drawn.
According to cell counts and time point, the cell growth curve based on cell counts is drawn.Test result indicates that,
Slow virus infects group tumour cell and cultivated in vitro after 5 days, and growth rate is significantly slowed, far below the increasing of control group tumour cell
Speed is grown, the vigor cell number of BEL-7404 human liver cancer cell has lowered 64.0% (Fig. 7), as shown in fig. 7, slow through shRNA
After virus infection 3 days, cell is laid on 96 orifice plates, and bed board number is 2000.Celigo is continuously detected 5 days, finds experimental group BEL-
The multiplication rate of 7404 cells is significantly inhibited.Point out the multiplication capacity of PYCR1 genes and BEL-7404 cells significantly correlated.
As shown in figure 8, after shRNA slow-virus infections 3 days, cell is laid on 96 orifice plates, bed board number is 2000.Celigo continuously detections 5
My god, it is found that the multiplication rate of experimental group SMMC-7721 cells is significantly inhibited.Point out PYCR1 genes and SMMC-7721 cells
Multiplication capacity it is significantly correlated.The vigor cell number of human hepatocarcinoma BEL-7402 has lowered 61.4% (Fig. 8).
Embodiment 4 detects the ability for the tumor cell clone formation for infecting PYCR1-siRNA slow virus
Human liver cancer BEL-7404, SMMC-7721 cell in exponential phase carries out pancreatin digestion, and cell suspension is made
(cell number is about 5 × 104/ ml) 6 orifice plates are inoculated in, cell is inoculated in into each experimental group in 6 orifice plate culture plates is inoculated with 400-
1000 cells/wells (being determined according to cell growth status), each experimental group sets 3 multiple holes.By the cell being inoculated with culture
Continue to cultivate in case untill cell number is more than 50 by 14 days or in most single clones, carried out changing liquid simultaneously every 3 days halfway
Observe cell state.Cell clone is taken pictures under fluorescence microscope before experiment is terminated, PBS washings cell 1 time.Added per hole
1mL4% paraformaldehydes, fixed cell 30-60min, PBS washs cell 1 time.Clean, free from admixture GIEMSA dye liquors are added per hole
500 μ L, dye cell 10-20min.ddH2O washings cell for several times, dries, taken pictures, colony count.
The result that liver cancer BEL-7404, the SMMC-7721 cell clonal formation as shown in Fig. 9,10 is tested, as shown in figure 9,
After shRNA slow-virus infections 3 days, cell is laid on 6 orifice plates, and bed board amount is 1000.After 11 days, observation clone's number finds experimental group
BEL-7404 cell colonies number is reduced, and points out the clonality of PYCR1 genes and BEL-7404 cells significantly correlated.
After shRNA slow-virus infections as shown in Figure 10 3 days, cell is laid on 6 orifice plates, and bed board amount is 1000.After 11 days, observation clone's number,
It was found that experimental group SMMC-7721 cell colonies number is reduced, the Clone formation energy of PYCR1 genes and SMMC-7721 cells is pointed out
Power is significantly correlated.Oncocyte infection PYCR1-siRNA rear clone Forming abilities are significantly reduced, and are compared with control group, RNA interference groups
Oncocyte formation clone's spot number is substantially reduced, and the volume of clone's spot is obviously reduced.Show that PYCR1 silences cause tumour cell to be formed
The ability of clone declines.
Embodiment 5 detects the apoptosis of tumor cells level for infecting PYCR1-siRNA slow virus
When each orifice plate cell growth to coverage rate of experimental group 6 is about 70%, the PYCR1-siRNA inductions of interference group are withered
Die;Pancreatin digests, and complete medium is resuspended into cell suspension, is collected in supernatant cell in same 5mL centrifuge tubes, and every group sets three
Individual multiple holes (to ensure upper machine cell number enough, cell number >=5 × 105/ is handled);1300rmp centrifuges 5min, abandons supernatant, 4 DEG C
D-Hanks (pH=7.2~7.4) the washing cell precipitations of precooling;1 × binding buffer wash cell precipitation once,
1300 rmp, 3min are centrifuged, and collect cell;Cell precipitation is resuspended in 200 μ 1 × binding of L buffer;Add 10 μ L
Annexin V-APC are dyed, room temperature lucifuge 10-15min;According to cell concentration, 1 × binding of 400-800 μ L are added
Buffer, upper machine testing.
As a result show, as shown in figure 11, detect that the BEL-7404 of apoptosis occurs for experimental group within 3 days after shRNA slow-virus infections
Cell is dramatically increased, and points out the apoptosis of PYCR1 genes and BEL-7404 cells significantly correlated.As shown in figure 12, shRNA slow virus
Detect that the SMMC-7721 cells that apoptosis occurs for experimental group are dramatically increased within 3 days after infection, point out PYCR1 genes and SMMC-7721
The apoptosis of cell is significantly correlated.PYCR1-siRNA interference group apoptosis of tumor cells rates are significantly higher than control group, are shown in liver
In cancer BEL-7404 cells (Figure 11) and SMMC-7721 cells (Figure 12), silence PYCR1 expression, apoptosis rate is significantly higher than
Control group.Show that apoptosis of tumor cells can be caused by lowering PYCR1 expressions.
Described above is only the preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art
For member, under the premise without departing from the principles of the invention, some improvements and modifications can also be made, these improvements and modifications also should
It is considered as protection scope of the present invention.
SEQUENCE LISTING
<110>No. 7 People's Hospital, Shanghai City
<120>The shRNA interference sequences and its pharmaceutical applications of people's PYCR1 genes
<130>Sa Da
<160> 6
<170> PatentIn version 3.5
<210> 1
<211> 58
<212> DNA
<213>Artificial sequence
<400> 1
ccggcacagt ttctgctctc aggaactcga gttcctgaga gcagaaactg tgtttttg 58
<210> 2
<211> 58
<212> DNA
<213>Artificial sequence
<400> 2
aattcaaaaa cacagtttct gctctcagga actcgagttc ctgagagcag aaactgtg 58
<210> 3
<211> 19
<212> DNA
<213>Artificial sequence
<400> 3
cagtttctgc tctcaggaa 19
<210> 4
<211> 610
<212> DNA
<213>Artificial sequence
<400> 4
gttttaaaat tatgttttaa aatggactat catatgctta ccgtaacttg aaagtatttc 60
gatttcttgg ctttatatat cttgtggaaa ggacgaaaca ccggcacagt ttctgctctc 120
aggaactcga gttcctgaga gcagaaactg tgtttttgaa ttctcgacct cgagacaaat 180
ggcagtattc atccacgaat tcggatccat taggcggccg cgtggataac cgtattaccg 240
ccatgcatta gttattaata gtaatcaatt acggggtcat tagttcatag cccatatatg 300
gagttccgcg ttacataact tacggtaaat ggcccgcctg gctgaccgcc caacgacccc 360
cgcccattga cgtcaataat gacgtatgtt cccatagtaa cgccaatagg gactttccat 420
tgacgtcaat gggtggagta tttacggtaa actgcccact tggcagtaca tcaagtgtat 480
catatgccaa gtacgccccc tattgacgtc aatgacggta aatggcccgc ctggcattat 540
gcccagtaca tgaccttatg ggactttcct acttggcagt acatctacgt attagtcatc 600
gctattacca 610
<210> 5
<211> 24
<212> DNA
<213>Artificial sequence
<400> 5
cctatttccc atgattcctt cata 24
<210> 6
<211> 20
<212> DNA
<213>Artificial sequence
<400> 6
gtaatacggt tatccacgcg 20
Claims (10)
1. a kind of shRNA interference sequences of people PYCR1 genes, including DNA oligo positive strand sequences and anti-chain sequence, wherein, institute
Stating positive strand sequence is:
5’-CCGGCACAGTTTCTGCTCTCAGGAACTCGAGTTCCTGAGAGCAGAAACTGTGTTTTTG-3’;
The anti-chain sequence is:
5’-AATTCAAAAACACAGTTTCTGCTCTCAGGAACTCGAGTTCCTGAGAGCAGAAACTGTG-3’。
2. shRNA interference sequences according to claim 1, it is characterised in that the DNA oligo positive strand sequences and anti-chain
Sequence includes siRNA target sequences:
5’-CAGTTTCTGCTCTCAGGAA-3’。
3. a kind of shRNA slow virus carriers of people PYCR1 genes, it is characterised in that the shRNA of the people PYCR1 genes is sick slowly
Poisonous carrier is for the siRNA target sequences of people's PYCR1 genes:
5’-CAGTTTCTGCTCTCAGGAA-3’。
4. a kind of people PYCR1 gene siRNAs, it is characterised in that the coding people PYCR1 gene siRNAs include being directed to people PYCR1
The siRNA target sequences of gene:
5’-CAGTTTCTGCTCTCAGGAA-3’。
5. a kind of people PYCR1 gene siRNA nucleic acid carriers, it is characterised in that the people PYCR1 gene siRNAs nucleic acid carrier bag
Include the siRNA target sequences for people's PYCR1 genes:
5’-CAGTTTCTGCTCTCAGGAA-3’。
6. a kind of people PYCR1 gene siRNA nucleic acid carriers, it is characterised in that the people PYCR1 gene siRNA nucleic acid carriers are:
5’-GTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGG
CTTTATATATCTTGTGGAAAGGACGAAACACCGGCACAGTTTCTGCTCTCAGGAACTCGAGTTCCTGAGAGCAGAAA
CTGTGTTTTTGAATTCTCGACCTCGAGACAAATGGCAGTATTCATCCACGAATTCGGATCCATTAGGCGGCCGCGTG
GATAACCGTATTACCGCCATGCATTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGG
AGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATA
ATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGC
CCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCT
GGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACC
A-3’。
7. a kind of people PYCR1 genes disturb the construction method of slow virus, it is characterised in that comprise the following steps:
1) synthesis is for the DNA oligo normal chains and anti-chain of the RNA interfered target sequences of people's PYCR1 genes, the positive strand sequence
For:
5’-CCGGCACAGTTTCTGCTCTCAGGAACTCGAGTTCCTGAGAGCAGAAACTGTGTTTTTG-3’;
The anti-chain sequence is:
5’-AATTCAAAAACACAGTTTCTGCTCTCAGGAACTCGAGTTCCTGAGAGCAGAAACTGTG-3’;
2) double-stranded DNA of positive strand sequence and anti-chain the sequence anneals formation with cohesive end;
3) vector linearization being made by digestion, makes linearized vector and step 1) obtained double-stranded DNA is connected;
4) connection product is converted into competent escherichia coli cell, performing PCR identification is entered to obtained positive colony;
5) plasmid extraction, virus packaging.
8. method according to claim 7, it is characterised in that the step 3) in endonuclease reaction for add AgeI and
EcoRI double digestions.
9. method according to claim 7, it is characterised in that the step 4) connection product conversion E. coli competent
The specific method of cell is:
Connection product is added in competent escherichia coli cell, ice bath;Heat shock, ice bath;Add the LB liquid of antibiotic-free
Culture medium, shaking table concussion and cultivate;Bacterium solution is taken uniformly to be applied on the LB solid mediums containing Amp, the mistake in 37 DEG C of incubators
Night cultivates;Positive colony enters in performing PCR qualification process
What is used identifies primer for identification primer-F:5 '-CCTATTTCCCATGATTCCTTCATA-3 ' and identification primer-R:5’
GTAATACGGTTATCCACGCG-3 ', detailed process is:Picking single bacterium colony enters performing PCR amplification, electrophoresis, sequencing.
10. the shRNA interference sequences of people PYCR1 genes according to claims 1 to 6, people's PYCR1 genes RNA are built
Body, people PYCR1 genes interference slow virus are preparing the growth of suppression tumour cell, promote apoptosis of tumor cells, prevent or treat
Application in the medicine of tumour.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710067075.5A CN106978418B (en) | 2017-02-07 | 2017-02-07 | shRNA interference sequence of human PYCR1 gene and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710067075.5A CN106978418B (en) | 2017-02-07 | 2017-02-07 | shRNA interference sequence of human PYCR1 gene and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN106978418A true CN106978418A (en) | 2017-07-25 |
CN106978418B CN106978418B (en) | 2019-12-06 |
Family
ID=59339180
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201710067075.5A Active CN106978418B (en) | 2017-02-07 | 2017-02-07 | shRNA interference sequence of human PYCR1 gene and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN106978418B (en) |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP3406253A1 (en) * | 2017-05-24 | 2018-11-28 | Bayer Aktiengesellschaft | Inhibitors and antagonists of human pycr1 |
CN109055431A (en) * | 2018-08-16 | 2018-12-21 | 深圳市南山区疾病预防控制中心 | The slow virus recombinant vector and its construction method of targeting ERR α gene and application |
CN114146178A (en) * | 2021-10-26 | 2022-03-08 | 兰州大学第二医院 | Application of PYCR1 gene as target in preparation of esophageal cancer product and related product |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102844435A (en) * | 2010-02-22 | 2012-12-26 | 库尔纳公司 | Treatment of pyrroline-5-carboxylate reductase 1 (pycr1) related diseases by inhibition of natural antisense transcript to pycr1 |
WO2016077632A3 (en) * | 2014-11-13 | 2016-08-25 | Buck Institute For Research On Aging | Inhibition of proline catabolism for the treatment of cancer and other therapeutic applications |
-
2017
- 2017-02-07 CN CN201710067075.5A patent/CN106978418B/en active Active
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102844435A (en) * | 2010-02-22 | 2012-12-26 | 库尔纳公司 | Treatment of pyrroline-5-carboxylate reductase 1 (pycr1) related diseases by inhibition of natural antisense transcript to pycr1 |
WO2016077632A3 (en) * | 2014-11-13 | 2016-08-25 | Buck Institute For Research On Aging | Inhibition of proline catabolism for the treatment of cancer and other therapeutic applications |
Non-Patent Citations (2)
Title |
---|
NILSSON R 等: "Metabolic enzyme expression highlights a key role for MTHFD2 and the mitochondrial folate pathway in cancer", 《NAT COMMUN》 * |
ZENG T等: "Knockdown of PYCR1 inhibits cell proliferation and colony formation via cell cycle arrest and apoptosis in prostate cancer", 《MED ONCOL》 * |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP3406253A1 (en) * | 2017-05-24 | 2018-11-28 | Bayer Aktiengesellschaft | Inhibitors and antagonists of human pycr1 |
CN109055431A (en) * | 2018-08-16 | 2018-12-21 | 深圳市南山区疾病预防控制中心 | The slow virus recombinant vector and its construction method of targeting ERR α gene and application |
CN109055431B (en) * | 2018-08-16 | 2020-12-11 | 深圳市南山区疾病预防控制中心 | Slow virus recombinant vector of targeted ERR alpha gene and construction method and application thereof |
CN114146178A (en) * | 2021-10-26 | 2022-03-08 | 兰州大学第二医院 | Application of PYCR1 gene as target in preparation of esophageal cancer product and related product |
Also Published As
Publication number | Publication date |
---|---|
CN106978418B (en) | 2019-12-06 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN108251423A (en) | The sgRNA and Activiation method of CRISPR-Cas9 systemic characteristics targeting people's RSPO2 genes and application | |
CN105524924B (en) | Cyclic RNA circ-ZKSCAN1 use | |
CN111849979B (en) | sgRNA for targeted knockout of RPSA gene and construction method of RPSA gene knockout cell line | |
CN106978418A (en) | The shRNA interference sequences of people's PYCR1 genes and its application | |
CN107663539A (en) | Circular rna circ PTGR1 purposes | |
CN106620703B (en) | The inhibitor application in preparation of anti-tumor drugs of GINS2 gene or albumen | |
CN103194425B (en) | Method for promoting epidermal cell proliferation | |
CN110317878B (en) | Long-chain non-coding RNA for diagnosis and treatment monitoring of bladder cancer and application thereof | |
CN107334777A (en) | New application of interference BTF3 in inhibiting proliferation of melanoma cells | |
CN104630221B (en) | Suppress shRNA and its recombinant vector and the application of growth of tumour cell | |
CN112063635B (en) | Target sequence of RNA virus and application thereof | |
CN102533982B (en) | The novelty teabag of people KLF8 gene in oncotherapy | |
CN103667422B (en) | The purposes and its related drugs of people's CUL4B genes | |
CN103421884B (en) | The purposes and its related drugs of people's FZR1 genes | |
CN113444726A (en) | lncRNA ALDB-898 related to piglet bacterial diarrhea and application thereof | |
CN109517821A (en) | A kind of RNA interference, slow virus carrier and its application targeting PRIM1 gene | |
CN103667431B (en) | A kind of purposes and its related drugs of people CCCH types zinc finger protein expressing gene | |
CN113789340B (en) | Expression vector of circular RNA hsa_circ_0001741, recombinant engineering bacterium and application thereof | |
CN104368001B (en) | Suppress CALM1 and cooperate with the application in suppressing tumour with EGFR | |
CN104774928B (en) | The application of people's RRS1 genes and inhibitor | |
CN104826130B (en) | MSX3 gene specifics induce the selectively polarized method and its application of microglia | |
CN111228292B (en) | Application of human TPT1/TCTP gene in preparation of antitumor drugs | |
CN108342389A (en) | The purposes and its related drugs of PLEKHO1 genes | |
CN114457075B (en) | shRNA (short hairpin ribonucleic acid) and lentiviral vector for knocking down PXYLP1 gene expression, and construction method and application thereof | |
CN110117593B (en) | Application of nucleic acid, recombinant vector and recombinant lentivirus for specifically reducing FAM84B gene expression |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |