CN108220460B - Food-borne streptococcus pyogenes LAMP primer group, kit and application - Google Patents
Food-borne streptococcus pyogenes LAMP primer group, kit and application Download PDFInfo
- Publication number
- CN108220460B CN108220460B CN201711287868.4A CN201711287868A CN108220460B CN 108220460 B CN108220460 B CN 108220460B CN 201711287868 A CN201711287868 A CN 201711287868A CN 108220460 B CN108220460 B CN 108220460B
- Authority
- CN
- China
- Prior art keywords
- streptococcus pyogenes
- food
- spy1258
- kit
- borne
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the technical field of molecular biology detection of food safety, and discloses a food-borne streptococcus pyogenes LAMP primer group, a kit and application. The LAMP primer group comprises outer primers F3 and B3, inner primers FIP and BIP, and a Streptococcus pyogenes transcription regulation gene spy1258 is used as a target gene for qualitatively detecting Streptococcus pyogenes in food and food contact materials. The kit comprises the LAMP primer group of the food-borne streptococcus pyogenes, DNA polymerase, 2 multiplied reaction buffer solution, sealing liquid, fluorescent dye, positive control and negative control. The kit can effectively detect 1 fg/. mu.L streptococcus pyogenes, and has very high sensitivity. The primer group performs specific amplification on 6 sites of the target sequence, ensures the specificity and has no cross reaction with other strains. The whole amplification process can be completed only in 1h, and the highest yield of the target gene can reach 1010And (6) copying.
Description
Technical Field
The invention relates to the technical field of molecular biology detection of food safety, and particularly relates to a food-borne streptococcus pyogenes LAMP primer group, a kit and application.
Background
Streptococcus is generally classified into pyogenic and non-pyogenic types, with β -hemolysis occurring in Streptococcus pyogenes and α -hemolysis or insoluble blood occurring in non-pyogenic Streptococcus. The common streptococcus pyogenes include streptococcus pyogenes, streptococcus agalactiae and the like. The non-pyogenic streptococcus includes streptococcus mitis, streptococcus pneumoniae, etc.
Streptococcus pyogenes (s. pyogenes), a gram-positive bacterium belonging to the phylum firmicutes and Streptococcus, is also known as Streptococcus pyogenes. The pyogenes are circular and oval in shape, generally arranged in a chain shape, have no spores and have capsules. S. pyogens has been found to have a variety of typing which results in colony morphology variations of s.pyogens, generally divided into three major groups: (1) mucus-like colonies. The colony has larger appearance, convex surface and more water; (2) and (4) a matt colony. The colony surface is flat, rough and high in transparency; (3) and (4) glossy colonies. Such colonies are small in shape and have a smooth and glossy surface (Johnson DR and Kaplan EL 1996).
Food-borne pathogenic bacteria are an important source of food safety problems. Food pathogens are pathogenic bacteria that can cause food poisoning or that are food borne. Pathogenic bacteria directly or indirectly pollute food and water sources, and human oral infection can cause intestinal infectious diseases, food poisoning and epidemic of livestock and poultry infectious diseases. In recent years, bacterial infection caused by streptococcus pyogenes has a growing trend, and the safety and health of people are seriously harmed.
Streptococcus pyogenes from different sources have different properties. Unlike streptococcus pyogenes in samples such as sputum, cerebrospinal fluid and other secretions, the streptococcus pyogenes of the present invention is a common food-borne pathogenic bacterium, is a gram-positive streptococcus, is in a circular or oval shape, is generally in a chain arrangement, and can cause a beta-type hemolysis phenomenon. Food is commonly found in milk, meat, eggs and products thereof, and streptococcus pyogenes can cause skin soft tissue infection, impetigo, acute pharyngitis and other diseases.
At present, the detection method of streptococcus pyogenes in China comprises the traditional microbial culture identification, immunoassay, PCR detection technology and the like. The traditional culture method has the defects of complex operation, long time consumption, low sensitivity and the like; the immunoassay method has low specificity although it has high sensitivity and takes a short time; the PCR method developed in recent years can well meet the requirements on time consumption, specificity and sensitivity, but has high requirements on equipment and is difficult to be popularized in basic level and field detection.
Loop-mediated isothermal amplification (LAMP) is a novel gene amplification technology developed in recent years, and utilizes 4 specific primers (two for each of an inner primer and an outer primer) and Bst DNA polymerase to specifically recognize 6 independent sites on a target sequence, so that the DNA target sequence can be specifically, efficiently and quickly amplified under a constant temperature condition (about 65 ℃), and can be amplified to 10 target genes within 1h9～1010And (6) copying. The LAMP technology has the advantages of simple operation, high reaction speed, high sensitivity, good specificity, low price and the like, and is widely applied to the fields of pathogen detection, transgenic component detection, disease diagnosis and the like at present.
Disclosure of Invention
The invention aims to overcome the defects and provides a food-borne streptococcus pyogenes LAMP primer group.
The invention also aims to provide a kit with the food-borne streptococcus pyogenes LAMP primer group.
The invention also aims to provide a food-borne streptococcus pyogenes LAMP primer group and application of the kit.
The invention is realized by the following technical scheme:
a LAMP primer group of food-borne streptococcus pyogenes comprises outer primers F3 and B3, inner primers FIP and BIP, and a streptococcus pyogenes transcription regulation gene spy1258 is used as a target gene for qualitatively detecting streptococcus pyogenes in food and food contact materials, wherein the nucleotide sequences of the primers are shown as follows:
spy1258-F3：CCTTACTAAAAAGGCTGGTATC
spy1258-B3：GAGTTGCGGAAATTTGAGG
spy1258-FIP：TCCAGAGTGTCATTTTTGAAGTGAT-AATAGAGGAACCTTCTACCTCC
spy1258-BIP：TCAGGCTGAAATCTACACAGACAC-GCGGTTATAAATTCTCTATGTTCT。
preferably, the molar ratio of the inner primers to the outer primers is 1: 8.
A kit for qualitatively detecting Streptococcus pyogenes in food and food contact materials comprises the LAMP primer group of food-borne Streptococcus pyogenes.
Preferably, the kit further comprises DNA polymerase, 2 × reaction buffer, sealing liquid, fluorescent dye, positive control and negative control.
Preferably, the DNA polymerase is Bst DNA polymerase at a concentration of 8U/. mu.L.
Preferably, the 2 × reaction buffer comprises buffer, betaine and dNTPs in a volume ratio of 10:8: 7.
Preferably, the fluorescent dye is present at a concentration of 10 × SYBR Green I;
preferably, the sealing fluid is mineral oil.
Preferably, the positive control is genomic DNA of a streptococcus pyogenes standard strain; the negative control was sterilized deionized water.
The food-borne streptococcus pyogenes LAMP primer group or the kit is applied to qualitative detection of streptococcus pyogenes in food and food contact materials.
A method for detecting streptococcus pyogenes in food and food contact materials by using the kit comprises the following steps:
(1) extracting DNA of a substance to be detected: the food sample pretreatment conforms to GB 4789.11-2014, namely 25g or 25mL of sample to be detected is placed in a sterile homogenizing bag, added into 225mL of improved tryptone soybean broth (mTSB) and homogenized for 1-2 min; or adding the mixture into a homogenizing cup containing 225mL mTSB, and homogenizing for 1min to 2min at 8000r/min to 10000 r/min. The pretreatment of food contact material adopts sterile normal saline to wet cotton swabs which are respectively 2 and 25cm in length2(5 cm. times.5 cm) surfaceUniformly coating the whole square grid for 3 times, cutting off the part of the cotton swab in contact with the hand by using sterilizing scissors, putting the cotton swab in 10mL mTSB, and homogenizing; culturing at 36 +/-1 ℃ for 18-24 h, putting 200 mu L of cultured bacterial liquid into a clean 1.5mL centrifuge tube, boiling at 100 ℃ for 10min, centrifuging at 12000rpm for 10min, taking supernatant, and storing at-20 ℃ for later use.
(2) A 25 μ L reaction was used: 1.6 mu M of each of the inner primers spy1258-FIP and spy1258-BIP, 0.2 mu M of each of spy1258-F3 and spy1258-B3, 12.5 mu L of 2X reaction buffer, 8U of DNA polymerase, 0.5 mu L of fluorescent dye, 2 mu L of sample to be detected, and 25 mu L of ultrapure water; mixing, adding a drop of sealing liquid, mixing, centrifuging, and reacting at 62.5 deg.C for 45 min;
(3) and (3) judging a detection result: putting the reaction tube into a fluorescent PCR instrument, and judging a detection result according to whether an amplification curve appears: if the S-shaped amplification curve appears, the detection result is positive, namely the sample contains streptococcus pyogenes; if no S-shaped amplification curve appears, the detection result is negative, namely the sample does not contain streptococcus pyogenes.
Preferably, one drop of sealing liquid is about 20 μ L.
Preferably, the fluorescent PCR instrument is a real-time fluorescent quantitative PCR system (Life Tech (applied biosystems), LightCycler @1.5, Germany, model ABI 7500, and the like.
Compared with the prior art, the invention has the following beneficial technical effects:
(1) the sensitivity is high. The kit can effectively detect 1 fg/. mu.L of streptococcus pyogenes, and has very high sensitivity.
(2) The specificity is strong. The invention designs 4 primers according to the specific target sequence of streptococcus pyogenes, and specifically amplifies 6 sites of the target sequence, thereby ensuring the specificity and having no cross reaction with other strains.
(3) The time consumption is less, and the efficiency is high. The whole amplification process can be completed only in 1h, and the yield of the target gene in the process can reach 1010 copies at most.
(4) The operation is convenient and fast, and the equipment requirement is low. The detection process does not need expensive and complex instruments, the reaction detection can be realized only by putting the sample into a constant temperature instrument, and the judgment result can judge whether the streptococcus pyogenes is contained only by observing whether a reaction curve appears.
Drawings
FIG. 1 is a diagram showing the results of experiments specific to the Streptococcus pyogenes LAMP detection method, which is, in order, Streptococcus pyogenes (S.pyogenenes), Staphylococcus aureus (S.aureous), Shigella sonnei (S.sonnei), Pseudomonas aeruginosa (P.aeruginosa), Escherichia coli (Escherichia coli, E.coli), Bacillus cereus (B.cereus), Listeria monocytogenes (Listeria monocytogenes, L.moninogenes), Listeria iselii (Listeria ivanovaevii, L.ivanovvii), Listeria inrichensis (Listeria innoccus, L.innoccus), Listeria monocytogenes (Listeria monocytogenes), Escherichia coli (Listeria islava, Escherichia coli), Escherichia coli (Listeria parahaemolyticus, Escherichia coli), Escherichia coli (Bacillus subjuniori, Escherichia coli, Escherichia coli, Escherichia coli, Escherichia coli, Escherichia coli, parahaemolyticus) was performed.
FIG. 2 is a diagram showing the sensitivity experiment result of the LAMP detection method for Streptococcus pyogenes: wherein the concentration from right to left is the result of LAMP reaction of the Streptococcus pyogenes genome DNA template with the concentration of 100 pg/mu L, 10 pg/mu L, 1 pg/mu L, 100 fg/mu L, 10 fg/mu L and 1 fg/mu L in sequence.
FIG. 3 is a schematic diagram of detection reagent samples of the Streptococcus pyogenes LAMP kit, which sequentially shows the LAMP reaction results of a blank control (blank), a positive control (positive), a negative control (negative), a sample 1(sample 1) and a sample 2(sample 2).
Detailed Description
The invention is further illustrated by the following specific examples. The starting materials and methods employed in the examples of the present invention are those conventionally available in the market and conventionally used in the art, unless otherwise specified.
Example 1
Design synthesis, kit and detection method of LAMP primer of streptococcus pyogenes
(1) Design and Synthesis of LAMP primers
Based on the Streptococcus pyogenes transcriptional regulatory gene spy1258 as the target gene, the inventors creatively designed 2 pairs of LAMP (inner primers FIP and BIP, outer primers F3 and B3). The primer is synthesized by Shanghai biological engineering (Shanghai) GmbH, and the sequence of the primer is as follows:
SEQ NO.1：spy1258-F3：CCTTACTAAAAAGGCTGGTATC
SEQ NO.2：spy1258-B3：GAGTTGCGGAAATTTGAGG
SEQ NO.3：spy1258-FIP：TCCAGAGTGTCATTTTTGAAGTGAT-AATAGAGGAACCTTCTACCTCC
SEQ NO.4：spy1258-BIP：ATCAGGCTGAAATCTACACAGACAC-GCGGTTATAAATTCTCTATGTTCT
(2) streptococcus pyogenes LAMP detection kit
A kit for qualitatively detecting streptococcus pyogenes in food and food contact materials comprises DNA polymerase, 2 x reaction buffer solution, sealing solution, fluorescent dye, positive control, negative control and LAMP primer group.
Wherein the DNA polymerase is Bst DNA polymerase with the concentration of 8U/muL; 2 × buffer in reaction buffer: betaine: dNTPs is 10:8: 7; the fluorescent dye is 10 multiplied by SYBR Green I; the sealing liquid is mineral oil; the positive control is the genome DNA of the streptococcus pyogenes standard strain; the negative control was sterilized deionized water.
(3) Detection method
A method for detecting streptococcus pyogenes in food and food contact materials by using the kit comprises the following steps:
(1) extracting DNA of a substance to be detected: the food sample pretreatment conforms to GB 4789.11-2014, namely 25g or 25mL of sample to be detected is placed in a sterile homogenizing bag, added into 225mL of improved tryptone soybean broth (mTSB) and homogenized for 1-2 min; or adding the mixture into a homogenizing cup containing 225mL mTSB, and homogenizing for 1min to 2min at 8000r/min to 10000 r/min.
Food contact material frontProcessing: wetting cotton swabs with sterile physiological saline solution at 2 cells of 25cm2Uniformly coating the whole square grid back and forth for 3 times within the area range of (5cm multiplied by 5cm), cutting off the part of the cotton swab in contact with the hand by using a pair of sterilizing scissors, putting the cotton swab in 10mL mTSB, and homogenizing; culturing at 36 +/-1 ℃ for 18-24 h, putting 200 mu L of cultured bacterial liquid into a clean 1.5mL centrifuge tube, boiling at 100 ℃ for 10min, centrifuging at 12000rpm for 10min, taking supernatant, and storing at-20 ℃ for later use.
(2) The LAMP reaction system is a 25-mu-L reaction system: comprises 1.6 mu M of each of inner primers spy1258-FIP and spy1258-BIP, 0.2 mu M of each of spy1258-F3 and spy1258-B3, 12.5 mu L of 2 multiplied reaction buffer solution, 8U of Bst DNA polymerase and 0.5 mu L of 10 multiplied SYBR Green I, 2 mu L of a sample to be detected and 25 mu L of ultrapure water; after mixing, one drop (about 20. mu.L) of the sealing liquid was added.
Mixing, centrifuging, and reacting at 62.5 deg.C for 45 min.
(3) And (3) judging a detection result: the reaction tube is placed in a fluorescent PCR instrument (such as ABI 7500, LightCycler @1.5), and the detection result is judged according to whether an amplification curve appears or not. If the S-shaped amplification curve appears, the detection result is positive, namely the sample contains streptococcus pyogenes; if no S-shaped amplification curve appears, the detection result is negative, namely the sample does not contain streptococcus pyogenes.
Example 2
LAMP specificity experiment
Specific experiments were carried out on streptococcus pyogenes, staphylococcus aureus, shigella sonnei, pseudomonas aeruginosa, escherichia coli, bacillus cereus, listeria monocytogenes, listeria israeli, listeria inokokia, listeria slaeri, rhodococcus equi, enterobacter sakazakii, yersinia enterocolitica, bacillus subtilis, campylobacter jejuni, and vibrio parahaemolyticus by using the LAMP reaction kit of example 1 according to the reaction system and the detection method, and the experimental results are shown in fig. 1. And sterile double distilled water was set as a negative control. As can be seen from FIG. 1, only Streptococcus pyogenes showed a "S" -shaped amplification curve, which is a positive result, while none of the other strains showed a "S" -shaped amplification curve within the reaction time of 45min, indicating that the reaction system of example 1 has specificity only for Streptococcus pyogenes.
Example 3
LAMP sensitivity assay
The standard strain of streptococcus pyogenes is streaked on a blood plate, cultured for 18h at 36 +/-1 ℃, and the DNA in bacteria is extracted by adopting a prokaryotic genome extraction kit of an OMEGA company. The extracted streptococcus pyogenes DNA was subjected to 10-fold gradient dilution to obtain 6 gradient DNA templates with concentrations of 100pg/μ L, 10pg/μ L, 1pg/μ L, 100fg/μ L, 10fg/μ L, and 1fg/μ L, respectively, and negative controls (sterilized double distilled water) were set, and the reaction system and detection method in example 1 were performed to determine the sensitivity of the LAMP kit.
The results in FIG. 2 show that the LAMP kit of example 1 can effectively detect 1 fg/. mu.L of Streptococcus pyogenes.
Example 4
In the embodiment, paper cups produced by two different manufacturers purchased in the market are used as detection objects to qualitatively detect streptococcus pyogenes in the paper cups.
(1) Samples 1 and 2 were pretreated and cultured, respectively, according to example 1, and DNAs were extracted;
(2) the LAMP reaction system is a 25-mu-L reaction system: comprises 1.6 mu M of each of inner primers spy1258-FIP and spy1258-BIP, 0.2 mu M of each of spy1258-F3 and spy1258-B3, 12.5 mu L of 2 multiplied reaction buffer solution, 8U of Bst DNA polymerase and 0.5 mu L of 10 multiplied SYBR Green I, 2 mu L of a sample to be detected and 25 mu L of ultrapure water; after mixing, one drop (about 20. mu.L) of the sealing liquid was added. Mixing, centrifuging, and reacting at 62.5 deg.C for 45 min. And a blank control, a negative control (sterilized double distilled water) and a positive control (standard strain of streptococcus pyogenes) were set.
(3) And (3) judging a detection result: the reaction tube is placed in a fluorescent PCR instrument (such as ABI 7500, LightCycler @1.5), and the detection result is judged according to whether an amplification curve appears or not. The detection result is shown in FIG. 3, the S-shaped amplification curve of the sample 1 is a positive result, the S-shaped amplification curve of the sample 2 is not generated, and the negative result shows that the sample 1 contains Streptococcus pyogenes and the sample 2 does not contain Streptococcus pyogenes. The method can effectively detect Streptococcus pyogenes in actual sample.
Sequence listing
<110> Guangdong institute for quality supervision and inspection of products
Food-borne streptococcus pyogenes LAMP primer group, kit and application
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA
<213> primer spy1258-F3(primer spy1258-F3)
<400> 1
ccttactaaa aaggctggta tc 22
<210> 2
<211> 19
<212> DNA
<213> primer spy1258-B3(primer spy1258-B3)
<400> 2
gagttgcgga aatttgagg 19
<210> 3
<211> 47
<212> DNA
<213> primer spy1258-FIP (primer spy1258-FIP)
<400> 3
tccagagtgt catttttgaa gtgataatag aggaaccttc tacctcc 47
<210> 4
<211> 48
<212> DNA
<213> primer spy1258-BIP (primer spy1258-BIP)
<400> 4
tcaggctgaa atctacacag acacgcggtt ataaattctc tatgttct 48
Claims (10)
1. The LAMP primer group for food-borne streptococcus pyogenes is characterized by comprising outer primers spy1258-F3 and spy1258-B3, and inner primers spy1258-FIP and spy 1258-BIP; the streptococcus pyogenes transcription regulation gene spy1258 is used as a target gene for qualitatively detecting streptococcus pyogenes in food and food contact materials, and the nucleotide sequence of a primer is shown as follows:
spy1258-F3：CCTTACTAAAAAGGCTGGTATC
spy1258-B3：GAGTTGCGGAAATTTGAGG
spy1258-FIP：TCCAGAGTGTCATTTTTGAAGTGAT-AATAGAGGAACCTTCTACCTCC
spy1258-BIP：TCAGGCTGAAATCTACACAGACAC-GCGGTTATAAATTCTCTATGTTCT。
2. a kit for qualitative detection of Streptococcus pyogenes in food and food-contact materials, characterized by comprising the LAMP primer set for food-borne Streptococcus pyogenes of claim 1.
3. The kit of claim 2, wherein the molar ratio of the inner primers to the outer primers is 1: 8.
4. The kit of claim 3, further comprising DNA polymerase, 2 x reaction buffer, sealing solution, fluorescent dye, positive control, and negative control.
5. The kit of claim 4, wherein the DNA polymerase is Bst DNA polymerase at a concentration of 8U/. mu.L.
6. The kit of claim 4, wherein the 2 x reaction buffer comprises buffer, betaine, and dNTPs in a volume ratio of 10:8: 7.
7. The kit of claim 4, wherein the fluorescent dye is provided at a concentration of 10 XSSYBR Green I; the sealing liquid is mineral oil.
8. The kit according to claim 4, wherein the positive control is genomic DNA of a Streptococcus pyogenes standard strain; the negative control was sterilized deionized water.
9. The application of the food-borne streptococcus pyogenes LAMP primer group of claim 1 or the kit of any one of claims 2 to 8 in qualitative detection of streptococcus pyogenes in food and food contact materials.
10. A method for detecting Streptococcus pyogenes in food and food contact materials using the kit according to any one of claims 3 to 8, comprising the steps of:
(1) extracting DNA of a substance to be detected: the food sample pretreatment conforms to GB 4789.11-2014, namely 25g or 25mL of sample to be detected is placed in a sterile homogenizing bag, added into 225mL of improved tryptone soybean broth (mTSB) and homogenized for 1-2 min; or adding the mixture into a homogenizing cup containing 225mL mTSB, and homogenizing for 1 min-2 min at 8000 r/min-10000 r/min; the pretreatment of food contact material adopts sterile normal saline to wet cotton swabs which are respectively 2 and 25cm in length2Uniformly coating the whole square grid in an area range back and forth for 3 times, cutting off the part of the cotton swab in contact with the hand by using sterilizing scissors, putting the cotton swab in 10mL mTSB, and homogenizing; culturing at 36 +/-1 ℃ for 18-24 h, putting 200 mu L of cultured bacterial liquid into a clean 1.5mL centrifuge tube, boiling at 100 ℃ for 10min, centrifuging at 12000rpm for 10min, taking supernatant, and storing at-20 ℃ for later use;
(2) a 25 μ L reaction was used: 1.6 mu M of each of the inner primers spy1258-FIP and spy1258-BIP, 0.2 mu M of each of spy1258-F3 and spy1258-B3, 12.5 mu L of 2X reaction buffer, 8U of DNA polymerase, 0.5 mu L of fluorescent dye, 2 mu L of sample to be detected, and 25 mu L of ultrapure water; mixing, adding a drop of sealing liquid, mixing, centrifuging, and reacting at 62.5 deg.C for 45 min;
(3) and (3) judging a detection result: placing the reaction tube containing the reaction system into a fluorescent PCR instrument, and judging a detection result according to whether an amplification curve appears: if the S-shaped amplification curve appears, the detection result is positive, namely the sample contains streptococcus pyogenes; if no S-shaped amplification curve appears, the detection result is negative, namely the sample does not contain streptococcus pyogenes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711287868.4A CN108220460B (en) | 2017-12-07 | 2017-12-07 | Food-borne streptococcus pyogenes LAMP primer group, kit and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711287868.4A CN108220460B (en) | 2017-12-07 | 2017-12-07 | Food-borne streptococcus pyogenes LAMP primer group, kit and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108220460A CN108220460A (en) | 2018-06-29 |
| CN108220460B true CN108220460B (en) | 2021-08-03 |
Family
ID=62653924
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711287868.4A Active CN108220460B (en) | 2017-12-07 | 2017-12-07 | Food-borne streptococcus pyogenes LAMP primer group, kit and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108220460B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111534610A (en) * | 2019-11-12 | 2020-08-14 | 广州微芯生物科技有限公司 | Fluorescent quantitative PCR method for detecting toxin-producing streptococcus pyogenes and corresponding kit |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102766690A (en) * | 2012-07-12 | 2012-11-07 | 广东产品质量监督检验研究院 | Primer groups, kit and method for detecting specific sequence of glyphosate-resistant transgenic soybean transformant |
| CN104630354A (en) * | 2015-01-22 | 2015-05-20 | 中国人民解放军疾病预防控制所 | LAMP kit and special primer thereof for detecting streptococcus pyogenes |
| CN104711351A (en) * | 2015-03-16 | 2015-06-17 | 山东大学附属济南市中心医院 | Specific primer combination for detecting streptococcus pyogenes based on loop-mediated isothermal amplification method and application of specific primer combination |
-
2017
- 2017-12-07 CN CN201711287868.4A patent/CN108220460B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102766690A (en) * | 2012-07-12 | 2012-11-07 | 广东产品质量监督检验研究院 | Primer groups, kit and method for detecting specific sequence of glyphosate-resistant transgenic soybean transformant |
| CN104630354A (en) * | 2015-01-22 | 2015-05-20 | 中国人民解放军疾病预防控制所 | LAMP kit and special primer thereof for detecting streptococcus pyogenes |
| CN104711351A (en) * | 2015-03-16 | 2015-06-17 | 山东大学附属济南市中心医院 | Specific primer combination for detecting streptococcus pyogenes based on loop-mediated isothermal amplification method and application of specific primer combination |
Non-Patent Citations (5)
| Title |
|---|
| Detection of Streptococcus pyogenes using rapid visual molecular assay;Xiangna Zhao et al.;《FEMS Microbiology Letters》;20150827;第6-7页 * |
| Development of a loop-mediated isothermal amplification method for rapid detection of streptococcal pyrogenic exotoxin B;Cuiming Cao et al.;《Toxicon》;20160401;第117卷;第53-58页 * |
| Molecular and Clinical Diagnosis of Group A Streptococcal Pharyngitis in Children;Susanna Felsenstein et al.;《Journal of Clinical Microbiology》;20140820;第52卷(第11期);第3884-3889页 * |
| Xiangna Zhao et al..Detection of Streptococcus pyogenes using rapid visual molecular assay.《FEMS Microbiology Letters》.2015, * |
| 食品安全国家标准 食品微生物学检验 β型溶血性链球菌检验;中华人民共和国国家卫生和计划生育委员会;《中华人民共和国国家标准GB4789.11-2014》;20141201;第2页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108220460A (en) | 2018-06-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110760569B (en) | Rapid constant-temperature detection method and kit for nucleic acid of cronobacter sakazakii | |
| CN108588250B (en) | LAMP primer for detecting watermelon bacterial fruit blotch and detection method thereof | |
| JP2007117022A (en) | Primer set for detection of listeria monocytogenes and detection method | |
| CN104263838A (en) | LAMP-LFD (loop-mediated isothermal amplification and lateral flow dipstick) detection kit and detection method for Listeria monocytogenes | |
| Sanjiv et al. | Epidemiological typing of Staphylococcus aureus by DNA restriction fragment length polymorphism of coa gene | |
| CN108220460B (en) | Food-borne streptococcus pyogenes LAMP primer group, kit and application | |
| CN106367493B (en) | Method, primer and application for rapid constant-temperature detection of salmonella | |
| CN101875967B (en) | Method for quickly testing food-borne pathogenic bacteria | |
| KR101752274B1 (en) | Primer set for high sensitive real-time multiplex loop-mediated isothermal amplification reaction for determining type of shiga toxin genes stx1 and stx2 of Enterohemorrhagic Escherichia coli, and method for determining type of shiga toxin genes of Enterohemorrhagic Escherichia coli using the same | |
| CN1814788A (en) | Waters frequent food born pathogenic hacteria multiple PCR rapid detecting kit and its detecting method | |
| CN102732599A (en) | Method for detecting Vibrio vulnificus and Vibrio parahaemolyticus in seawater sample by duplex polymerase chain reaction | |
| Thongphueak et al. | Development of the rapid test kit for the identification of Campylobacter spp. Based on Loop-mediated Isothermal Amplification (LAMP) in combination with a Lateral Flow Dipstick (LFD) and Gold Nano-DNA Probe (AuNPs) | |
| JP2007189980A (en) | Primer for detecting staphylococcus aureus and detection method using the same | |
| CN106222274B (en) | quick detection method for hollisgilettia | |
| CN112111584A (en) | Method for rapidly detecting escherichia coli in water | |
| US20080206743A1 (en) | Rapid and Specific Detection of Enterobacter Sakazakii | |
| US20050233345A1 (en) | Primers for detecting food poisoning bacteria and a use thereof | |
| Vale et al. | Simultaneous detection of micro‐organisms in water samples for future chip applications: coliform bacteria, non‐mandatory bacteria, hepatitis A virus and noroviruses | |
| RU2451751C1 (en) | SYNTHETIC OLIGONUCLEOTIDE PRIMERS AND METHOD OF DETECTING Lactococcus lactis subspecies lactis IN STARTER CULTURES WHEN PRODUCING FERMENTED MILK PRODUCTS | |
| ÖZER | A REVIEW OF CULTURAL AND MOLECULAR DETECTION OF Listeria monocytogenesIN FOOD | |
| Yuan et al. | Detection of Listeria monocytogenes in foods by visual saltatory rolling circle amplification. | |
| Tran et al. | Direct recombinase polymerase amplification assay for accurate and rapid detection of Listeria monocytogenes in food. | |
| CN111206108A (en) | PCR detection kit and detection method for listeria monocytogenes | |
| JP2012039977A (en) | Primer set for detecting staphylococcus aureus | |
| CN108950037A (en) | Dual LAMP detects Shigella and Listeria Monocytogenes primer sets, reagent, kit and method simultaneously |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |