CN102766690A - Primer groups, kit and method for detecting specific sequence of glyphosate-resistant transgenic soybean transformant - Google Patents
Primer groups, kit and method for detecting specific sequence of glyphosate-resistant transgenic soybean transformant Download PDFInfo
- Publication number
- CN102766690A CN102766690A CN2012102424061A CN201210242406A CN102766690A CN 102766690 A CN102766690 A CN 102766690A CN 2012102424061 A CN2012102424061 A CN 2012102424061A CN 201210242406 A CN201210242406 A CN 201210242406A CN 102766690 A CN102766690 A CN 102766690A
- Authority
- CN
- China
- Prior art keywords
- primer
- lectin
- sample
- genetically engineered
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses primer groups, a kit and a method for detecting a specific sequence of a glyphosate-resistant transgenic soybean transformant. Two groups of LAMP (loop-mediated isothermal amplification) primers are designed, the primer group 1 is used for detecting an internal reference gene Lectin and can detect soybean ingredients in a sample and simultaneously exclude false negative results, and the primer group 2 is used for detecting the specific sequence of the glyphosate-resistant transgenic soybean transformant, has high specificity and can effectively detect glyphosate-resistant transgenic soybean ingredients, wherein the sequence is a boundary sequence which connects an inserted exogenous gene with a plant gene. When the kit is used for the detection and analysis of a sample, a positive control, a blank control and an internal control are respectively set, so that the production of false positives and false negatives can be avoided. Special equipment is not required for detection, and the detection cost is low; and the detection results can be judged by visual observation of changes in color of a reaction solution, the identification is simple and convenient to perform, the results are visualized, and the primer groups, the kit and the method disclosed by the invention are suitable for field fast detection and grassroots screening of a large number of samples and easy to realize large-range popularization and application.
Description
Technical field
The invention belongs to field of biological detection, be specifically related to a kind of primer sets, test kit and method that is used to detect resistance glyphosate genetically engineered soybean specificity of transformant sequence.
Background technology
Along with developing rapidly of genetically modified organism, its security causes heated argument and common concern in the world.For ensureing human consumer's right to know and preference; Corresponding laws and rules has all been formulated in many in the world countries and regions; Reinforcement is to importing and exporting the management of transgenic product, and this is brought bigger challenge for the genetically modified organism security control provides the transgenic testing of technical support.The method that detects transgenic product has a lot, mainly is divided into detection and two big types of the detections that is directed against exogenous nucleic acid to exogenous protein.But transgenic product, through the multi-program processing treatment, by sex change, destruction, recall rate is lower for most protein.So the detection to exogenous nucleic acid is more general.
The exogenous nucleic acid that changes in the transgenic product generally comprises promotor, marker gene, goal gene and terminator, increases to analyze to these genes and can screen the transgene component that detects in the sample to be checked.According to the difference that detects target, the detection method of transgenic product is divided into examination method, gene specific detection method, structure specific detection method, 4 levels of transformation event specific detection method, and the specificity of detection from low to high.Transformation event specific detection method is to detect to the border sequence (being the specificity of transformant sequence) that the exogenous array that inserts is connected with Plant Genome.Owing to insert the uniqueness in site; The transformation event specific detection has higher specificity and accuracy; Not only can judge and whether contain transgene component in the sample to be checked; But also can identify specifically which kind of transgenic strain sample to be checked contains, therefore comparing other 3 kinds of methods has better specificity.
The resistance glyphosate genetically engineered soybean occupies 47% of global genetically modified crops cultivated area as main genetically modified crops, and is the trend that increases year by year.China is as the sale big country of genetically engineered soybean; Annual from 1,500 ten thousand tons of soybean of the about import of the U.S. (with China self-produced non-transgenic soybean quantity suitable); All contain transgene component mostly; That is to say that nearly half the soya-bean oil, bean curd, soymilk and other bean product all are genetically modified on the home market.
The regular-PCR method and the fluorescence quantitative PCR method of multiple detection resistance glyphosate genetically engineered soybean have been set up at present both at home and abroad; These methods all need the instrument (like PCR appearance, real-time PCR appearance) of special reagent (like fluorescent probe) and complex and expensive, are inappropriate for the on-the-spot rapid detection and the universal use of basic unit.
(Loop-mediated isothermal amplification LAMP) is the constant temperature nucleic acid amplification method that is equaled a kind of novelty of exploitation in 2000 by the Japanese Notomi T of Eiken Chemical to loop-mediated isothermal amplification technique.This techniques make use is a kind of, and to have a strand displacement active
BstArchaeal dna polymerase can be realized a large amount of amplifications of nucleic acid constant temperature (about 65 ℃) insulation 30-60 minute.Be characterized in simple to operate, quick, specificity is high, with low cost, so thought to substitute a kind of new nucleic acid amplification technique of PCR by numerous investigators.
Wang Yong in 2007, Lan Qing are wealthy etc. has reported and has a kind ofly carried out the LAMP method that the resistance glyphosate genetically engineered soybean detects to the cp4-epsps gene, and this is owned by France to detect in gene specific.But because the cp4-epsps gene is as a kind of good resistant gene that promotes the well-being of mankind; Changed over to the genetically modified crops that form different strains in the different strains of various crop or crop of the same race, this detection method obviously effectively specificity distinguish genetically modified crops and strain thereof with identical resistance glyphosate resistance.Cao had also set up a kind of LAMP detection kit that detects genetically engineered soybean with sincere grade in 2011; This test kit is to carry out augmentation detection to external source EPSPS-NOS gene; But the EPSPS-NOS gene order not merely only is present in the resistance glyphosate genetically engineered soybean, can not detect resistance glyphosate genetically engineered soybean composition specifically.Therefore to the resistance glyphosate genetically engineered soybean set up a kind of special, be suitable for field quick detection and the transformation event method for detecting specificity applied has very important significance on a large scale.
Summary of the invention
One object of the present invention is to provide the detection primer sets of a kind of resistance glyphosate genetically engineered soybean and processed goods thereof.
Another object of the present invention is to provide the detection kit of a kind of resistance glyphosate genetically engineered soybean and processed goods thereof.
Another object of the present invention is to provide the detection method of a kind of resistance glyphosate genetically engineered soybean and processed goods thereof.
The technical scheme that the present invention adopted is:
The detection primer sets of resistance glyphosate genetically engineered soybean and processed goods thereof comprises primer sets 1 and primer sets 2, and wherein, primer sets 1 comprises outer primer Lectin-F3, Lectin-B3 and inner primer Lectin-FIP, Lectin-BIP, and sequence is following:
Lectin-?F3?GCCGAAGCAACCAAACATG（SEQ?ID?NO:1）；
Lectin-B3?GGGGCATAGAAGGTGAAGTT（SEQ?ID?NO:2）；
Lectin-FIP?TGGGGTGCCGTTTTCGTCAACATCCTCCAAGGAGACGCTAT（SEQ?ID?NO:3）；
Lectin-BIP?ACCCTCGTCTCTTGGTCGCG-GGCAACGCTACCGGTTTC（SEQ?ID?NO:4）；
RR-F3?ATAGGGAACCCAAATGGAA（SEQ?ID?NO:5）；
RR-B3?TTGTGCGTCATCCCTTAC（SEQ?ID?NO:6）；
RR-FIP?GGCATCTTGAACGATAGCCTTTCAAGGAAGGTGGCTCCTAC（SEQ?ID?NO:7）；
RR-BIP?CACGAGGAGCATCGTGGAAATCAGTGGAGATATCACATCAA（SEQ?ID?NO:8）。
The detection kit of resistance glyphosate genetically engineered soybean and processed goods thereof comprises: the primer sets 1 that (1) is above-mentioned; (2) primer sets 2; (3) Bst archaeal dna polymerase; (4) LAMP reaction solution; (5) staining agent; (6) internal reference; (7) positive control.
The interpolation mol ratio of outer primer and inner primer is 1:8 in the primer sets 1; The interpolation mol ratio of outer primer and inner primer is 1:8 in the primer sets 2.
The LAMP reaction solution is by 0. 2 mol/L Mg
2SO
4, 25 mmol/L dNTP, 10 * Bst buffer, 5 mol/L trimethyl-glycines form in the ratio proportioning of 1:4:10:20.
Staining agent is SYBR Green.
Internal reference is for containing the recombinant plasmid of soybean internal reference gene Lectin (SEQ ID NO:9); Positive control is for containing the recombinant plasmid of resistance glyphosate genetically engineered soybean specificity of transformant sequence (SEQ ID NO:10).
The used carrier of the recombinant plasmid of internal reference and positive control is the pMDl8-T carrier.
Utilize the mentioned reagent box to detect the method for resistance glyphosate genetically engineered soybean and processed goods thereof, comprise the steps:
(1) extracts purifying sample DNA to be checked;
(2) the LAMP method detects;
(3) result judges: if internal reference, positive control are positive in the step (2); Blank is negative; And sample Lectin gene test is positive, resistance glyphosate genetically engineered soybean specificity of transformant sequential detection is positive, and shows that then sample to be checked contains resistance glyphosate genetically engineered soybean composition.
Beneficial effect of the present invention is:
1, the present invention has designed 2 groups of LAMP primers, and primer sets 1 detects internal reference gene Lectin, can detect the soybean components in the sample, can get rid of false negative result simultaneously; Primer sets 2 detects the specificity of transformant sequence of resistance glyphosate genetically engineered soybean, and this sequence has high degree of specificity for the border sequence that the foreign gene that inserts is connected with Plant Genome, can effectively detect resistance glyphosate genetically engineered soybean composition.
2, test kit of the present invention has been developed positive control and internal reference thing voluntarily, is used for being provided with positive control, blank and internal reference respectively when sample detection is analyzed, and can avoid false positive and false-negative generation.
3, detection kit of the present invention is under constant temperature, to carry out augmentation detection, and a thermostat water bath just can satisfy requirement of experiment, does not need special devices, and it is low to detect cost; Detected result can judge through visual inspection through the colour-change of reaction solution, identify easy, result visualization; Be applicable to the examination of field quick detection and basic unit's large sample amount, be easy to apply on a large scale.
Description of drawings
Fig. 1 be detection method of the present invention colour developing as a result synoptic diagram (1, green, the positive; 2, orange, feminine gender).
Fig. 2 is sensitivity analysis result (1.2000000copies/ μ l, 2.200000copies/ μ l, the 3.20000copies/ μ l of specificity of transformant sequential detection; 4.2000copies/ μ l, 5.200copies/ μ l, 6.20copies/ μ l; 7.2copies/ μ l, 8.balnk.
Fig. 3 is specificity analyses result (A primer sets 1 detected result: 1. resistance glyphosate genetically engineered soybean, 2. non-transgenic soybean, 3. transgenic paddy rice TT51-1; 4. transgene rape RT73; 5. transgenic beet H7-1,6. transgenic corns MON810,7. transgenic corns Bt176; 8. internal reference, 9. blank; B primer sets 2 detected results: 1. resistance glyphosate genetically engineered soybean, 2. non-transgenic soybean, 3. transgenic paddy rice TT51-1; 4. transgene rape RT73,5. transgenic beet H7-1,6. transgenic corns MON810; 7. transgenic corns Bt176,8. positive control, 9. blank).
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.These embodiment only be used to the present invention is described and be not used in the restriction scope of the present invention.The experimental technique of unreceipted actual conditions in the following example; Usually operate according to normal condition; The molecular cloning write such as Sambrook for example: laboratory manual (New York: Cold Spring Harbor Laboratory Press; 2001) condition described in, or the condition of advising according to manufacturer.
Embodiment 1: the development of resistance glyphosate genetically engineered soybean detection kit
Resistance glyphosate genetically engineered soybean detection kit of the present invention is by (1) Bst archaeal dna polymerase; (2) primer sets 1; (3) primer sets 2; (4) reaction solution; (5) staining agent (SYBR Green); (6) internal reference; (7) positive control is formed, and wherein Bst archaeal dna polymerase, reaction solution, colour developing liquid etc. can be bought by corresponding company, are development voluntarily and detect primer sets, internal reference and positive control.
One, experiment material
The resistance glyphosate genetically engineered soybean
Two, reagent
BstDNA polysaccharase, 10 *
BstBuffer is available from U.S. New England Biolabs company; Trimethyl-glycine is available from U.S. Sigma company; DNTP, MgSO4 analytical pure, Premix
TaqArchaeal dna polymerase, pMD18-T carrier, dna molecular amount Marker, transgenic genome DNA extracting reagent kit (GMO DetectionVer.2.0) are available from precious biotechnology (Dalian) ltd; The little extraction reagent kit of plasmid is available from OMEGA company; DH5 ɑ bacterial strain is preserved for this laboratory; Primer is synthetic by the prompt basic biotechnology in the English Weihe River, Shanghai Services Co., Ltd.
Three, key instrument equipment
C1000 type PCR appearance (Bio-Rad Laboratories, Inc.)
Gel type gel imaging system (Bio-Rad Laboratories, Inc.)
Biophotometer plus ultraviolet spectrophotometer (Eppendorf, Inc.)
Other instruments comprise: thermostat water bath, whizzer, constant incubator, electronic balance, micropipet etc.
Four, experimental technique and process
1, the design of primer sets
Obtain the internal reference gene Lectin (GenBank K00821) and the specificity of transformant sequence (GenBank GQ870263) of resistance glyphosate genetically engineered soybean through the relevant domestic and foreign literature data of GenBank inquiry with retrieval.Sequence information according to obtaining utilizes online http://primerexplorer.jp/e/PrimerExploerV4 software to design 2 groups of primers respectively, is respectively applied for amplification Lectin gene and resistance glyphosate genetically engineered soybean specificity of transformant sequence.Lectin gene amplification primer comprises outer primer Lectin-F3, Lectin-B3 and inner primer Lectin-FIP, Lectin-BIP; Specificity of transformant sequence amplification primer is made up of outer primer RR-F3, RR-B3 and inner primer RR-FIP, RR-BIP.Primer sequence is seen table 1.
2, the preparation of internal reference and positive control
2. 1 total DNA extraction
(1) takes by weighing in resistance glyphosate genetically engineered soybean standard substance 1g to the 50mL centrifuge tube.
(2) CTAB that adds 10 mL65 ℃ preheating extracts damping fluid and RNase A enzyme, put upside down behind the mixing in 65 ℃ of incubation 30min, during put upside down the mixing centrifuge tube 2-3 time, 12000 rpm whizzers, centrifugal 10min, transferase 12-4mL supernatant is to the 10mL centrifuge tube.
(3) add and the isopyknic trichloromethane of supernatant, put upside down mixing after, 12000 rpm whizzers, centrifugal 10min shifts supernatant to the 10mL centrifuge tube.
(4) add the CTAB precipitated liquid of 2 * volume, put upside down mixing after, room temperature leaves standstill 1h; 12000 rpm whizzers, centrifugal 10min abandons supernatant.
(5) in deposition, add 400 μ L sodium chloride solutions, make resolution of precipitate, shift lysate to the 1.5mLEppendorf centrifuge tube.
(6) in lysate, add the equal-volume trichloromethane, put upside down mixing, with 12000 rpm whizzers, centrifugal 10min shifts the upper strata water to the 1.5mLEppendorf centrifuge tube.
(7) add the Virahol of 4 ℃ of precoolings of 0.6 times of volume, put upside down mixing after, leave standstill 30 min, 4 ℃ of 12000 rpm whizzer, centrifugal 10min, careful abandoning supernatant under 4 ℃.
(8) 70% ethanol of adding 700 μ L4 ℃ precoolings, the inclination centrifuge tube, behind the light revolution circle, 4 ℃ of 12000 rpm whizzer, centrifugal 10min, careful abandoning supernatant.
(9) repeat once, volatilize liquid in room temperature or the nucleic acid vacuum drying system.
(10) add the dissolving of 50 μ LTE buffered soln, adjustment concentration to 100 μ g/mL ,-20 ℃ of preservations are subsequent use.
2. 2 pcr amplifications
2.2.1 the pcr amplification of internal reference Lectin gene
Utilizing primer Lectin-F3 and Lectin-B3 in the table 1, is template with resistance glyphosate genetically engineered soybean standard substance genomic dna, carries out pcr amplification, and reaction system and program are seen table 2 and table 3, obtains the Lectin gene (SEQ ID NO:9) of 207bp.
2.2.2 the pcr amplification of positive control specificity of transformant sequence
With resistance glyphosate genetically engineered soybean standard substance genomic dna is template, utilizes primer RR-F3 and RR-B3 in the table 1 to carry out pcr amplification, and reaction system and program are seen table 2 and table 3.Obtain the specificity of transformant sequence (SEQ ID NO:10) of 214bp.
2. the structure of 3 internal references and positive control
According to pMDl8-T support agent box specification sheets, the PCR product of Lectin gene and specificity of transformant sequence is building up on the carrier respectively, and transforms DH5a competence bacterial strain, construction recombination plasmid pMDl8-Lectin and pMDl8-RR.Utilize bacterium colony PCR that recombinant bacterial strain is identified, confirm that through sequencing analysis the exogenous array in the recombinant plasmid is consistent with expection.
2. the preparation of 4 internal references and positive control
Extract plasmid pMDl8-Lectin and pMDl8-RR respectively as the internal reference and the positive control of test kit of the present invention according to the plasmid extraction kit specification sheets.The uv-spectrophotometric appearance detects DNA purity and concentration, with ultrapure water DNA is diluted to 50 μ g/mL.
Embodiment 2: the application of resistance glyphosate genetically engineered soybean detection kit
One, experiment material
The resistance glyphosate genetically engineered soybean.
The non-transgenic soybean.
Other transgenic lines: transgenic paddy rice TT51-1, transgene rape RT73, transgenic beet H7-1, transgenic corns MON810, transgenic corns Bt176.
Two, reagent
BstDNA polysaccharase, 10 *
BstBuffer is available from U.S. New England Biolabs company; Trimethyl-glycine is available from U.S. Sigma company; DNTP, MgSO4 analytical pure, transgenic genome DNA extracting reagent kit (GMO DetectionVer.2.0) are available from precious biotechnology (Dalian) ltd; Primer is synthetic by the prompt basic biotechnology in the English Weihe River, Shanghai Services Co., Ltd.
Three, key instrument equipment
Gel type gel imaging system (Bio-Rad Laboratories, Inc.)
Biophotometer plus ultraviolet spectrophotometer (Eppendorf, Inc.)
Other instruments comprise: thermostat water bath, whizzer, constant incubator, electronic balance, micropipet etc.
Four, experimental technique and process
1, the foundation of test kit detection architecture
1.1 the foundation of internal reference detection architecture
Utilizing the primer sets 1 in the table 1, is template with the pMDl8-Lectin recombinant plasmid dna, carries out the LAMP amplification, and reaction system and program are seen table 4 and table 5.
1.2 the foundation of positive control detection architecture
Utilizing the primer sets 2 in the table 1, is template with the pMDl8-RR recombinant plasmid dna, carries out the LAMP amplification, and reaction system and program are seen table 6 and table 7.
2, the operation instruction of test kit
2. the extraction of 1 sample DNA
(1) takes by weighing the 1g sample to the 50mL centrifuge tube.
(2) CTAB that adds 10 mL65 ℃ preheating extracts damping fluid and Rnase A enzyme, put upside down behind the mixing in 65 ℃ of incubation 30min, during put upside down the mixing centrifuge tube 2-3 time, 12000 rpm whizzers, centrifugal 10min, transferase 12-4mL supernatant is to the 10mL centrifuge tube.
(3) add and the isopyknic trichloromethane of supernatant, put upside down mixing after, 12000 rpm whizzers, centrifugal 10min shifts supernatant to the 10mL centrifuge tube.
(4) add the CTAB precipitated liquid of 2 * volume, put upside down mixing after, room temperature leaves standstill 1h; 12000 rpm whizzers, centrifugal 10min abandons supernatant.
(5) in deposition, add 400 μ L sodium chloride solutions, make resolution of precipitate, shift lysate to the 1.5mLEppendorf centrifuge tube.
(6) in lysate, add the equal-volume trichloromethane, put upside down mixing, with 12000 rpm whizzers, centrifugal 10min shifts the upper strata water to the 1.5mLEppendorf centrifuge tube.
(7) add the Virahol of 4 ℃ of precoolings of 0.6 times of volume, put upside down mixing after, leave standstill 30 min, 4 ℃ of 12000 rpm whizzer, centrifugal 10min, careful abandoning supernatant under 4 ℃.
(8) 70% ethanol of adding 700 μ L4 ℃ precoolings, the inclination centrifuge tube, behind the light revolution circle, 4 ℃ of 12000 rpm whizzer, centrifugal 10min, careful abandoning supernatant.
(9) repeat once, volatilize liquid in room temperature or the nucleic acid vacuum drying system.
(10) add the dissolving of 50 μ LTE buffered soln, adjustment concentration to 100 μ g/mL ,-20 ℃ of preservations are subsequent use.
2. the detection of 2 sample DNAs
Each sample needs to carry out respectively simultaneously the augmentation detection of primer sets 1 (being undertaken by detection architecture 1) and primer sets 2 (being undertaken by detection architecture 2).Detection architecture 1 is provided with internal reference and blank, and detection architecture 2 is provided with positive control and blank.It is green that positive control and internal reference reaction solution are, and the result is positive, explains that 2 detection architecture are normal; It is green that the blank reaction solution is, and the result is negative, and illustrative system is pollution-free, can get rid of false positive results.It is green that sample detection system 1 amplification reaction solution is, and the result is positive, contains soybean components in the interpret sample, and the DNA quality of sample extraction reaches a standard, and can get rid of the false negative result of detection architecture 2; Sample detection system 1 amplification reaction solution is orange, and the result is negative, does not contain soybean components in the interpret sample.It is green that sample detection system 2 amplification reaction solutions are, and the result is positive, contains resistance glyphosate genetically engineered soybean composition in the interpret sample; Sample detection system 2 amplification reaction solutions are orange, and the result is negative, do not contain resistance glyphosate genetically engineered soybean composition (Fig. 1) in the interpret sample.
3 sensitivity analyses
With the pMDl8-RR recombinant plasmid dna that extracts, measure its purity and concentration, and by formula: plasmid copy number=plasmid quality (g)/(plasmid molecule base logarithm (bp) * 660) * 6.02 * 10
23, with concentration convert to copy number as measure unit after, by the gradient dilution standard plasmid molecule of 10 times of multiple proportions; Be mixed with 2000000copies/ μ l successively, 200000copies/ μ l, 20000 copies/ μ l; 2000copies/ μ l; 200copies/ μ l, 20copies/ μ l, the standardized solution of seven gradients of 2copies/ μ l.Method according to 1.2 is carried out augmentation detection, and the detection sensitivity of confirming test kit is 200copies/ μ l (Fig. 2).
4 specificity analyses
Extract the genomic dna of resistance glyphosate genetically engineered soybean, non-transgenic soybean, transgenic paddy rice TT51-1, transgene rape RT73, transgenic beet H7-1, transgenic corns MON810, transgenic corns Bt176; After using spectrophotometer to confirm its concentration and purity; Method according to 1.1 and 1.2 is carried out the augmentation detection of Lectin gene and resistance glyphosate genetically engineered soybean specificity of transformant sequence; The result only detects the Lectin gene in resistance glyphosate genetically engineered soybean, non-transgenic soybean; Only in the resistance glyphosate genetically engineered soybean, detect the specificity of transformant sequence, explain that this test kit has specificity (Fig. 3) efficiently.
Above embodiment is merely and introduces preferred case of the present invention, and to those skilled in the art, any conspicuous variation and the improvement in the scope that does not deviate from spirit of the present invention, carried out all should be regarded as a part of the present invention.
< 110>Guangdong product quality supervision and inspection research institute
< 120>be used to detect primer sets, test kit and the method for resistance glyphosate genetically engineered soybean specificity of transformant sequence
<130>
<160> 10
<170> PatentIn?version?3.5
<210> 1
<211> 19
<212> DNA
< 213>artificial sequence
<400> 1
gccgaagcaa?ccaaacatg 19
<210> 2
<211> 20
<212> DNA
< 213>artificial sequence
<400> 2
ggggcataga?aggtgaagtt 20
<210> 3
<211> 41
<212> DNA
< 213>artificial sequence
<400> 3
tggggtgccg?ttttcgtcaa?catcctccaa?ggagacgcta?t 41
<210> 4
<211> 38
<212> DNA
< 213>artificial sequence
<400> 4
accctcgtct?cttggtcgcg?ggcaacgcta?ccggtttc 38
<210> 5
<211> 19
<212> DNA
< 213>artificial sequence
<400> 5
atagggaacc?caaatggaa 19
<210> 6
<211> 18
<212> DNA
< 213>artificial sequence
<400> 6
ttgtgcgtca?tcccttac 18
<210> 7
<211> 41
<212> DNA
< 213>artificial sequence
<400> 7
ggcatcttga?acgatagcct?ttcaaggaag?gtggctccta?c 41
<210> 8
<211> 41
<212> DNA
< 213>artificial sequence
<400> 8
cacgaggagc?atcgtggaaa?tcagtggaga?tatcacatca?a 41
<210> 9
<211> 207
<212> DNA
< 213>resistance glyphosate genetically engineered soybean
<400> 9
gccgaagcaa?ccaaacatga?tcctccaagg?agacgctatt?gtgacctcct?cgggaaagtt 60
acaactcaat?aaggttgacg?aaaacggcac?cccaaaaccc?tcgtctcttg?gtcgcgccct 120
ctactccacc?cccatccaca?tttgggacaa?agaaaccggt?agcgttgcca?gcttcgccgc 180
ttccttcaac?ttcaccttct?atgcccc 207
<210> 10
<211> 214
<212> DNA
< 213>resistance glyphosate genetically engineered soybean
<400> 10
atagggaacc?caaatggaaa?aggaaggtgg?ctcctacaaa?tgccatcatt?gcgataaagg 60
aaaggctatc?gttcaagatg?cctctgccga?cagtggtccc?aaagatggac?ccccacccac 120
gaggagcatc?gtggaaaaag?aagacgttcc?aaccacgtct?tcaaagcaag?tggattgatg 180
tgatatctcc?actgaacgta?gggatgacgc?acaa 214
Claims (8)
1. the detection primer sets of resistance glyphosate genetically engineered soybean and processed goods thereof comprises primer sets 1 and primer sets 2, and wherein, primer sets 1 comprises outer primer Lectin-F3, Lectin-B3 and inner primer Lectin-FIP, Lectin-BIP, and sequence is following:
Lectin-?F3?GCCGAAGCAACCAAACATG（SEQ?ID?NO:1）；
Lectin-B3?GGGGCATAGAAGGTGAAGTT（SEQ?ID?NO:2）；
Lectin-FIP?TGGGGTGCCGTTTTCGTCAACATCCTCCAAGGAGACGCTAT（SEQ?ID?NO:3）；
Lectin-BIP?ACCCTCGTCTCTTGGTCGCG-GGCAACGCTACCGGTTTC（SEQ?ID?NO:4）；
Primer sets 2 comprises outer primer RR-F3, RR-B3 and inner primer RR-FIP, RR-BIP, and sequence is following:
RR-F3?ATAGGGAACCCAAATGGAA（SEQ?ID?NO:5）；
RR-B3?TTGTGCGTCATCCCTTAC（SEQ?ID?NO:6）；
RR-FIP?GGCATCTTGAACGATAGCCTTTCAAGGAAGGTGGCTCCTAC（SEQ?ID?NO:7）；
RR-BIP?CACGAGGAGCATCGTGGAAATCAGTGGAGATATCACATCAA（SEQ?ID?NO:8）。
2. the detection kit of resistance glyphosate genetically engineered soybean and processed goods thereof comprises: the described primer sets 1 of (1) claim 1; (2) the described primer sets 2 of claim 1; (3) Bst archaeal dna polymerase; (4) LAMP reaction solution; (5) staining agent; (6) internal reference; (7) positive control.
3. detection kit according to claim 2 is characterized in that, the interpolation mol ratio of outer primer and inner primer is 1:8 in the said primer sets 1; The interpolation mol ratio of outer primer and inner primer is 1:8 in the said primer sets 2.
4. detection kit according to claim 2 is characterized in that, described LAMP reaction solution is by 0. 2 mol/L Mg
2SO
4, 25 mmol/L dNTP, 10 * Bst buffer, 5 mol/L trimethyl-glycines form in the ratio proportioning of 1:4:10:20.
5. detection kit according to claim 2 is characterized in that, said staining agent is SYBR Green.
6. detection kit according to claim 2 is characterized in that, described internal reference is for containing the recombinant plasmid of soybean internal reference gene Lectin (SEQ ID NO:9); Said positive control is for containing the recombinant plasmid of resistance glyphosate genetically engineered soybean specificity of transformant sequence (SEQ ID NO:10).
7. detection kit according to claim 6 is characterized in that, the used carrier of the recombinant plasmid of internal reference and positive control is the pMDl8-T carrier.
8. utilize the test kit detection resistance glyphosate genetically engineered soybean of claim 2 and the method for processed goods thereof, comprise the steps:
(1) extracts purifying sample DNA to be checked;
(2) the LAMP method detects;
(3) result judges: if internal reference, positive control are positive in the step (2); Blank is negative; And sample Lectin gene test is positive, resistance glyphosate genetically engineered soybean specificity of transformant sequential detection is positive, and shows that then sample to be checked contains resistance glyphosate genetically engineered soybean composition.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012102424061A CN102766690A (en) | 2012-07-12 | 2012-07-12 | Primer groups, kit and method for detecting specific sequence of glyphosate-resistant transgenic soybean transformant |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012102424061A CN102766690A (en) | 2012-07-12 | 2012-07-12 | Primer groups, kit and method for detecting specific sequence of glyphosate-resistant transgenic soybean transformant |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102766690A true CN102766690A (en) | 2012-11-07 |
Family
ID=47094257
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2012102424061A Pending CN102766690A (en) | 2012-07-12 | 2012-07-12 | Primer groups, kit and method for detecting specific sequence of glyphosate-resistant transgenic soybean transformant |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102766690A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108220460A (en) * | 2017-12-07 | 2018-06-29 | 广东产品质量监督检验研究院 | A kind of food-borne streptococcus pyogenes LAMP primer group and kit and application |
-
2012
- 2012-07-12 CN CN2012102424061A patent/CN102766690A/en active Pending
Non-Patent Citations (3)
| Title |
|---|
| MEI LIU ET AL: "Sensitive and Rapid Detection of Genetic Modified Soybean(Roundup Ready)by loop-Mediated Isothermal Amplification", 《BIOSCI.BIOTECHNOL, BIOCHEM》 * |
| XIAOYAN GUAN ET AL: "Visual and Rapid Detection of Two Genetically Modified Soybean Events Using Loop-mediated Isothermal Amplification Method", 《FOOD ANAL.METHOD 》 * |
| 吕山花等: "抗草甘膦转基因大豆PCR检测方法的建立与应用", 《中国农业科学》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108220460A (en) * | 2017-12-07 | 2018-06-29 | 广东产品质量监督检验研究院 | A kind of food-borne streptococcus pyogenes LAMP primer group and kit and application |
| CN108220460B (en) * | 2017-12-07 | 2021-08-03 | 广东产品质量监督检验研究院 | Food-borne streptococcus pyogenes LAMP primer group, kit and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105567789B (en) | The PCR primer pair composition and its application of identification or auxiliary identification sturgeon germplasm | |
| CN101775440A (en) | Plasmid control molecule for detection of transgenic soybean and building method thereof | |
| CN106995841A (en) | A kind of genetically engineered soybean detection multiple PCR reagent kit and detection method | |
| CN102634593A (en) | LAMP (mop-mediated isothermal amplification) detection primer group, kit and method for transgenic maize EVENT98140 and derived varieties thereof | |
| CN102634588A (en) | LAMP (mop-mediated isothermal amplification) detection primer group, kit and method for transgenic maize MIR604 and derived varieties thereof | |
| CN102766624A (en) | Primer group, kit and method for detecting specific sequence of genetically modified organism corn Bt176 transformant | |
| CN102010910A (en) | Loop-mediated isothermal amplification technology-based plasmodium genus and species nucleic acid screening method | |
| CN104328174B (en) | A kind of detect the LAMP primer of Mus Klebsiella pneumonia, test kit and method | |
| CN102888455A (en) | Kit for detecting mycobacterium tuberculosis based on loop-mediated isothermal amplification, and primers | |
| CN105603081B (en) | Non-diagnosis-purpose qualitative and quantitative detection method for intestinal microorganisms | |
| CN106755545A (en) | The LAMP detection primer group of pat gene, kit and detection method in genetically modified crops | |
| CN105154538B (en) | The primer and method of a kind of Legionella quick detection and parting | |
| CN102766690A (en) | Primer groups, kit and method for detecting specific sequence of glyphosate-resistant transgenic soybean transformant | |
| WO2022068785A1 (en) | Nucleic acid detection method for identifying bacillus cereus and bacillus thuringiensis | |
| CN106480015A (en) | A kind of method of extracellular dna in high efficiency extraction deposit | |
| CN102634592A (en) | LAMP (mop-mediated isothermal amplification) detection primer group, kit and method for transgenic maize BT176 and derived varieties thereof | |
| CN102776268A (en) | Kit and method for detection of transgenic maize Mon89034 and derivative varieties thereof through gene amplification at constant temperature | |
| CN102102126B (en) | Quick, simple and convenient detection method for transgenic cows with human lactoferrin gene | |
| CN112029892A (en) | Method for rapidly identifying specificity of transgenic herbicide-tolerant soybean ZH10-6 transformant | |
| CN113136447A (en) | PCR-HRM detection method for rapidly distinguishing mating types of rice blast germs | |
| CN105063207A (en) | LAMP detection primer group, kit, and detection method of transgenic soybean MON87705 | |
| CN112301147A (en) | RPA primer probe combination, kit and detection method for detecting transgenic corn double antibody 12-6 | |
| Ren et al. | A Portable Nucleic Acid Sensor Based on PCR for Simple, Rapid, and Sensitive Testing of Botrytis cinerea in Ginseng | |
| CN107904320A (en) | Detect shiga Salmonella loop-mediated isothermal amplification experiment primer sets and its application | |
| CN105483235A (en) | LAMP (Loop-mediated isothermal amplification) detection primer group and kit and detection method for gene cry1F of transgenic plants |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20121107 |