CN102816769B - Hermetia illucens L antibacterial peptide, preparation method and application thereof - Google Patents
Hermetia illucens L antibacterial peptide, preparation method and application thereof Download PDFInfo
- Publication number
- CN102816769B CN102816769B CN2012102868787A CN201210286878A CN102816769B CN 102816769 B CN102816769 B CN 102816769B CN 2012102868787 A CN2012102868787 A CN 2012102868787A CN 201210286878 A CN201210286878 A CN 201210286878A CN 102816769 B CN102816769 B CN 102816769B
- Authority
- CN
- China
- Prior art keywords
- antibacterial peptide
- stomoxyn
- pcr
- preparation
- application
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Agricultural Chemicals And Associated Chemicals (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention discloses a new Hermetia illucens L antibacterial peptide StomoxynZH1, a preparation method and an application thereof. Preparation steps of the antibacterial peptide comprise: extracting the total RNA of insect Hermetia illucens L as a template, performing RT-PCR to obtain a first strand of cDNA as a template, and performing PCR amplification to obtain a PCR product; carrying out digestion to obtain a PCR product and a eukaryotic expression vector to construct a recombinant expression vector; transforming the resulting recombinant expression vector into yeast host cellsto obtain a recombinant strain expressing the antibacterial peptide StomoxynZH1; and carrying out inducing culture on the resulting recombinant strain to obtain a culture, and carrying out centrifugal separation on the culture to obtain the expressed antibacterial peptide. The antibacterial peptide of the present invention has broad spectrum antimicrobial activities and provides good application prospects in medicine, agriculture disease prevention and control, feed additives and other fields, wherein the broad spectrum antimicrobial activities comprise gram-negative bacteria escherichia coliresistance, gram-positive bacteria staphylococcus aureus resistance, and fungi rice blast pathogenic bacteria resistance.
Description
Technical field
The present invention relates to the gene biological field of engineering technology.Be specifically related to the flat angle of a kind of speck stratiomyiid (Hermetia illucens L.) antibacterial peptide gene, also relate to the preparation method of the flat angle of a kind of speck stratiomyiid antibacterial peptide, also relate to the application of the flat angle of a kind of speck stratiomyiid antibacterial peptide aspect antibacterial.
Background technology
Insect antimicrobial peptide is a class antibacterial substance that produces when being subjected to accidental injury or pathogenic bacterial infection when insect, it is a kind of immunne response product in the non-specific immunity system of defense in the organism, mainly be created in the blood hemolymph, have many-sided advantage,, Heat stability is good little as molecular weight, broad-spectrum antibacterial action and pathogenic bacteria are difficult for producing resistance etc.
The resistance of pathogenic micro-organism constantly strengthens at present, and resistance is composed also in continuous expansion, and is therefore comparatively severe to the influence of results for the treatment of such as clinical disease-resistant, anti-infective, agriculture animals and plants disease.People constantly seek and study the new antimicrobial agents that is different from the conventional medicament mechanism of action when actively studying the resistant organism resistance mechanism, the correlative study of antibacterial peptide has just become the focus that people pay close attention to and study thus.
The U.S. and Japan have dropped into the research and development that huge fund is carried out natural antibacterial peptide, and particularly the development of resources of fly class is as one of new high-tech industry the exploitation of insect resources, but the research and development in this field just begins in China.At present, separate in the bodies such as fruit bat from Diptera class insect (mainly being fly class insect) of expert both domestic and external and scholar, housefly, matting chela fly, Mediterranean fruitfly and obtain antibacterial peptide.These antibacterial peptides have much characteristic preferably, as good water solubility, broad-spectrum antibacterial activity, can suppress various bacteria, fungi, virus and tumour cancer cells but do not damage normal somatocyte, have no side effect etc.
The flat angle of dipteral insect speck stratiomyiid can be grown in rotten thing, ight soil and rubbish etc. and contain in the severe environment of a large amount of bacteriums, himself but can not cause death because of infection pathogen, this flat angle of explanation speck stratiomyiid has very strong immunizing power (what positive wave etc., 2001) to pathogenic micro-organism.And this immunizing power is probably from the secreted active substance role of the flat angle of speck stratiomyiid itself.
The research of the antibacterial peptide that insect autoimmunization produces is many, especially it is more to be directed to the antibacterial peptide research that housefly produces, from the extraction of the active substance of early stage insect and separation and purification up till now the stage carry out evaluation and the clone of bioactive peptide molecule with gene engineering method.But aspect environmental safety, not only can not propagate pathogenic bacteria with the flat angle of speck stratiomyiid as research material, and the flat angle of speck stratiomyiid itself still handles the good material of agricultural wastes, thus relatively other insect material to be used for carrying out antibacterial peptide research association safer, have feasibility.The flat angle of speck stratiomyiid may have new antibacterial peptide gene utilizing ight soil etc. can secrete antimicrobial substance, is necessary its antibacterial peptide gene is carried out examination,
Therefore, further investigate excavating new antibacterial peptide in the stratiomyiid of the flat angle of speck, numerous areas such as medicine, food preservatives, fodder additives and corps diseases biological control are had great importance.For the flat angle of speck stratiomyiid antibacterial peptide function and study on mechanism provide molecular basis, and provide theoretical foundation for the application of antibacterial peptide in biological control and medicine.
Summary of the invention
One object of the present invention is to provide a kind of novel antimicrobial peptide gene, its nucleotides sequence is classified as shown in SEQ ID NO.1 or the SE Q ID NO.2, the similarity of these two nucleotide sequences reaches in this gene order of 99%(and has base mutation), with known Stomoxyn antibacterial peptide gene (GeneBank NO:AP00484) homology be 46.29%, can encode with a kind of antibacterial peptide.This sequence be first from the stratiomyiid of the flat angle of speck examination clone obtain, can be according to this sequences Design primer, and be template with the cDNA of the flat angle of speck stratiomyiid, this nucleotide sequence that increases in a large number of the method by PCR or RT-PCR, be connected in expression vector, express and produce antibacterial peptide.
Another object of the present invention is to provide a kind of novel antimicrobial peptide Stomoxyn ZH1, and its aminoacid sequence is shown in the SEQ ID NO.3.This antibacterial peptide has broad-spectrum antibacterial activity: the anti-Gram-negative bacteria intestinal bacteria of energy, gram-positive microorganism streptococcus aureus and antimycotic rice blast pathogen; At aspects such as medicine, agricultural disease control, fodder additivess good prospects for application is arranged.
A further object of the invention has been to provide the preparation method of a kind of novel antimicrobial peptide Stomoxyn ZH1, make up carrier for expression of eukaryon, carry out inducing culture after being transformed into expression strain, centrifuging and taking fermentation supernatant, adopt the lyophilize method of enrichment to obtain the purpose antibacterial peptide supernatant, this method is easy, and is quick and with low cost.
The invention still further relates to the application of a kind of novel antimicrobial peptide Stomoxyn ZH1 in medicines such as preparation treatment or the antibiotic infection of preventive medicine.
The invention still further relates to a kind of novel antimicrobial peptide Stomoxyn ZH1 in the application of the commercial animal antiseptic feed additive of preparation.
The invention still further relates to the application of a kind of novel antimicrobial peptide Stomoxyn ZH1 in the biological pesticide of preparation treatment or prevention agricultural plants disease.
For realizing above-mentioned task, the present invention adopts following technical measures:
An object of the present invention is to provide a kind of new nucleotide sequence, a kind of new antibacterial peptide StomoxynZH1 of this sequence encoding.In the present invention, the nucleotide sequence of antibacterial peptide Stomoxyn ZH1 is to be template with the cDNA after the total RNA of the flat angle of speck stratiomyiid or the mRNA reverse transcription, and obtain by the PCR method amplification with the degenerated primer of design.Concrete grammar is as follows: stratiomyiid Wuhan, the flat angle of speck kind is provided by Hua Zhong Agriculture University microbial pesticide national project research centre, get the flat angle of speck stratiomyiid near upper part tissue of head, extracting total RNA or mRNA is template (commercially available extraction RNA and mRNA test kit, operation to specifications), carry out reverse transcription with reverse transcriptase primer Oligo dT Primer and obtain cDNA first chain.Be template with above-mentioned cDNA first chain, be that primer carries out pcr amplification with the many of design to degenerated primer (seeing table 1 for details) again, be that the pcr amplification of primer obtains the purpose fragment about 180bp with S tomoxyn finally, this fragment is reclaimed and cloning and sequencing, obtain a kind of antibacterial peptide gene of separation, its sequence is shown in SEQ ID NO.1 or the SEQ ID NO.2.
The present invention's two nucleotide sequences required for protection, this nucleotide sequence in a large number can increase by the method for PCR.The claimed antibacterial peptide of the present invention can be produced with the following method: the included following concrete operation of this method is according to the normal experiment condition; [J. Sa nurse Brooker etc. is write as " molecular cloning laboratory manual " (third edition); 2003, Beijing: Science Press] described in condition carry out.
The preparation method of a kind of novel antimicrobial peptide Stomoxyn ZH1 the steps include:
1) total RNA or the mRNA of the flat angle of extraction speck stratiomyiid become cDNA first chain with the reverse transcription test kit with its reverse transcription;
2) many to degenerated primer according to the issuable antibacterial peptide design of dipteral insect institute, see table 1 for details
3) be pcr template with cDNA first chain that obtains the flat angle of speck stratiomyiid, increasing with above-mentioned degenerated primer obtains the purpose fragment, with resulting fragment reclaim, to obtain sequence be the Nucleotide full length sequence shown in SEQ ID NO.1 or the SEQ ID NO.2 to cloning and sequencing;
4) primer of redesign band restriction enzyme site, amplification obtains SEQ ID NO.1 and the SEQ ID NO.2 with restriction enzyme site
5) make up recombinant expression vector: preserve in the nucleotide sequence that obtains in the step 4 and carrier for expression of eukaryon pPICZ α A(laboratory, perhaps commercially available, invitrogen company) carrying out enzyme cuts, dna sequence dna after ligase enzyme is cut and expression vector pPICZ α A make up recombinant expression vector pPICZ α A-Stomoxyn ZH1;
6) the recombinant expression vector electricity that obtains in the step 5 is converted into (preserve in this laboratory) in the host cell of pichia spp GS115, and in the BMGY substratum 30 ℃ cultivate 24h after, be inoculated in the BMMY substratum 30 ℃ of inducing culture 2-3d acquisitions of the methyl alcohol culture with 1%;
7) get culture centrifugation supernatant in the step 6, the antibacterial peptide of aminoacid sequence obtained a kind of antibacterial peptide shown in abduction delivering had in the purification step 6, and its sequence is shown in the SEQ ID NO.3.
Purity detecting can detect with the SDS-PAGE method.
The application of the flat angle of a kind of speck stratiomyiid antibacterial peptide aspect antibacterial, its application process is:
Recognize that through inspection information the anti-microbial activity of Stomoxyn is anti-G
+And G
-And anti-part fungi, therefore tentatively Sto moxyn ZH1 expressed proteins has been done G
+Representative strain streptococcus aureus and G
-Representative strain intestinal bacteria and rice blast pathogen have been done antibacterial detection.
The main dull and stereotyped face-off of the punching culture method that adopts detects its anti-microbial activity.Bacterium mainly is that the suspension of drawing 100 μ L logarithmic phases is uniformly coated on the solid medium plate, and the punch tool with diameter 5mm punches on substratum 6 symmetrically and evenly then.Accurately draw antibacterial peptide Stomoxyn ZH1 and express sample 80ul, add in the preparation hole of substratum, each indicator is cooked three repetitions.The pathogenic fungi inhibition test then is that activated good pathogenic fungi bacterium piece is connected to substratum (PDA) central authorities, adds corresponding antibacterial peptide Stomoxyn ZH1 then and express sample 80ul in the preparation hole of substratum.Pathogenetic bacteria is in 37 ℃ of cultivation 24h, and pathogenic fungi is cultivated about 2d at 28 ℃, observes inhibition.The result shows that expressing sample Stomoxyn ZH1 gram-positive microorganism streptococcus aureus, Gram-negative bacteria intestinal bacteria and fungi rice blast pathogen all has inhibition.
Medically main anti-pseudomonas aeruginosa, escherichia coli, Salmonella typhi, proteus vulgaris and cause Candida albicans, dysentery bacterium, pneumobacillus of human diseases etc.Part stomoxyn even the virus that contains coating such as simplexvirus, vesicular stomatitis virus also had effect medically, and harmless to normal cell.
Aspect animal diseases, be primarily aimed in born of the same parents' endoparasitism protozoon, toxoplasma gondii, plasmodium and trypanosoma bocagei and roundworm egg are had lethal effect.Animal derived pathogenic bacterium such as pasteurella multocida, intestinal bacteria and streptococcus aureus also there is the resistance effect.
Anti-bacterial diseases of plants bacterial strain mainly is rice leaf spot bacteria, Chinese cabbage soft rot bacteria and rice blast pathogenic fungi etc.
Compared with prior art, the present invention has the following advantages:
1. the anti-fungus peptide Stomoxyn ZH1 that the degenerated primer amplification by the design antibacterial peptide gene makes new advances from the insect stratiomyiid.
2.Stomoxyn ZH1 has broad spectrum antibiotic activity, at aspects such as medicine, agricultural disease control, fodder additivess good prospects for application is arranged.
3. the preparation method of novel antimicrobial peptide Stomoxyn ZH1, this method is easy, and is quick and with low cost.
Description of drawings
Fig. 1 is the pcr amplification electrophoresis synoptic diagram of a kind of antibacterial peptide gene Stomoxyn
M:DNA 50bp Marker; 1:Stomoxyn institute amplified band.
Fig. 2 is the structure synoptic diagram of a kind of pPICZ α A-Stomoxyn ZH1
STO is novel antimicrobial peptide gene Stomoxyn ZH1 among the figure.At first design contains the upstream and downstream primer of EcoR I and Not I restriction enzyme site, cDNA with the flat angle of speck stratiomyiid is template, carry out PCR, must arrive two ends and contain the PCR product of EcoR I and Not I restriction enzyme site, with EcoR I and Not I enzyme respectively enzyme cut PCR product and pPICZ α A plasmid, STO is inserted the multiple clone site of pPICZ α A and finish ligation, thereby finish the structure of pPICZ α A-Stomoxyn ZH1 recombinant expression vector.
Fig. 3 is the abduction delivering synoptic diagram of a kind of pichia spp GS115 (pPICZ α A-Stomoxyn ZH1)
M, albumen marker, 1 is that pPICZ α A empty carrier is expressed sample;
The bacterial strain that 2-7 is respectively recombinant plasmid is with 1% methanol induction 24h, 36h, 48h, 60h, 72h, the expressed sample of 96h.
Fig. 4 is a kind of bacteriostatic experiment synoptic diagram of antibacterial peptide
A is the result of Stomoxyn ZH1 inhibition streptococcus aureus among Fig. 4, and ck is that empty carrier is expressed sample, and 1,2 application of sample is that Stomoxyn ZH1 expresses sample 1; 3,4 application of samples are expressed sample 2 for Stomoxyn ZH1;
B suppresses colibacillary result for Stomoxyn ZH1 among Fig. 4, and ck is that empty carrier is expressed sample, and 1,3 application of sample is expressed sample 1 for Stomoxyn ZH1; 2,4 application of samples are expressed sample 2 for Stomoxyn ZH1;
C is the result of Stomoxyn ZH1 inhibition rice blast pathogen among Fig. 4, and No. 1 application of sample is GS115 fermentation supernatant; No. 2 application of samples are that empty carrier is expressed sample; 3 application of samples are expressed sample for Stomoxyn ZH1.
Embodiment
Below in conjunction with specific embodiment, further illustrate the present invention.Should be understood that these embodiment only to be used for explanation the present invention and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to the normal experiment condition, " molecular cloning laboratory manual " (third edition) [J. Sa nurse Brooker etc. writes 2003, Beijing: Science Press] described in condition carry out or the condition of advising according to manufacturer.
The preparation of the flat angle of embodiment 1 speck stratiomyiid cDNA first chain
(1) extraction of the total RNA of speck flat angle stratiomyiid
With diethylpyrocarbonate (DEPC in Shanghai give birth to worker purchase) the water logging bubble 12h of standby equipment (Tip is first-class for Dissecting scissors, centrifuge tube, each model) with 1%;
Each equipment of handling through DEPC carries out autoclaving processing 30min;
With the flat angle of starting materials speck stratiomyiid with 75% alcohol-pickled 30min;
With ultrapure water clean material 2-3 time;
Cutting the mortar of putting into RNase free after tissue sample places liquid nitrogen to handle immediately with Dissecting scissors grinds, extract total RNA with ultrapure total RNA rapid extraction test kit (the white Bioisystech Co., Ltd in Yuanping City) under aseptic condition, detailed step sees the specification sheets of RNA rapid extraction test kit for details.
RNA places-70 ℃ of preservations, and is standby.
(2) synthesize the flat angle of speck stratiomyiid cDNA article one chain
According to Reverse Transcription System test kit specification sheets (purchasing in TIANGEN company), be synthetic cDNA first chain of primer with Oligo (dT).Reaction system is as follows, successively following reagent is added in DEPC water treatment and the PCR pipe of sterilizing:
In above-mentioned reaction solution (10 μ l), continue to add following reagent
Above-mentioned system is hatched 1h in 42 ℃ behind the mixing gently;
85 ℃ of heating 5min inactivation TransScriptRT enzymes.
The product of reverse transcription is standby in-20 ℃ of preservations as the template of PCR.
The examination of embodiment 2 antibacterial peptide genes and the amplification of gene Stomoxyn
(1) design of degenerated primer
Consult the Relational database of antibacterial peptide, analyze the conservative region of all kinds of antibacterial peptides according to the issuable antibacterial peptide of dipteral insect, utilize Primer5.0 to design degenerated primer, and finally designed 6 pairs of primers, the result sees table 1 for details.
The required primer of table 1 anti-fungus peptide gene amplification
(2) pcr amplification of antibacterial peptide gene
Utilize the cDNA of the flat angle of the speck stratiomyiid of reverse transcription to be template, with the design 6 pairs of degenerate primers respectively as primer, carry out thermograde PCR, system and the condition of pcr amplification are as follows:
The system of pcr amplification is:
The form of application of temperature grads PCR is reacted, and its reaction parameter is: 94 ℃ of pre-sex change 5min; 94 ℃ of sex change 30sec, Tm(40-60 ℃) annealing 30s, 72 ℃ are extended 45s, 30 circulations; 72 ℃ are extended 1min, 10 circulations, and 72 ℃ are extended 10min.Reacted product is got 3-5ul detect amplification, deposition condition 110V, 100mA, 40min with 2.5% agarose gel electrophoresis.The final discovery with the primer of antibacterial peptide gene Stomoxyn design, obtains the big or small band about 180bp that is when the Tm value is 50.6 ℃.
(3) recovery of PCR product and purifying
PCR reclaims gel electrophoresis with 2.5% agarose at the back of increasing in a large number, cuts glue under ultraviolet lamp, reclaims test kit (U.S. Axygen company) with glue and carry out gel and reclaim, and concrete steps see gel recovery test kit specification sheets for details.Detect recovering state with 2.5% agarose gel electrophoresis simultaneously.
The purpose fragment that amplification is obtained is connected on the carrier pMD18-T, and 4 ℃ of connections are spent the night.Operate according to pMD18-T support agent box process specifications.
The ligation system is:
(4) the competent preparation of E.coli DH5 α
The preparation process of E.coli DH5 α competent cell is as follows:
A, carry and inoculate E.coli DH5 α the day before yesterday, single bacterium colony of picking DH5 α is inoculated in the LB liquid nutrient medium and in 37 ℃ of shaking tables and carries out overnight incubation;
B, get 1ml DH5 α and cultivate the LB liquid that bacterium liquid is added to 100ml and (contain 20mmol/L MgCl
2) in the substratum, on the shaking table in about 37 ℃ of shaking culture 3h;
C, with 0.1mol/L CaCl
2Place that to carry out precooling treatment on ice standby; Following steps need and be carried out aseptic technique on ice;
D, the cultured DH5 α of absorption 1.5ml bacterium liquid are to the 2ml centrifuge tube, at cooled on ice 10min;
E, 4 ℃, 4,000r/min frozen centrifugation 10min;
F, abandoning supernatant add 100 μ l precooling 0.1mol/L CaCl
2Solution is inhaled dozen mixing up and down with pipettor and is made cell resuspended, places 20min on ice;
G., 4 ℃, 4,000r/min frozen centrifugation 10min;
H, abandoning supernatant add the 0.1mol/L CaCl of 100 μ l precoolings
2Solution is inhaled dozen mixing up and down with pipettor and is made cell resuspended;
I, resuspended cell are standby in-70 ℃ of preservations after can being used for conversion operation immediately or adding 20% glycerine.
(5) the purpose fragment is converted into E.coli DH5 α
The purpose fragment that b step the (2) step is obtained is connected on the pMD18-T carrier, and the product after will connecting is transformed in the E.coli DH5 α competent cell, and concrete operation steps sees the process specifications of pMD18-T support agent box for details.
(6) screening of positive colony
Picking 10-20 single bacterium colony from grow more single bacterium colony and growing way flat board preferably, being inoculated into 2ml after mark is good is added with in the LB liquid nutrient medium of 100 μ g/ml penbritins, and in 37 ℃ of shaking tables overnight incubation, getting the corresponding bacterium liquid of cultivating is that template is done the PCR evaluation, can amplify then positive clone's of purpose fragment, PCR reaction conditions and reaction system are with embodiment 2.At last the corresponding bacterium liquid of positive colony is sent to the handsome company in Shanghai and carries out sequence verification.Find that from sequencing result the purpose bar is taken the clone out of and obtained two (similarity is 99% between two) gene fragments, and with known Stomoxyn gene order homology be 46.29%, be new antibacterial peptide, name the ZH1 into Stomoxyn.
The amplification again of embodiment 3 antibacterial peptide gene Stomoxyn ZH1
According to the Stomoxyn ZH1 gene order that embodiment 2 increased and obtains, in conjunction with required expression vector pPICZ α A, design has the primer of restriction enzyme site, upstream primer P1:CCG
GAATTCAGAGGATTTCGTAAGCA(line place is the restriction enzyme site of EcoR I, is the protection base in the square frame); Downstream primer P2:AAT
GCGGCCGCAGTAGCAGCAACAACAGCA(line place is the restriction enzyme site of Not I, is the protection base in the square frame) primer is synthetic by the handsome company in Shanghai.
CDNA with the flat angle of speck stratiomyiid is template, primer P1 and P2 with the band restriction enzyme site that designs, go out corresponding Stomoxyn ZH1 gene (amplification condition is the same with embodiment 2) through pcr amplification, amplified production detects with 2.5% agarose gel electrophoresis.
The structure of embodiment 4 recombinant plasmid pPICZ alpha A-Stomoxyn ZH1
(1) double digestion of plasmid pPICZ α A and purpose fragment
With EcoR I and Not I difference double digestion purpose fragment Stomoxyn ZH1 and secreting, expressing plasmid pPICZ α A.
The double digestion system of purpose fragment is:
The double digestion system of plasmid pPICZ α A is:
Enzyme is cut system and is all placed 37 ℃, and enzyme is cut 3-4h, then enzyme is cut product plasmid pPICZ α A and is got 3 μ l samples and carry out 1.0% agarose gel electrophoresis and detect, and purpose fragment Stomoxyn ZH1 gets 3 μ l samples and detects with 2.5% agarose gel electrophoresis.With PCR cleanup Kit(U.S. Axygen company) isolated fragment reclaims enzyme and cuts product, and concrete operation method is seen Axy Pr ep
TMPCR clearup Kit specification sheets.
(2) connection of purpose fragment and conversion
At T
4Under the effect of DNA Ligase, the target gene fragment after enzyme cut is connected with carrier after enzyme is cut, and reaction system is spent the night in 4 ℃ of ligations.
The system of ligation is:
Be converted into the working instructions that competent cell DH5 α operation steps sees the pMD-18T carrier for details with connecting product.Behind the Zeocin resistance screening, picking partial resistance transformant carries out bacterium colony PCR and identifies that the resistance transformant of the target gene fragment that will increase is defined as positive colony.
(3) extracting of recombinant plasmid and enzyme are cut evaluation
Optional wherein a few strain positive colonies change over to and contain in the LB liquid nutrient medium of Zeocin that 5ml is added with 25 μ g/ml 37 ℃ of shaking table 220r/min overnight incubation.The positive recombinant plasmid of a large amount of extractions, operation steps see plasmid for details carries middle amount test kit (the biological company limited in the village, Beijing ally border) process specifications for a short time.Get wherein a small amount of plasmid and respectively unloaded plasmid pPICZ α A and recombinant plasmid are carried out double digestion with restriction enzyme EcoR I and Not I, reaction system is the same.Getting 4 μ l enzymes then cuts product and carries out 1% agarose gel electrophoresis respectively and detect.If the band of 2 clauses and subclauses is arranged in the detected result, one identical with pPICZ α A size, and another is identical with Stomoxyn ZH1 size, and the construction of recombinant plasmid success is described.With recombinant plasmid called after pPICZ α A/Stomoxyn ZH1.Simultaneously the corresponding bacterium liquid of positive recombinant clone is sent to the handsome company in Shanghai and carries out sequence verification.
Structure and the abduction delivering of embodiment 5 engineering strains
(1) preparation of pichia spp GS115 competent cell
A, picking GSll5(laboratory preserve or are commercially available) single bacterium colony, be seeded to and contain in the 5mL YPD substratum, 28 ℃, 280r/min spend the night;
B, the bacterium liquid that spends the night of getting 150 μ L are inoculated into the 2L triangle that contains the 500mL fresh culture and shake in the bottle, and 28 ℃ of shaking table 250r/min spend the night;
C, 4 ℃, the centrifugal 10min of 6000r/min is with the resuspended precipitation of sterilized water of 500mL ice precooling;
D, centrifugal by above step is with the resuspended thalline of ice precooling sterilized water of 250mL;
E, centrifugal by above step, the sorbyl alcohol of the 1mol/L of the ice precooling of usefulness 20mL comes resuspended thalline;
F, centrifugal by above step is with the next resuspended thalline of the 1mol/L sorbyl alcohol of 1.5mL precooling;
G, above-mentioned bacterium liquid is packed as the every pipe of 80 μ L, place-70 ℃ standby.
(2) linearizing of recombinant plasmid
About 10 μ g recombinant plasmids are carried out single endonuclease digestion with Sac I (TaKaRa company or commercially available), the consumption of enzyme, the temperature when enzyme is cut, with reference to shop instruction, 37 ℃ of enzymes are cut 1h.
The single endonuclease digestion reaction system is:
Reclaim enzyme with PCR cleanup Kit and cut product, concrete operation method is seen Axy Prep
TMPCR clearup Kit specification sheets.
(3) the recombinant plasmid electricity is converted into GS115
After pichia spp GS115 was finished in preparation, the recombinant plasmid electricity that linearizing is good was converted among the pichia spp GS115.The detailed step that electricity transforms is as follows:
A, the good recombinant plasmid of 20 μ l linearizing is mixed with 80 μ l competent cell GS115, the electricity that joins precooling transforms in the cup (0.2cm), and ice bath 5min;
B, when voltage 2000V the electric shock 5ms;
C, add the 1mol/L sorbyl alcohol lml of precooling immediately, behind the mixing it is forwarded in the aseptic centrifuge tube to 30 ℃ of incubators activation 1h;
D, 100 μ l are cultivated bacterium be applied to the YPD that contains 200 μ g/ml Zeocin and cultivate in the bacterium;
E, 30 ℃ of cultivation 2-3d are up to growing single bacterium colony.
(3) positive-selecting of yeast recon
Picking list colony inoculation spends the night in the YPD substratum from grow more single bacterium colony and growing way flat board preferably, gets incubated overnight bacterium 10 μ l then in the centrifuge tube of 1.5ml and adds 5 μ l lyase, and 30 ℃ of incubators leave standstill several minutes; Get 2 μ l reaction solutions as template, the reaction system of PCR is the same with embodiment 2 with the reaction conditions amplification condition, can amplify then positive clone's of purpose fragment after the evaluation.
(4) abduction delivering of target protein and SDS-PAGE identify
After resistance screening and PCR evaluation, the corresponding yeast liquid of positive colony in (3) is carried out abduction delivering with 1% methyl alcohol, with the yeast that transforms empty carrier in contrast, concrete operations step following (note inoculation in the operation, application of sample, sampling, suspension handle and collect thalline etc. and all under aseptic condition, operate):
A, picking positive colony are inoculated in the 50ml BMGY substratum, and 28 ℃ of shaking table 180r/min cultivate;
(sampling detects, up to OD about B, cultivation 2d
600Be between 2～6), 4 ℃, 6,000rpm is centrifugal, and 15min collects thalline;
C comes resuspended thalline, 28 ℃ of shaking table 180r/min inducing culture with 50ml BMMY substratum;
D, get sample one time every 24h, adding small amount of methanol then, to make the methanol concentration in the bacterium liquid be about 1%;
E, with institute's sample thief in 4 ℃, the centrifugal 15min of 6,000rpm collects thalline and supernatant, SDS-PAGE detects albumen;
F, induce 4-5d after, stop to induce, 4 ℃, the centrifugal 15min of 8,000r/min collects all thalline and supernatant, SDS-PAGE detects albumen.
Preceding with inducing, do not induce and induce the back in a small amount sampling the Eppendorf pipe in 4 ℃ with 8000rpm centrifugal 5 minutes, discard precipitation.Get above-mentioned each 10ul of supernatant sample respectively in 10ul 2 * sds gel sample-loading buffer (100mM Tris-C1,200mM beta-mercaptoethanol, 4%SDS, 0.2% tetrabromophenol sulfonphthalein, 20% glycerine), 100 ℃ were heated 10 minutes, sample can be stored in-4 ℃, in order to application of sample on gel.Get the 10ul application of sample and in the 12%SDS polyacrylamide gel, carry out electrophoresis.After electrophoresis finishes, unload gel, at coomassie brilliant blue staining liquid (1g Xylene Brilliant Cyanine G R-250,450ml methyl alcohol, 450ml ddH2O, the 100ml Glacial acetic acid) dyeing is 1 hour in, use destainer (40ml methyl alcohol, 10ml acetic acid, 50ml ddH2O) decolouring then, changed liquid once every 30 minutes, till background is taken off totally.By observing gel as can be known: goal gene is successful abduction delivering in pichia spp, size is about 14kDa, and in abduction delivering 72h expression amount maximum, because the whole expression amount of antibacterial peptide Stomoxyn ZH1 is less than normal, its SDS-PAGE detects not too obvious, and the result sees for details shown in Figure 3.
Embodiment 6 expresses the mensuration of antibacterial peptide Stomoxyn ZH1 antibacterial activity in vitro
Recognize that through inspection information the anti-microbial activity of Stomoxyn is anti-G
+And G
-And anti-part fungi, therefore the first albumen of tentatively Sto moxyn ZH1 being expressed has been done G
+Representative strain streptococcus aureus and G
-Representative strain intestinal bacteria and rice blast pathogen have been done antibacterial detection.
The main dull and stereotyped face-off of the punching culture method that adopts detects its anti-microbial activity.Bacterium mainly is that the suspension of drawing 100 μ L logarithmic phases is uniformly coated on the solid medium plate, and the punch tool with diameter 5mm punches on substratum 6 symmetrically and evenly then.Accurately draw antibacterial peptide Stomoxyn ZH1 and express sample 80ul, add in the preparation hole of substratum, each indicator is cooked three repetitions.The pathogenic fungi inhibition test then is that activated good pathogenic fungi bacterium piece is connected to substratum (PDA) central authorities, adds corresponding antibacterial peptide Stomoxyn ZH1 then and express sample 80ul in the preparation hole of substratum.Pathogenetic bacteria is in 37 ℃ of cultivation 24h, and pathogenic fungi is cultivated about 2d at 28 ℃, observes inhibition.As can be seen from Figure 4, express sample Stomoxyn ZH1 gram-positive microorganism streptococcus aureus, Gram-negative bacteria intestinal bacteria and fungi rice blast pathogen inhibition is all arranged.
SEQUENCE LISTING
＜110〉Hua Zhong Agriculture University
＜120〉the flat angle of a kind of speck stratiomyiid antibacterial peptide and preparation method and application
＜130〉the flat angle of a kind of speck stratiomyiid antibacterial peptide and preparation method and application
<160> 3
<170> PatentIn version 3.1
<210> 1
<211> 189
<212> DNA
＜213〉the flat angle of speck stratiomyiid
<400> 1
agaggatttc gtaagcattt caacaactta ccaatctgcg tggaaggatt agctggagat 60
attggttcca ttcttcttgg tgttgaatca gatatcggtg cattggctgg tgccatcgcc 120
aatttggctc ttatcgctgg tgaatgcgct gcacaaggtg aagcaggagc tgctgttgtt 180
gctgctact 189
<210> 2
<211> 189
<212> DNA
＜213〉the flat angle of speck stratiomyiid
<400> 2
agaggatttc gtaagcattt taacaactta ccaatctgcg tggaaggatt agctggagat 60
attggttcca ttcttcttgg tgttgaatca gatatcggtg cattggctgg tgccatcgcc 120
aatttggctc ttatcgctgg tgaatgcgct gcacaaggtg aagcaggagc tgctgttgtt 180
gctgctact 189
<210> 3
<211> 63
<212> PRT
＜213〉the flat angle of speck stratiomyiid
<400> 3
Arg Gly Phe Arg Lys His Phe Asn Asn Leu Pro Ile Cys Val Glu Gly
1 5 10 15
Leu Ala Gly Asp Ile Gly Ser Ile Leu Leu Gly Val Glu Ser Asp Ile
20 25 30
Gly Ala Leu Ala Gly Ala Ile Ala Asn Leu Ala Leu Ile Ala Gly Glu
35 40 45
Cys Ala Ala Gln Gly Glu Ala Gly Ala Ala Val Val Ala Ala Thr
50 55 60
Claims (6)
1. the antibacterial peptide gene of a separation, its sequence is shown in the SEQ ID NO.1.
2. the antibacterial peptide gene of a separation, its sequence is shown in the SEQ ID NO.2.
3. the antibacterial peptide of a claim 1 or 2 described genes encodings, its sequence is shown in the SEQ ID NO.3.
4. the application of the described antibacterial peptide of claim 3 in the vitro inhibition streptococcus aureus.
5. the application of the described antibacterial peptide of claim 3 in the vitro inhibition intestinal bacteria.
6. the application of the described antibacterial peptide of claim 3 in the vitro inhibition rice blast pathogen.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012102868787A CN102816769B (en) | 2012-08-13 | 2012-08-13 | Hermetia illucens L antibacterial peptide, preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012102868787A CN102816769B (en) | 2012-08-13 | 2012-08-13 | Hermetia illucens L antibacterial peptide, preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102816769A CN102816769A (en) | 2012-12-12 |
| CN102816769B true CN102816769B (en) | 2013-09-04 |
Family
ID=47301216
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2012102868787A Expired - Fee Related CN102816769B (en) | 2012-08-13 | 2012-08-13 | Hermetia illucens L antibacterial peptide, preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102816769B (en) |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| FR3026746B1 (en) | 2014-10-03 | 2021-09-10 | Pierre Furtos | PROCESS FOR THE PRODUCTION OF TARGET ANTIBIOTICS FROM INSECTS |
| CN104996726B (en) * | 2015-07-10 | 2018-06-15 | 河南恩赛姆生物科技有限公司 | Utilize the method for the flat angle stratiomyiid larva production functional feedstuff additive of speck |
| CN112662698A (en) * | 2017-06-08 | 2021-04-16 | 中国农业科学院饲料研究所 | Preparation method of novel antibacterial peptide DLP4 |
| CN107267547A (en) * | 2017-06-26 | 2017-10-20 | 北京生泰云科技有限公司 | Novel antimicrobial peptide DLP2 preparation method |
| CN111018960B (en) * | 2019-12-04 | 2021-09-10 | 中国农业科学院饲料研究所 | Antibacterial peptide ID13, and preparation method and application thereof |
| CN112812165B (en) * | 2021-02-18 | 2022-03-08 | 华中农业大学 | Hermetia illucens antibacterial peptide Hidefensein 1 and application thereof |
| CN115491253B (en) * | 2022-08-31 | 2023-09-19 | 华中农业大学 | Functional grease with high oleamide content and preparation method and application thereof |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101173005A (en) * | 2007-10-30 | 2008-05-07 | 沈子龙 | Insect antimicrobial peptide Thanatin derivant, producing method and uses of the same |
| CN101328207B (en) * | 2008-05-08 | 2011-05-18 | 华南农业大学 | Citrus fruit fly antibacterial peptide, preparation and use thereof |
-
2012
- 2012-08-13 CN CN2012102868787A patent/CN102816769B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN102816769A (en) | 2012-12-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102816769B (en) | Hermetia illucens L antibacterial peptide, preparation method and application thereof | |
| CN101284876B (en) | Fusion protein Penharpin, preparation method and use | |
| CN104946668A (en) | cry1Ia gene and application thereof, Cry1Ia protein coded by cry1Ia gene, and preparation method and application thereof | |
| CN102146135A (en) | Recombinant human-like collagen and production method thereof | |
| CN109536507A (en) | The peptide and prokaryotic expression preparation method of Bu Shi silvery pomfret Scad antibacterial peptide gene and its coding | |
| CN107653258B (en) | Application of cotton GhLecRK1 gene in plant verticillium wilt resistance | |
| CN103333225A (en) | Antibacterial peptide, preparation method and applications thereof | |
| CN102190718B (en) | Recombined litopenaeus setiferus protein SF-P9, preparation method and application thereof | |
| CN103789317A (en) | Scylla paramamosain antibacterial peptide hyastatin gene clone, encoding protein recombination and application | |
| CN108314714A (en) | Verticillium dahliae secreted protein exciton VdPEL1 and its application | |
| CN106146630A (en) | A kind of mould albumen exciton EPTP and the application in improving disease resistance of plant thereof | |
| CN109021086A (en) | A kind of antibacterial peptide cecropin A mutant and its encoding gene, preparation method and application | |
| CN102703457A (en) | Method for preparing and expressing antibacterial peptide gene | |
| CN102559554A (en) | Bacillus thuringiensis cry1Ca gene, expressed protein and application of bacillus thuringiensis cry1Ca gene | |
| CN108017698B (en) | Garlic antibacterial peptide AR117 and application thereof | |
| CN110004184A (en) | A kind of construction method of banana blight bacteria myosin-1 knock out mutants body | |
| CN102732532A (en) | Application of micromolecular heat shock protein gene improving stress resistance of oryza sativa | |
| CN101864372A (en) | Preparation method of antibacterial peptide gene engineering strain | |
| CN102586262B (en) | Defensin gene of antimicrobial peptide of bemisia tabaci (Gennadius), antimicrobial peptide encoded by defensin gene and preparation method for defensin gene | |
| CN104530204B (en) | A kind of rape cecropin B gene nPRP1 and its application | |
| CN106478789B (en) | From the effector albumen and its encoding gene of grape ulcer bacterium and application | |
| CN102241756B (en) | High expression of tenebrio molitor antibacterial peptide TmAMP3m in escherichia coli and application of TmAMP3m | |
| CN102051363A (en) | Clam ferroprotein gene as well as coding protein and application of in vitro recombinant expression product of same | |
| CN112538490B (en) | NLP gene for inducing necrosis and active oxygen accumulation in preservative mold, and expression vector and application thereof | |
| CN103255096A (en) | Gene engineering bacterium capable of performing high-efficiency expression on Alpha-elaterin-protein and construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130904 Termination date: 20140813 |
|
| EXPY | Termination of patent right or utility model |