CN102776183B - A kind of amplimer of large yellow croaker plastosome whole genome sequence and application thereof - Google Patents
A kind of amplimer of large yellow croaker plastosome whole genome sequence and application thereof Download PDFInfo
- Publication number
- CN102776183B CN102776183B CN201210241493.9A CN201210241493A CN102776183B CN 102776183 B CN102776183 B CN 102776183B CN 201210241493 A CN201210241493 A CN 201210241493A CN 102776183 B CN102776183 B CN 102776183B
- Authority
- CN
- China
- Prior art keywords
- yellow croaker
- amplimer
- large yellow
- whole genome
- genome sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The invention discloses a kind of amplimer and application thereof of large yellow croaker plastosome whole genome sequence, that to be its amplimer be feature is 15 right, gene order is respectively as shown in SEQ ID NO:1-30, also utilize this amplimer acquisition Dai-ju stock Pseudosciaena crocea plastosome whole genome sequence and Fujian-East Guangdong race large yellow croaker plastosome whole genome sequence respectively as SEQ ID NO:31, shown in SEQ ID NO:32, and obtain large yellow croaker high variant area amplimer, advantage is can be quick by above-mentioned 15 pairs of amplimers, obtain Dai-ju stock Pseudosciaena crocea and Fujian-East Guangdong race large yellow croaker plastosome whole genome sequence respectively efficiently, and large yellow croaker high variant area amplimer, for the Identification of Species of large yellow croaker, geographical population are differentiated, the research of germ plasm resource and genetic diversity provides support, for the authentication technique developing Dai-ju stock Pseudosciaena crocea and Fujian-East Guangdong race large yellow croaker further provides basis.
Description
Technical field
The present invention relates to biological technical field, especially relate to a kind of amplimer and application thereof of large yellow croaker plastosome whole genome sequence.
Background technology
Large yellow croaker (Pseudosciaena crocea), have another name called yellow croaker, yellow croaker, be under the jurisdiction of Perciformes (Perciformes), Sciaenidae (Sciaenidae), yellow croaker genus (Pseudosciaena), being one of China's marine fishing Main Commercial Fishes, is the maximum fish species of Chinese seawater cage cultured output.China coast large yellow croaker is roughly divided into tai-chu race, Fujian-East Guangdong race, island in Guangdong Province race three geographical population.Dai-ju stock Pseudosciaena crocea is golden yellow or brave yellow, glossy, the gill filament is clear in scarlet or red-purple, and eyeball is full, brawniness, high resilience, be the superfine product in yellow croaker race, it is mainly distributed in Dai Quyang fishing ground, Zhe Bei Zhoushan, fishes for due to excessive, environmental degradation, current wild Dai-ju stock Pseudosciaena crocea is very rare.Because Fujian-East Guangdong race large yellow croaker is similar with Dai-ju stock Pseudosciaena crocea formalness, be difficult to distinguish, on market, Fujian-East Guangdong race large yellow croaker and Dai-ju stock Pseudosciaena crocea are even obscured sale by some trade companies, and swindle human consumer, therefore carries out species identification and seem very necessary by large yellow croaker similar in profile.
At present, differentiate that fish similar in profile are a kind of very convenient methods accurately by sequence difference, wherein the research of mtDNA sequence difference is a kind of wherein important method.Plastosome is intracellular important organelle, belong to matrocliny and there is self a set of genome, it is semiautonomous organelle, and due to its structure simply, hardly recombinate, the feature such as rate of evolution is fast, different zones rate of evolution there are differences, make that it is differentiated in kind, in the research of phyletic evolution and population genetics application very extensive.Different biological Mitochondrial Genome Overview all demonstrates great diversity in structure, gene number and sequence in the gene mode etc., and therefore the complete sequence research of Mitochondrial Genome Overview becomes the strongest evidence of animal molecular system generation.Chinese patent name is called wise sieve salmon plastosome whole genome sequence and amplimer (application number CN200910073114.8) thereof, Heilongjiang Province boar mitochondrial genom sequence clone and evolutionary analysis (application number: CN200810172959.8) etc. check order to plastosome full-length genome respectively, and the plastosome whole genome sequence of the large yellow croaker of different geographic populations (as Fujian-East Guangdong race large yellow croaker and Dai-ju stock Pseudosciaena crocea) up to the present still undetermined.
Summary of the invention
Technical problem to be solved by this invention is to provide a kind of amplimer and application thereof of large yellow croaker plastosome whole genome sequence; utilize this amplimer can obtain plastosome whole genome sequence and the large yellow croaker high variant area amplimer of different types of large yellow croaker, for the Molecular Identification of the conservative genetics of large yellow croaker, evolutionary genetics and species thereof provides material base.
The present invention solves the problems of the technologies described above adopted technical scheme: a kind of amplimer of large yellow croaker plastosome whole genome sequence, and the amplimer of large yellow croaker plastosome whole genome sequence is 15 right, and gene order is as follows respectively:
(1) upstream primer that large yellow croaker plastosome whole genome sequence amplimer the 1st is right is: 5 '-AGTCAACGGCGTAAAGAGTGG-3 ', and downstream primer is: 5 '-TACCCTTCTGGGAAAGTTGT-3 ';
(2) upstream primer that large yellow croaker plastosome whole genome sequence amplimer the 2nd is right is: 5 '-CCTGGGAAATGAATAGAAGT-3 ', and downstream primer is: 5 '-AAAATCATGGCATAGATAGA-3 ';
(3) upstream primer that large yellow croaker plastosome whole genome sequence amplimer the 3rd is right is: 5 '-TTACGACCTCGATGTTGGATCAG-3 ', downstream primer is: 5 '-GGAAGCACTAGGAGTTTTGAGT-3 '
(4) upstream primer that large yellow croaker plastosome whole genome sequence amplimer the 4th is right is: 5 '-AAGGGCCACTTTGATAGAGTG-3 ', and downstream primer is: 5 '-GTGAGTGCGGGGGTTTTGGCTCA-3 ';
(5) upstream primer that large yellow croaker plastosome whole genome sequence amplimer the 5th is right is: 5 '-TTGCCTACTCCTCAATTGCCCAC-3 ', and downstream primer is: 5 '-CTTATGTTATTCATTCGGGGGAA-3 ';
(6) upstream primer that large yellow croaker plastosome whole genome sequence amplimer the 6th is right is: 5 '-CCTCTACCTAATTTTTGGTGC-3 ', and downstream primer is: 5 '-ATGCGGTTGGCTTGAAATCAA-3 ';
(7) upstream primer that large yellow croaker plastosome whole genome sequence amplimer the 7th is right is: 5 '-AGCACTTGAACAAAAGCTCACTT-3 ', and downstream primer is: 5 '-GTCGAAGAGGCTTACAGTCATGGTCA-3 ';
(8) upstream primer that large yellow croaker plastosome whole genome sequence amplimer the 8th is right is: 5 '-GCAAGCGTTAGCCTTTTAAGC-3 ', and downstream primer is: 5 '-CAGGGGCTGGGGTCTACTAT-3 ';
(9) upstream primer that large yellow croaker plastosome whole genome sequence amplimer the 9th is right is: 5 '-CCTACACTTCTTATCCCTATTCTAAT-3 ', and downstream primer is: 5 '-GGAGAAAGGGAGGCGAGCGGT-3 ';
(10) upstream primer that large yellow croaker plastosome whole genome sequence amplimer the 10th is right is: 5 '-AGTATTAGTGACTTCCAATCA-3 ', and downstream primer is: 5 '-TGTAGAATAGAAAATAAGTGCC-3 ';
(11) upstream primer that large yellow croaker plastosome whole genome sequence amplimer the 11st is right is: 5 '-CCTCTTAACATCCCTGCAAATC-3 ', and downstream primer is: 5 '-TTCCTAAGACCAACGGATGAGC-3 ';
(12) upstream primer that large yellow croaker plastosome whole genome sequence amplimer the 12nd is right is: 5 '-AAAACATTAGATTGTGATTCTAA-3 ', and downstream primer is: 5 '-GACTCGGAGGCTGTAAATAG-3 ';
(13) upstream primer that large yellow croaker plastosome whole genome sequence amplimer the 13rd is right is: 5 '-GCCTGGCCCTCACTGGTACC-3 ', and downstream primer is: 5 '-AGCGGGTGGGTTTTGCGTAG-3 ';
(14) upstream primer that large yellow croaker plastosome whole genome sequence amplimer the 14th is right is: 5 '-CTCTAACCAGGACTAATGGCTTG-3 ', and downstream primer is: 5 '-TGATTATCAATCAATGTCCC-3 ';
(15) upstream primer that large yellow croaker plastosome whole genome sequence amplimer the 15th is right is: 5 '-TCAACATTAATTACCACGCT-3 ', downstream primer is: 5 '-GGGGTATCTAATCCCAGTTT-3 '.
An application for the amplimer of large yellow croaker plastosome whole genome sequence, the Dai-ju stock Pseudosciaena crocea plastosome whole genome sequence that the amplimer described in utilization obtains is as shown in SEQ ID NO:31.
An application for the amplimer of large yellow croaker plastosome whole genome sequence, Fujian-East Guangdong race large yellow croaker plastosome whole genome sequence that the amplimer described in utilization obtains is as shown in SEQ ID NO:32.
An application for the amplimer of large yellow croaker plastosome whole genome sequence, the large yellow croaker high variant area amplimer that the amplimer described in utilization obtains, gene order is as follows:
B1 upstream primer 5 '-AGACCTTCTAGGCTTTGCAATC-3 ',
B1 downstream primer 5 '-GGAGCTTTCTAGGGCTCATCT-3 ';
B2 upstream primer 5 '-TTATTTTCTATTCTACACCCTGGC-3 ',
B2 downstream primer 5 '-AGAGGGAATACCCCGCTGT-3 '.
Compared with prior art, the invention has the advantages that: the present invention makes public for the first time 15 pairs of amplimers of large yellow croaker plastosome whole genome sequence, 15 pairs of amplimers carry out pcr amplification to large yellow croaker sample, obtain the specific amplification products of clip size between 900-1560bp respectively, without the need to high-quality DNA profiling and long-chain round pcr, the success ratio of clone is high, and the product that obtains of the often pair of primer amplification not need walking method direct Sequencing to survey logical, the sequence of adjacent area amplified production has the lap of more than 80bp, facilitate the splicing of sequencing result, can be quick, obtain Dai-ju stock Pseudosciaena crocea and Fujian-East Guangdong race large yellow croaker plastosome whole genome sequence respectively efficiently, and different large yellow croaker is carried out homologous sequence comparison, analysis is carried out to large yellow croaker high variant area sequence and obtains large yellow croaker quick evolving region amplimer, for the Identification of Species of large yellow croaker, geographical population are differentiated, the research of germ plasm resource and genetic diversity provides support, for the authentication technique developing Dai-ju stock Pseudosciaena crocea and Fujian-East Guangdong race large yellow croaker further provides basis.
Accompanying drawing explanation
Fig. 1 is the agarose gel electrophoresis result schematic diagram of Dai-ju stock Pseudosciaena crocea pcr amplification product;
Fig. 2 is the agarose gel electrophoresis result schematic diagram of Fujian-East Guangdong race large yellow croaker pcr amplification product.
Embodiment
Below in conjunction with accompanying drawing embodiment, the present invention is described in further detail.
Specific embodiment one
The amplimer of large yellow croaker plastosome whole genome sequence of the present invention is 15 right, and gene order is as follows:
The amplified production of the primer designed by the present invention should cover whole plastosome full-length genome, and the amplified production length of often pair of primer is at 900-1560bp, and the overlapping sequences that adjacent two pairs of primers obtain is more than 80bp.
Specific embodiment two
The method of design of the amplimer of large yellow croaker plastosome whole genome sequence
One, the screening of template
Log in BCBI(http: //www.ncbi.nlm.nih.gov/) website, search and determinand kind belong to the species mitochondrial genome complete sequence of the even same genus of same section, if there are many sequences can supply to utilize, by blast comparison, the sequence of prioritizing selection and the nearest species of species sibship to be measured.
Two, according to template sequence design primer
Sequence screening obtained is as template, and be designed for the primer of pcr amplification with PCR primer design software Primer Premier5.0, concrete thought is as follows:
1) length of pcr amplification will at below 1600bp, because the generation sequenator ABI3730 order-checking of main flow is read length and can be arrived 800 to 1000bp now, and order-checking accuracy rate is high in 800bp, when therefore designing primer, make positive and negative two-way order-checking once can survey logical and not need step to move;
2) sequence of adjacent area amplified production has the lap of more than 80bp, and before order-checking, the accuracy of about 40bp sequence is low, has the lap of more than 80bp to facilitate the splicing of sequencing result and the accuracy of sequence;
3) avoid the secondary structure district of primer, the invalid or failed reason of order-checking of some primer amplification is the impact of primer iteron secondary structure;
4) length in general Primers complementary district be 19-25bp, G+C content preferably at 45%-55%, there is not continuous G or C more than 3 at 3 ' end, otherwise easily cause non-specific amplification;
5) according to the result of these species or the research of close species Mitochondrial Genome Overview, design of primers is in conserved regions, and as much as possible height variation is comprised to come in, such primer not only can obtain splicing large yellow croaker plastosome whole genome sequence for increasing, can also be used to the polymorphism analyzing different geographic populations.
Specific embodiment three
The Dai-ju stock Pseudosciaena crocea plastosome whole genome sequence that the present invention utilizes 15 pairs of amplimers of large yellow croaker plastosome whole genome sequence to obtain, as shown in SEQ ID NO:31.
Dai-ju stock Pseudosciaena crocea plastosome complete genome sequence altogether 16467bp, containing 22 tRNA, 2 rRNA, and 13 protein coding genes and 1 D-loop district.
Specific embodiment four
Fujian-East Guangdong race large yellow croaker plastosome whole genome sequence that the present invention utilizes 15 pairs of amplimers of large yellow croaker plastosome whole genome sequence to obtain, as shown in SEQ ID NO:32.
Dai-ju stock Pseudosciaena crocea chondriogen composition and with the variance analysis of Fujian-East Guangdong race large yellow croaker in table 2.Dai-ju stock Pseudosciaena crocea and Fujian-East Guangdong race large yellow croaker Mitochondrial Genome Overview total length are 16467bp, 64, difference site, and both similaritys are 99.6%, and 37 genes of encoding altogether, comprise 13 protein coding genes.Outside the tRNA gene order of removing short data records, secondly D-loop regional differentiation the highest (2.01%) between tai-chu race and Fujian-East Guangdong race large yellow croaker chondriogen is ND3(0.86%), CO II (0.72%), ND6(0.57%) and ND 4(0.43%) etc.
Specific embodiment five
Utilize 15 pairs of primer amplifications in above-mentioned specific embodiment one to obtain Dai-ju stock Pseudosciaena crocea and Fujian-East Guangdong race large yellow croaker plastosome whole genome sequence, concrete steps are as follows:
1, the extraction of large yellow croaker Mitochondrial Genome Overview template DNA
1.1 gather tai-chu race, Fujian-individual each 1 tail of East Guangdong race large yellow croaker cultivation, take from Xiangshan of Zhejiang Province Huang in November, 2010 and keep away Ao aquaculture net cage;
1.2 get fish body muscle of back (removing scale and skin) about 0.1g, and phenol/chloroform method extracting large yellow croaker STb gene, saves backup at-20 DEG C;
2, large yellow croaker plastosome full length sequence amplification
2.1 design of primers and pcr amplification
Template DNA: tai-chu race and each 1 of Fujian-East Guangdong race large yellow croaker; The amplimer of amplification large yellow croaker plastosome full length sequence is shown in embodiment 1.The template DNA concentration of PCR reaction is about 100ng, and reaction system cumulative volume is 25 μ L, wherein each 2.5mmol/L of 10 × Buffer 2.5 μ L, dNTPs 4 μ L(), each 1 μ L(10 μm ol/L of primer), Taq enzyme 0.2 μ L(5U/ μ L).PCR reaction conditions is: 95 DEG C of denaturation 3min; 94 DEG C of sex change 45s, 54 DEG C of annealing 45s, 72 DEG C extend 1min30s, 35 circulations; Last 72 DEG C extend 10min.PCR primer adopts test kit to cut glue purification.
Adopt the PCR primer agarose gel electrophoresis result of Dai-ju stock Pseudosciaena crocea template DNA acquisition as shown in Figure 1,1-15 is for template with Dai-ju stock Pseudosciaena crocea STb gene, the band that the amplimer of large yellow croaker plastosome whole genome sequence increases out to 1-15PCR, M:marker; The primer PCR amplification Dai-ju stock Pseudosciaena crocea plastosome whole genome sequence efficiency adopting the present invention to design is high and band is special.
Adopt the PCR primer agarose gel electrophoresis result of Fujian-East Guangdong race large yellow croaker template DNA acquisition as shown in Figure 2,1-15 is for template with Fujian-East Guangdong race large yellow croaker STb gene, the band that the amplimer of large yellow croaker plastosome whole genome sequence increases out to 1-15PCR, M:marker.Fujian-East Guangdong race large yellow croaker plastosome whole genome sequence efficiency is high and band is special to adopt the primer PCR of the present invention's design to increase.
2.2 Cloning and sequencing
15 PCR primer of Dai-ju stock Pseudosciaena crocea and Fujian-East Guangdong race large yellow croaker are distinguished purifying, then spends the night with 4 DEG C, pMD18-T carrier respectively and be connected, transformed competence colibacillus cell E.coli DH5 α.With primer M13F/R random detection, each clone all sends that 3 positive colonies is positive and negative two-wayly to check order, to ensure the accuracy of sequence.
2.3 sequence assembly
Adopt the softwares such as DAMBE, Vector NTI 7.0 to splice respectively the sequencing result of Dai-ju stock Pseudosciaena crocea and Fujian-East Guangdong race large yellow croaker, then the chondriogen full length sequence of Dai-ju stock Pseudosciaena crocea and Fujian-East Guangdong race large yellow croaker is analyzed respectively.
2.4 adopt the chondriogen full length sequence of sequence analysis software to the Dai-ju stock Pseudosciaena crocea obtained and Fujian-East Guangdong race large yellow croaker to carry out structure, functional analysis respectively
| Numbering | Amplification region | Product length | Upstream primer (5 '-3 ') | Downstream primer (5 '-3 ') |
| B1 | 15068-62 | 1462 | AGACCTTCTAGGCTTTGCAATC | GGAGCTTTCTAGGGCTCATCT |
| B2 | 10805-11589 | 785 | TTATTTTCTATTCTACACCCTGGC | AGAGGGAATACCCCGCTGT |
DNAStar software package is utilized to carry out searching of open reading frame to sequence, the acquisition of complementary chain; The ORFfinder software of NCBI website is utilized to complete the translation of albumen coded sequence and the investigation of amino acid coding situation; Compare with the template sequence in the online software of blast and specific embodiment two and determine each chondriogen and other non-coding sequence particular location in the sequence, analytical results is as shown in table 2.
Specific embodiment six
The design of the sequential analysis of large yellow croaker high variant area and amplimer
By the tai-chu race of acquisition and the chondriogen full length sequence of Fujian-each 1 of East Guangdong race large yellow croaker, to compare with Vector NTI7.0 software in conjunction with the large yellow croaker mtDNA complete sequence (sequence number: FJ595214 and NC011710) on NCBI and find out high variant area, at conservative region district design primer pair B1 and B2 at quick evolving region two ends, its gene order is as shown in table 3:
The principle of invention: with 2 pairs of primers; B1 upstream primer 5 '-AGACCTTCTAGGCTTTGCAATC-3 ', B1 downstream primer 5 '-GGAGCTTTCTAGGGCTCATCT-3 '; B2 upstream primer 5 '-TTATTTTCTATTCTACACCCTGGC-3 ', B2 downstream primer 5 '-AGAGGGAATACCCCGCTGT-3 ' carries out pcr amplification to Dai-ju stock Pseudosciaena crocea and Fujian-East Guangdong race large yellow croaker quick evolving region, the laggard row data analysis of cloning and sequencing, two geographical population sample numbers have 25 respectively.Adopt the B1 amplification mitochondrial D-loop region of large yellow croaker, to 2 partial sequence fragment binding analysis in this sequence, detect 2 OTU altogether, be respectively OTU-D1:GGCATTTAGGCACAAGGTC and CTTCTGAGTTGTGCCCCC, OTU-D2:GGCATTTAGGCACAAGGTT and TTTCTGAGTTGTGCCCCC; Tai-chu race 25 samples are D1 type, in Fujian-25, East Guangdong race sample, have 9 for D1 type, have 16 for D2 type.On the basis of above-mentioned experiment, use the primer pair B2 amplification mitochondrial ND4 region of large yellow croaker, to the 2 partial sequence fragments also binding analysis in this sequence, detect 2 OTU, be respectively N1:CAGGCCCCACCATACTAAT and GACAGGAACCGGCACCC, N2:CAGGCCCCACCATACTAAC and AACAGGAACCGGCACCC; Tai-chu race 25 samples are N1 type, in Fujian-9, East Guangdong race D1 type sample, have 4 for N1 type, have 5 for N2 type.
Binding analysis is carried out to the OTU somatotype in above-mentioned D-loop and ND4 region, 3 types can be divided into: D1-N1, D1-N2 and D2.Dai-ju stock Pseudosciaena crocea is D1-N1 type; And 2 types can be divided in Fujian-East Guangdong race large yellow croaker: D1-N2 type and D2 type,
Certainly, above-mentioned explanation is not limitation of the present invention, and the present invention is also not limited to above-mentioned citing.Those skilled in the art are in essential scope of the present invention, and the change made, remodeling, interpolation or replacement, also should belong to protection scope of the present invention.
Claims (4)
1. an amplimer for large yellow croaker plastosome whole genome sequence, it is characterized in that the amplimer of large yellow croaker plastosome whole genome sequence is 15 right, gene order is as follows respectively:
(1) upstream primer that large yellow croaker plastosome whole genome sequence amplimer the 1st is right is: 5 '-AGTCAACGGCGTAAAGAGTGG-3 ', and downstream primer is: 5 '-TACCCTTCTGGGAAAGTTGT-3 ';
(2) upstream primer that large yellow croaker plastosome whole genome sequence amplimer the 2nd is right is: 5 '-CCTGGGAAATGAATAGAAGT-3 ', and downstream primer is: 5 '-AAAATCATGGCATAGATAGA-3 ';
(3) upstream primer that large yellow croaker plastosome whole genome sequence amplimer the 3rd is right is: 5 '-TTACGACCTCGATGTTGGATCAG-3 ', downstream primer is: 5 '-GGAAGCACTAGGAGTTTTGAGT-3 '
(4) upstream primer that large yellow croaker plastosome whole genome sequence amplimer the 4th is right is: 5 '-AAGGGCCACTTTGATAGAGTG-3 ', and downstream primer is: 5 '-GTGAGTGCGGGGGTTTTGGCTCA-3 ';
(5) upstream primer that large yellow croaker plastosome whole genome sequence amplimer the 5th is right is: 5 '-TTGCCTACTCCTCAATTGCCCAC-3 ', and downstream primer is: 5 '-CTTATGTTATTCATTCGGGGGAA-3 ';
(6) upstream primer that large yellow croaker plastosome whole genome sequence amplimer the 6th is right is: 5 '-CCTCTACCTAATTTTTGGTGC-3 ', and downstream primer is: 5 '-ATGCGGTTGGCTTGAAATCAA-3 ';
(7) upstream primer that large yellow croaker plastosome whole genome sequence amplimer the 7th is right is: 5 '-AGCACTTGAACAAAAGCTCACTT-3 ', and downstream primer is: 5 '-GTCGAAGAGGCTTACAGTCATGGTCA-3 ';
(8) upstream primer that large yellow croaker plastosome whole genome sequence amplimer the 8th is right is: 5 '-GCAAGCGTTAGCCTTTTAAGC-3 ', and downstream primer is: 5 '-CAGGGGCTGGGGTCTACTAT-3 ';
(9) upstream primer that large yellow croaker plastosome whole genome sequence amplimer the 9th is right is: 5 '-CCTACACTTCTTATCCCTATTCTAAT-3 ', and downstream primer is: 5 '-GGAGAAAGGGAGGCGAGCGGT-3 ';
(10) upstream primer that large yellow croaker plastosome whole genome sequence amplimer the 10th is right is: 5 '-AGTATTAGTGACTTCCAATCA-3 ', and downstream primer is: 5 '-TGTAGAATAGAAAATAAGTGCC-3 ';
(11) upstream primer that large yellow croaker plastosome whole genome sequence amplimer the 11st is right is: 5 '-CCTCTTAACATCCCTGCAAATC-3 ', and downstream primer is: 5 '-TTCCTAAGACCAACGGATGAGC-3 ';
(12) upstream primer that large yellow croaker plastosome whole genome sequence amplimer the 12nd is right is: 5 '-AAAACATTAGATTGTGATTCTAA-3 ', and downstream primer is: 5 '-GACTCGGAGGCTGTAAATAG-3 ';
(13) upstream primer that large yellow croaker plastosome whole genome sequence amplimer the 13rd is right is: 5 '-GCCTGGCCCTCACTGGTACC-3 ', and downstream primer is: 5 '-AGCGGGTGGGTTTTGCGTAG-3 ';
(14) upstream primer that large yellow croaker plastosome whole genome sequence amplimer the 14th is right is: 5 '-CTCTAACCAGGACTAATGGCTTG-3 ', and downstream primer is: 5 '-TGATTATCAATCAATGTCCC-3 ';
(15) upstream primer that large yellow croaker plastosome whole genome sequence amplimer the 15th is right is: 5 '-TCAACATTAATTACCACGCT-3 ', downstream primer is: 5 '-GGGGTATCTAATCCCAGTTT-3 '.
2. the application of the amplimer of a large yellow croaker plastosome whole genome sequence according to claim 1, it is characterized in that: its amplimer be applied as described in utilization obtains Dai-ju stock Pseudosciaena crocea plastosome whole genome sequence as shown in SEQ ID NO:31, wherein the reagent of PCR reaction is: Dai-ju stock Pseudosciaena crocea template DNA concentration is 100ng, reaction system cumulative volume is 25 μ L, wherein 10 × Buffer 2.5 μ L, 2.5mmol/L dNTPs 4 μ L, 10 μm of each 1 μ L of ol/L amplimer according to claim 1, 5U/ μ L Taq enzyme 0.2 μ L, PCR reaction conditions is: 95 DEG C of denaturation 3min, 94 DEG C of sex change 45s, 54 DEG C of annealing 45s, 72 DEG C extend 1min30s, 35 circulations, last 72 DEG C extend 10min.
3. the application of the amplimer of a large yellow croaker plastosome whole genome sequence according to claim 1, it is characterized in that: its amplimer be applied as described in utilization obtains Fujian-East Guangdong race large yellow croaker plastosome whole genome sequence as shown in SEQ ID NO:32, wherein the reagent of PCR reaction is: Fujian-East Guangdong race large yellow croaker template DNA concentration is 100ng, reaction system cumulative volume is 25 μ L, wherein 10 × Buffer 2.5 μ L, 2.5mmol/LdNTPs 4 μ L, 10 μm of each 1 μ L of ol/L amplimer according to claim 1, 5U/ μ L Taq enzyme 0.2 μ L, PCR reaction conditions is: 95 DEG C of denaturation 3min, 94 DEG C of sex change 45s, 54 DEG C of annealing 45s, 72 DEG C extend 1min30s, 35 circulations, last 72 DEG C extend 10min.
4. the application of the amplimer of a large yellow croaker plastosome whole genome sequence according to claim 1, it is characterized in that: the amplimer described in application obtains Dai-ju stock Pseudosciaena crocea plastosome whole genome sequence as shown in SEQ IDNO:31, amplimer described in application obtains Fujian-East Guangdong race large yellow croaker plastosome whole genome sequence as shown in SEQ ID NO:32, by the tai-chu race of acquisition and the chondriogen full length sequence of Fujian-each 1 of East Guangdong race large yellow croaker, compare in conjunction with large yellow croaker mtDNA complete sequence Vector NTI 7.0 software that is FJ 595214 and NC011710 of the sequence number on NCBI and find out high variant area, conservative region district design large yellow croaker high variant area amplimer at quick evolving region two ends is to B1 and B2, its gene order is as follows:
B1 upstream primer 5 '-AGACCTTCTAGGCTTTGCAATC-3 ',
B1 downstream primer 5 '-GGAGCTTTCTAGGGCTCATCT-3 ';
B2 upstream primer 5 '-TTATTTTCTATTCTACACCCTGGC-3 ',
B2 downstream primer 5 '-AGAGGGAATACCCCGCTGT-3 '.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210241493.9A CN102776183B (en) | 2012-07-12 | 2012-07-12 | A kind of amplimer of large yellow croaker plastosome whole genome sequence and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210241493.9A CN102776183B (en) | 2012-07-12 | 2012-07-12 | A kind of amplimer of large yellow croaker plastosome whole genome sequence and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102776183A CN102776183A (en) | 2012-11-14 |
| CN102776183B true CN102776183B (en) | 2015-08-12 |
Family
ID=47121291
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210241493.9A Active CN102776183B (en) | 2012-07-12 | 2012-07-12 | A kind of amplimer of large yellow croaker plastosome whole genome sequence and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102776183B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| TWI643866B (en) * | 2017-08-17 | 2018-12-11 | 陳喆洺 | Primer pairs for lates calcarifer, mitochondrial hypervariable region and method for detecting perch dna by using the primer pairs |
Families Citing this family (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103074335B (en) * | 2012-11-22 | 2014-07-09 | 浙江海洋学院 | Goby mitochondrion COIII and ND3 gene amplimer, design and amplification method |
| CN104911182B (en) * | 2015-06-01 | 2018-05-22 | 中国水产科学研究院 | Fish mitochondria complete genome DNA expands |
| CN107449853B (en) * | 2017-04-20 | 2018-09-28 | 宁波大学 | A method of differentiating tai-chu race and Fujian-East Guangdong race Larimichthys crocea |
| CN107557478A (en) * | 2017-09-15 | 2018-01-09 | 中国长江三峡集团公司中华鲟研究所 | A kind of method and its application that amplification the Changjiang river fish chondriogen total order is combined based on degenerate primer |
| CN109868272B (en) * | 2019-03-18 | 2020-07-24 | 湖南农业大学 | Amplification primer and amplification method of blackhead red-headed mouse mitochondrion whole genome sequence |
| CN110684850A (en) * | 2019-09-04 | 2020-01-14 | 浙江海洋大学 | Primer sequence and method for rapidly identifying large and small yellow croakers |
| CN110846381A (en) * | 2019-11-08 | 2020-02-28 | 河南师范大学 | Primer combination for amplification of carp mitochondrial DNA fragment and application thereof |
| CN112725466A (en) * | 2021-02-20 | 2021-04-30 | 安徽农业大学 | Amplification primer and amplification method of chicken mitochondrial whole genome sequence |
| CN113046445B (en) * | 2021-03-30 | 2022-02-08 | 拱北海关技术中心 | DNA barcodes, primers, kit and method for identifying vertebrates |
| CN114686600B (en) * | 2022-02-24 | 2023-12-12 | 宁波大学 | Primer group and method for meat detection based on seven-fold PCR technology |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101698842A (en) * | 2009-10-22 | 2010-04-28 | 厦门大学 | Amplification primer for grouper catostomidae mitochondrial genome complete sequence and design method thereof |
| CN101724630A (en) * | 2008-10-24 | 2010-06-09 | 刘娣 | Complete sequence cloning and evolutionary analysis on boar mitochondrial genome in Heilongjiang Province |
-
2012
- 2012-07-12 CN CN201210241493.9A patent/CN102776183B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101724630A (en) * | 2008-10-24 | 2010-06-09 | 刘娣 | Complete sequence cloning and evolutionary analysis on boar mitochondrial genome in Heilongjiang Province |
| CN101698842A (en) * | 2009-10-22 | 2010-04-28 | 厦门大学 | Amplification primer for grouper catostomidae mitochondrial genome complete sequence and design method thereof |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| TWI643866B (en) * | 2017-08-17 | 2018-12-11 | 陳喆洺 | Primer pairs for lates calcarifer, mitochondrial hypervariable region and method for detecting perch dna by using the primer pairs |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102776183A (en) | 2012-11-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102776183B (en) | A kind of amplimer of large yellow croaker plastosome whole genome sequence and application thereof | |
| Laamanen et al. | Diversity of Aphanizomenon flos-aquae (cyanobacterium) populations along a Baltic Sea salinity gradient | |
| CN100532573C (en) | Method of screening pacific oyster EST micro-satellite mark | |
| Garczarek et al. | High vertical and low horizontal diversity of Prochlorococcus ecotypes in the Mediterranean Sea in summer | |
| Köhnemann et al. | The validation of a 15 STR multiplex PCR for Cannabis species | |
| CN103789301B (en) | The Auele Specific Primer of Portunus trituberculatus Miers microsatellite marker and screening method | |
| CN101712996A (en) | Method for quickly identifying categories of meat and dried meat products of five domestic animals | |
| Pegueroles et al. | Gene flow and gene flux shape evolutionary patterns of variation in Drosophila subobscura | |
| WO2016064264A1 (en) | Multiplex pcr kit for the detection of pig, dog, cat, rat and monkey derived materials for halal authentication | |
| Abbadi et al. | Species identification of bivalve molluscs by pyrosequencing | |
| CN102140522A (en) | Detection method for Apostichopus japonicas AjE101 micro-satellite DNA label | |
| Wirgin et al. | Stock identification of Atlantic cod in US waters using microsatellite and single nucleotide polymorphism DNA analyses | |
| CN105349671A (en) | Microsatellite sequence suitable for analyzing Qingxi black turtle group and screening method | |
| CN101818195B (en) | Genetic marker by taking pig miR-27a precursor flanking sequence SNP as trait of litter size of pig and application | |
| CN102876777B (en) | The special primer of brown croaker EST microsatellite marker and screening method | |
| CN104004750B (en) | A kind of SNP marker relevant to mitten crab sexual prematurity proterties and application thereof | |
| CN102321750A (en) | Method for rapidly screening bian chicken weight gain degree by molecular marking | |
| Buczkowska et al. | The development of species-specific SCAR markers for delimitation of Calypogeia species | |
| Nelson et al. | Temporal patterns of microbial community structure in the Mid-Atlantic Bight | |
| Bray et al. | Convergence and novelty in adaptation to whole genome duplication in three independent polyploids | |
| CN105504037A (en) | Gene and application thereof | |
| Singh et al. | Phylogeography and population expansion of Western Himalayan highly-erratically migratory painted lady butterfly (Lepidoptera: Nymphalidae: Vanessa cardui) | |
| KR102017236B1 (en) | The primer set for analysis of cephalopods and methods for their qualitativeand quantitative analysis | |
| Garcia-Vazquez et al. | Mislabeling of two commercial North American hake species suggests underreported exploitation of offshore hake | |
| KR20160025124A (en) | Identification of Cervus nippon hortulorum for DNA testing |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |