CN102643855B

CN102643855B - Application of arabidopsis thaliana heat shock protein gene HSP101 in seed germination and preservation

Info

Publication number: CN102643855B
Application number: CN 201210012301
Authority: CN
Inventors: 李唯奇; 禹晓梅; 陶发清; 郁步竹
Original assignee: Kunming Institute of Botany of CAS
Current assignee: Kunming Institute of Botany of CAS
Priority date: 2012-01-16
Filing date: 2012-01-16
Publication date: 2013-06-12
Anticipated expiration: 2032-01-16
Also published as: CN102643855A

Abstract

The invention provides application of arabidopsis thaliana gene HSP101 and T-DNA inserted mutant strain hot1 thereof in changing seed germination and preservation, application of the gene T-DNA inserted mutant strain hot1 in transgenic plants for changing seed germination and preservation, and application of the gene T-DNA inserted mutant strain hot1 in culturing seeds with low content of abscisic acid (ABA), and high content of gibberellin (GA3) and auxin (IAA). According to the modular arabidopsis thaliana, the functions of the heat shock protein gene HSP101 is relevant to seed germination and ageing, the arabidopsis thaliana seeds are sensitive to artificial ageing due to gene deletion and are not easy to store in a natural preservation process, and meanwhile, endogenous hormone abscisic acid (ABA) is reduced, gibberellin (GA3) is increased, and auxin (IAA) is increased, so that the germination is favored. Therefore, based on the invention, the gene HSP101 is manipulated, so that the characteristics of the seed preservation and the seed germination can be changed, and the gene HSP101 has very good application prospect in germplasm conservation and crop production.

Description

The application of Arabidopis thaliana heat shock protein gene HSP101 in seed germination and preservation

Technical field:

The invention belongs to seed physiology and plant genetic engineering field.Particularly, relate to arabidopsis gene HSP101 and T-DNA insertion mutation strain hot1 thereof the application in changing seed preservation, Germination Characteristics, also relate to simultaneously the application in the transgenic plant of this gene T-DNA insertion mutation strain hot1 aspect changing seed germination and preservation, and has low levels dormin (ABA) in cultivation, high-content Plant hormones regulators,gibberellins (GA ₃) and the seed of growth hormone (IAA) in application.

Background technology:

The preservation of seed is the important means of Preservation of plant germplasin, and it is to biodiversity conservation, have great importance to agriculture production.According to statistics, the plant germplasm resource of having collected in the world has 6,100,000 parts, wherein 90% is kept in the low temperature Germplasm Bank with the seed form, and the long-term germplasm quantity of storing of China has reached 340,000 parts, occupies first place in the world.But also there are a lot of problems in the germplasm cryopreservation, and what wherein Genetic Integrity of Germplasm Resource is had the greatest impact is exactly the Seed Aging problem, shows as percentage of germination and reduces.Seed germinating power in naturally storing also can be lost gradually, weather aging that Here it is (Machado Neto, Custodio et al.2001).Weather aging lasts longer, is difficult to when carrying out germplasm screening in breed improvement use; Temper(ing) can overcome the long deficiency of weather aging required time under normal temperature, and is widely used in the research of Seed Storability, and hot and humid method is often adopted in temper(ing).A series of Physiology and biochemistry and heredity variation can occur in the process of Seed Aging, comprise: the variation of variation, organic content and the kind of plasma membrane injury, material energy metabolism and variation (Galleschi, the Capocchi et al.2002 of genetic construction; Andreev, Spiridonova et al.2004; Freitas, Dias et al.2006).Therefore, carry out the correlative study of Seed Aging, disclose Mechanism of Seed Aging and further find out relevant countermeasure, preservation has important practical significance for germ plasm resource.

Seed is the important production means in agricultural, horticultural production, and it sprouts the production that directly affects agricultural gardening.People manage to make the neat recovery growth rapidly of embryo breaking dormancy for sowing obtains neat seedling shape seedling, for high yield lays the foundation.Seed germination is subjected to the coordinated regulation (Bewley 1997) of environmental factors (as light, temperature and humidity etc.) and internal factor (as the color of gene, hormone, sugar, nitrogenous compound, kind skin and structure etc.).The hormone regulating and controlling aspect, Plant hormones regulators,gibberellins (GA ₃), growth hormone (IAA) and dormin (ABA) be the main plant hormone of regulation and control seed germination and dormancy.ABA suppresses to sprout, induced dormancy, and Plant hormones regulators,gibberellins and growth hormone promote to sprout, and are the Main Factors of antagonism ABA, are seed germination institute essential (Flores, Jurado et al.2006; Rizza, Boccaccini et al.2010).At present, not yet clear and definite to " switch " mechanism of sprouting by dormancy, especially to the research aspect of Regulation in Seed Germination genes involved.

Heat shock protein Heat Shock Protein (HSP) extensively is present in (Zhang in the tissues such as plant cell membrane, tenuigenin, chloroplast(id), plastosome, Wang et al.2007), the conservative protein of one group of structure, homology according to its molecular size range and sequence, can be divided into five classes (Papp, Nardai et al.2003) such as small HSPs (sHSPs), HSP60, HSP70, HSP90 and HSP100.Their major function has: (1) prevents the protein aggregation of heated denaturalization; (2) denatured protein that will assemble separately; (3) protein folding of auxiliary sex change returns its original configuration; (4) assist to decompose strained protein (Suk-Whan and Elizabeth 2001).Most heat shock protein is high conservative on developing.In the Antisense Suppression mode, stop the expression of Arabidopis thaliana HSP101, can make mutant strain lose acquired thermotolerance, mutant strain is through 38 ℃, still can't (Gurley 2000 the environment existence of 45 ℃ under the pre-treatment of 90 minutes; Suk-Whan and Elizabeth 2001).Heat shock protein and thermal excited transcryption factor are except working under heat shock, and be also relevant with other multiple abiotic stress, as arid, (Kotak, Larkindale et al.2007) such as high salt and low temperature stress.Tomato sHSP can be by low temperature induction, and HSP21 is found to be included in anti-oxidant approach, and At HSP17.6 can be induced by osmotic pressure.At seed germination, particularly early stage, genetic transcription is active, and protein is synthetic in a large number, and the propagation of cell and differentiation are very violent, and the environment of cell is in continuous variation, and cell stimulates very responsive to external world.The HSPs in this period changes and effect shows very outstandingly (Hsu, Lai et al.2010).At present, the T-DNA insertion mutation strain hot1 that has no arabidopsis gene HSP101 disappearance and this gene in prior art can change the report of seed preservation, Germination Characteristics.

Summary of the invention:

The object of the present invention is to provide a kind of Arabidopis thaliana heat shock protein gene HSP101 and T-DNA insertion mutation strain hot1 thereof the application in seed germination, preservation and farm crop produce.

The present invention also aims to provide the application in a kind of arabidopsis gene HSP101 and the transgenic plant of T-DNA insertion mutation strain hot1 aspect cultivation has raising seed germination and preservation thereof, and cultivation has low levels dormin (ABA), high-content Plant hormones regulators,gibberellins (GA ₃) and the seed of growth hormone (IAA) in application.

In order to realize above-mentioned purpose of the present invention, the present invention has adopted following technical scheme:

The application of Arabidopis thaliana heat shock protein gene HSP101 in seed germination.

The application of Arabidopis thaliana heat shock protein gene HSP101 in seed storage.

Arabidopis thaliana heat shock protein gene HSP101 has low levels dormin ABA in cultivation, high-content Plant hormones regulators,gibberellins GA ₃With the application in the seed of growth hormone IAA.

Arabidopis thaliana heat shock protein gene HSP101 disappearance makes the Arabidopis thaliana seed have higher vigor.

Arabidopis thaliana heat shock protein gene HSP101 disappearance makes the Arabidopis thaliana seed responsive to temper(ing), storage endurance not in natural preservation process.

Arabidopis thaliana heat shock protein gene HSP101 disappearance makes endogenous hormones dormin ABA reduction in the Arabidopis thaliana seed, Plant hormones regulators,gibberellins GA ₃Raise, growth hormone IAA raises, and is conducive to sprout.

The application of the T-DNA insertion mutation strain hot1 of arabidopsis gene HSP101 in the transgenic plant of cultivating the improved seed sprouting.

The application of the T-DNA insertion mutation strain hot1 of arabidopsis gene HSP101 in the transgenic plant of cultivating the improved seed storage.

The T-DNA insertion mutation strain hot1 of Arabidopis thaliana HSP101 has low levels dormin ABA in cultivation, high-content Plant hormones regulators,gibberellins GA ₃With the application in the seed of growth hormone IAA.

The numbering of gene HSP101 of the present invention in GenBank is AT1G74310, the long 2736bp of the CDS of this gene, and 911 amino acid of encoding, its nucleotide sequence and aminoacid sequence are as shown in table 1.The Arabidopsis Mutants hot1 that the HSP101 gene T-DNA that utilization obtains from Arabidopis thaliana Biological resources center ABRC (Arabidopsis Biological Resource Center) inserts is as research object, the seed of mutant strain is numbered SALK_066374, one section T-DNA that mutant hot1 comes from carrier pROK2 inserts in the exon of gene HSP101, cause transgenation, the flanking sequence at insertion point place is as shown in table 2.

The present invention finds heat shock protein gene HSP101 function and Seed germination and aging relevant in the model plant Arabidopis thaliana, this genetically deficient can make the Arabidopis thaliana seed have higher vigor, but responsive to temper(ing), storage endurance not in natural preservation process, endogenous hormones dormin (ABA) reduces simultaneously, Plant hormones regulators,gibberellins (GA ₃) raise, growth hormone (IAA) raises, and is conducive to sprout.Therefore the present invention finds to operate gene HSP101 and can change seed preservation and Germination characteristics, germ plasm resource preserve and farm crop production in good application prospect is arranged.

Description of drawings:

Fig. 1 is that Western Blot identifies;

Fig. 2 is the PCR test, and Fig. 2 A is PCR design of primers schematic diagram; Fig. 2 B is electrophoresis result theory expectation schematic diagram;

Fig. 3 is that PCR identifies electrophoresis result;

Fig. 4 is the Seed Germination of Arabidopsis Pumila gesture;

Fig. 5 is the weather aging of Arabidopis thaliana seed, and Fig. 5 A is Arabidopis thaliana seed weather aging 2 years; Fig. 5 B is 2 years germination rates of Arabidopis thaliana seed weather aging;

Fig. 6 is the temper(ing) of Arabidopis thaliana seed;

Fig. 7 is Arabidopis thaliana Seed Endogenous Hormones content; Fig. 7 A is seed endogenous GA 3 content; Fig. 7 B is seed Endogenous IAA content; Fig. 7 C is the seed endogenous aba content.

Embodiment 1:

The acquisition of mutant strain:

The numbering of Arabidopis thaliana heat shock protein gene HSP101 of the present invention in GenBank is AT1G74310, the long 2736bp of the CDS of this gene, nucleotide sequence is (table 1) as shown in sequence table, 911 amino acid of encoding, and aminoacid sequence is (table 1) as shown in sequence table.The T-DNA that has bought this gene from U.S.'s Arabidopis thaliana Biological resources center Arabidopsis Biological Resource Center (ABRC) inserts strain seed (SALK_066374), the mutant strain name is called hot1, its insertion point flanking sequence such as table 2.

CDS sequence and the aminoacid sequence of table 1HSP101

1 ATGAATCCAGAGAAATTCACACACAAGACAAACGAGACAATTGCTACAGCTCATGAGCTA

1 METAsnProGluLysPheThrHisLysThrAsnGluThrIleAlaThrAlaHisGluLeu

61 GCTGTGAATGCAGGACATGCTCAATTCACTCCTTTGCATTTAGCTGGTGCTTTGATCTCT

21 AlaValAsnAlaGlyHisAlaGlnPheThrProLeuHisLeuAlaGlyAlaLeuIleSer

121GATCCCACCGGTATATTTCCTCAAGCAATCTCTAGTGCCGGTGGCGAGAACGCAGCTCAA

41 AspProThrGlyIlePheProGlnAlaIleSerSerAlaGlyGlyGluAsnAlaAlaGln

181TCTGCTGAAAGAGTGATCAATCAAGCCTTGAAGAAGCTTCCTTCACAATCTCCTCCACCT

61 SerAlaGluArgValIleAsnGlnAlaLeuLysLysLeuProSerGlnSerProProPro

241GATGATATTCCAGCGAGTTCTAGTCTTATTAAGGTCATTCGTCGTGCTCAAGCTGCTCAG

81 AspAspIleProAlaSerSerSerLeuIleLysValIleArgArgAlaGlnAlaAlaGln

301AAGTCACGAGGTGATACTCATTTGGCTGTTGACCAGTTGATTATGGGTCTTCTTGAAGAT

101LysSerArgGlyAspThrHisLeuAlaValAspGlnLeuIleMETGlyLeuLeuGluAsp

361TCTCAAATCAGGGATTTGTTGAACGAAGTCGGTGTAGCGACGGCGAGGGTAAAGTCTGAG

121SerGlnIleArgAspLeuLeuAsnGluValGlyValAlaThrAlaArgValLysSerGlu

421 GTTGAGAAGCTTCGTGGGAAAGAAGGGAAGAAAGTTGAGAGTGCTTCAGGGGACACAAAT

141 ValGluLysLeuArgGlyLysGluGlyLysLysValGluSerAlaSerGlyAspThrAsn

481 TTTCAAGCTTTAAAGACTTATGGAAGAGATTTGGTTGAGCAAGCAGGGAAGCTTGATCCT

161 PheGlnAlaLeuLysThrTyrGlyArgAspLeuValGluGlnAlaGlyLysLeuAspPro

541 GTGATTGGTCGTGATGAGGAGATTAGAAGAGTCGTGAGGATTCTTTCGAGGAGAACGAAG

181 ValIleGlyArgAspGluGluIleArgArgValValArgIleLeuSerArgArgThrLys

601 AACAATCCTGTGCTATTGGAGAGCCAGGAGTTGGTAAAACAGCTGTGGTTGAAGGTTTA

201 AsnAsnProValLeuIleGlyGluProGlyValGlyLysThrAlaValValGluGlyLeu

661 GCACAAAGGATTGTGAAAGGAGATGTGCCCAACAGTCTTACTGATGTGAGATTAATTTCG

221 AlaGlnArgIleValLysGlyAspValProAsnSerLeuThrAspValArgLeuIleSer

721 TTGGACATGGGTGCGTTAGTTGCTGGTGCTAAATACCGAGGAGAGTTTGAAGAAAGGTTG

241 LeuAspMETGlyAlaLeuValAlaGlyAlaLysTyrArgGlyGluPheGluGluArgLeu

781 AAATCTGTTTTGAAAGAAGTTGAGGACGCTGAAGGCAAAGTGATTCTCTTTATTGATGAG

261 LysSerValLeuLysGluValGluAspAlaGluGlyLysValIleLeuPheIleAspGlu

841 ATTCATTTGGTTCTTGGTGCTGGCAAAACTGAAGGGTCGATGGATGCAGCTAATCTGTTC

281 IleHisLeuValLeuGlyAlaGlyLysThrGluGlySerMETAspAlaAlaAsnLeuPhe

901 AAGCCCATGTTAGCTAGAGGGCAGCTTCGATGCATTGGTGCTACAACGCTTGAAGAATAC

301 LysProMETLeuAlaArgGlyGlnLeuArgCysIleGlyAlaThrThrLeuGluGluTyr

961 AGGAAATATGTTGAGAAAGATGCTGCCTTTGAGAGGAGGTTCCAACAAGTCTATGTTGCG

321 ArgLysTyrValGluLysAspAlaAlaPheGluArgArgPheGlnGlnValTyrValAla

1021GAGCCAAGTGTGCCTGACACCATTAGTATCCTTAGAGGACTCAAGGAGAAGTATGAGGGA

341 GluProSerValProAspThrIleSerIleLeuArgGlyLeuLysGluLysTyrGluGly

1081CATCATGGTGTGCGAATCCAAGACAGAGCTCTTATAAATGCTGCTCAGCTGTCTGCTCGT

361 HisHisGlyValArgIleGlnAspArgAlaLeuIleAsnAlaAlaGlnLeuSerAlaArg

1141TACATAACTGGTCGGCATTTACCGGATAAAGCAATTGATTTGGTTGATGAGGCTTGTGCG

381 TyrIleThrGlyArgHisLeuProAspLysAlaIleAspLeuValAspGluAlaCysAla

1201AATGTGAGAGTCCAGCTTGATAGTCAACCTGAAGAGATTGATAACCTTGAAAGGAAGAGG

401 AsnValArgValGlnLeuAspSerGlnProGluGluIleAspAsnLeuGluArgLysArg

1261ATGCAGCTGGAAATTGAACTTCACGCCTTGGAAAGGGAGAAGGATAAAGCCAGCAAAGCT

421 METGlnLeuGluIleGluLeuHisAlaLeuGluArgGluLysAspLysAlaSerLysAla

1321CGACTTATAGAGGTGCGGAAAGAGCTTGATGACCTGAGAGACAAGCTTCAGCCTCTCACG

441 ArgLeuIleGluValArgLysGluLeuAspAspLeuArgAspLysLeuGlnProLeuThr

1381ATGAAATACAGAAAGGAGAAAGAGAGAATTGATGAGATTCGAAGGCTTAAACAGAAAAGA

461 METLysTyrArgLysGluLysGluArgIleAspGluIleArgArgLeuLysGlnLysArg

1441GAAGAGCTCATGTTTTCTTTGCAGGAGGCAGAACGAAGATATGACCTTGCAAGAGCTGCT

481 GluGluLeuMETPheSerLeuGlnGluAlaGluArgArgTyrAspLeuAlaArgAlaAla

1501GATCTAAGATATGGCGCAATTCAAGAAGTGGAATCTGCAATTGCCCAACTTGAAGGAACT

501 AspLeuArgTyrGlyAlaIleGlnGluValGluSerAlaIleAlaGlnLeuGluGlyThr

1561TCTTCTGAAGAGAATGTGATGCTCACAGAAAACGTTGGGCCTGAACACATTGCTGAGGTT

521 SerSerGluGluAsnValMETLeuThrGluAsnValGlyProGluHisIleAlaGluVal

1621GTGAGCCGTTGGACAGGGATTCCAGTGACGAGACTTGGCCAAAATGAGAAGGAGAGGTTG

541 ValSerArgTrpThrGlyIleProValThrArgLeuGlyGlnAsnGluLysGluArgLeu

1681ATTGGTCTTGCTGATAGGTTGCATAAGCGGGTTGTGGGACAGAATCAAGCGGTAAATGCA

561 IleGlyLeuAlaAspArgLeuHisLysArgValValGlyGlnAsnGlnAlaValAsnAla

1741GTTTCTGAGGCAATTCTAAGGTCAAGGGCAGGACTTGGAAGGCCACAACAGCCAACTGGA

581 ValSerGluAlaIleLeuArgSerArgAlaGlyLeuGlyArgProGlnGlnProThrGly

1801TCATTCTTATTCCTTGGACCAACTGGTGTTGGCAAAACTGAGCTCGCCAAGGCTCTTGCT

601 SerPheLeuPheLeuGlyProThrGlyValGlyLysThrGluLeuAlaLysAlaLeuAla

1861GAGCAGCTGTTTGATGATGAAAACCTCTTAGTTCGGATTGATATGTCGGAATATATGGAA

621 GluGlnLeuPheAspAspGluAsnLeuLeuValArgIleAspMETSerGluTyrMETGlu

1921CAACACTCTGTCTCTCGCCTCATTGGGGCACCACCAGGGTATGTTGGTCACGAGGAAGGT

641 GlnHisSerValSerArgLeuIleGlyAlaProProGlyTyrValGlyHisGluGluGly

1981GGACAACTAACTGAGGCTGTGAGGAGGCGACCTTATTGTGTCATACTCTTTGATGAAGTG

661 GlyGlnLeuThrGluAlaValArgArgArgProTyrCysValIleLeuPheAspGluVal

2041GAGAAGGCTCATGTTGCTGTCTTCAACACTCTGCTCCAAGTTTTGGATGATGGTCGATTG

681 GluLysAlaHisValAlaValPheAsnThrLeuLeuGlnValLeuAspAspGlyArgLeu

2101ACAGACGGGCAAGGCAGGACAGTCGATTTCAGGAACTCGGTGATAATCATGACATCAAAC

701 ThrAspGlyGlnGlyArgThrValAspPheArgAsnSerValIleIleMETThrSerAsn

2161CTTGGTGCTGAACACCTCCTTGCAGGGCTAACTGGGAAAGTAACAATGGAAGTGGCCCGG

721 LeuGlyAlaGluHisLeuLeuAlaGlyLeuThrGlyLysValThrMETGluValAlaArg

2221GACTGTGTGATGCGGGAGGTGAGGAAACACTTCAGACCAGAGCTCTTGAACAGGCTTGAC

741 AspCysValMETArgGluValArgLysHisPheArgProGluLeuLeuAsnArgLeuAsp

2281GAGATTGTGGTGTTCGACCCCCTTTCACATGACCAGTTGAGGAAAGTAGCTCGGCTTCAA

761 GluIleValValPheAspProLeuSerHisAspGlnLeuArgLysValAlaArgLeuGln

2341ATGAAAGACGTTGCTGTCCGGCTTGCTGAAAGAGGAGTTGCTTTGGCAGTCACTGATGCT

781 METLysAspValAlaValArgLeuAlaGluArgGlyValAlaLeuAlaValThrAspAla

2401GCTTTGGACTATATCTTGGCAGAGAGTTATGACCCGGTGTATGGTGCTAGGCCTATAAGG

801 AlaLeuAspTyrIleLeuAlaGluSerTyrAspProValTyrGlyAlaArgProIleArg

2461AGATGGATGGAGAAGAAGGTGGTGACAGAACTGTCAAAGATGGTTGTGCGTGAGGAAATC

821 ArgTrpMETGluLysLysValValThrGluLeuSerLysMETValValArgGluGluIle

2521GATGAAAACTCCACTGTTTACATAGATGCAGGCGCTGGTGATCTTGTGTACCGGGTAGAA

841 AspGluAsnSerThrValTyrIleAspAlaGlyAlaGlyAspLeuValTyrArgValGlu

2581AGTGGAGGTCTAGTGGACGCTTCAACAGGCAAGAAGTCAGATGTGCTGATTCATATTGCT

861 SerGlyGlyLeuValAspAlaSerThrGlyLysLysSerAspValLeuIleHisIleAla

2641AACGGGCCAAAGAGAAGTGATGCAGCTCAGGCGGTGAAGAAGATGAGGATCGAGGAAATA

881 AsnGlyProLysArgSerAspAlaAlaGlnAlaValLysLysMETArgIleGluGluIle

2701GAAGATGACGATAATGAGGAAATGATCGAGGATTAA

901 GluAspAspAspAsnGluGluMETIleGluAsp＊＊＊

Table 2 insertion point flanking sequence

1ATCTC TGATC CCACC GGTAT ATTTC CTCAA GCAAT CTCTA GTGCC GGTGG

51CGAGA ACGCA GCTCA ATCTG CTGAA AGAGT GATCA ATCAA GCCTT GAAGA

101AGCT (Length：104)

Embodiment 2:

The check of mutant strain and homozygote are identified:

Western Blot identifies: wild-type Col and mutant hot1 seed extract total protein, detect the expression of albumen HSP101 with Western Blot.Result as shown in Figure 1, in wild type seeds, positive findings, appear in hsp101 gene normal expression, HSP101 albumen can be detected; And negative findings appears in mutant hot1, HSP101 albumen can not be detected, illustrates that in mutant hot1, this gene has been knocked really, can not express.

PCR identifies that homozygote: T-DNA inserts the genotypic evaluation of strain and needs three primers, is respectively: LP (5 '-AAT AAT GCG GCA AAA GAG GAG-3 ') is positioned on genome T-DNA insertion point left arm end place; RP (5 '-CTG CTT GCT CAA AAT CTC-3 ') is positioned at T-DNA insertion point right arm end place; The .PCR design of primers of primer BP:LBb3:(5 ' on T-DNA left arm end-ATTTTGCCGATTTCGGAAC-3) with reference to SIGNA (http://signa1.salk.edu/tdnaprimers.2.htm1) related data .PCR principle as shown in Figure 2.

Milling and extracting wild-type Col and mutant hot1 leaves genomic DNA carry out PCR as template.As shown in Figure 3, when this carries out pcr amplification and carry out electrophoresis primer with LP and RP, produce a PCR product band in wild-type plant Col, molecular weight is approximately 1100bp, and does not have the PCR product to form in mutant hot1 plant; When this increases to primer PCR with RP and LBb3, there is no the PCR product in the wild-type plant, and a PCR product band is arranged in mutant hot1 plant.Therefore identify that mutant hot1 plant is homozygote homozygote (HM).

Embodiment 3:

Have higher vigor in Arabidopis thaliana after the hsp101 gene knockout:

Wild-type Col and mutant hot1 seed are placed in 25 ℃ of illumination of culture dish and sprout, undertaken by the standard germination test method, four repetitions are established in each processing, and are isometric with radicle length and seed, it is the germination standard that radicel length reaches seed one half, 6 days calculating germination rates.As shown in Figure 4, lower than mutant hot1, mutant hot1 seed has higher vigor to wild-type Col seed at 24h, 48h germination rate.

Embodiment 4:

In Arabidopis thaliana, the hsp101 gene is knocked in rear storage naturally vigor and loses faster:

Seed is under the condition that storage or Germplasm Bank are preserved naturally, and its germinating power can be lost gradually, and weather aging occurs.This experiment is got the wild-type Col that receives in August, 2009 and mutant hot1 seed storage at room temperature, gets the seed of storing 2 years in September, 2011 and sprouts experiment detection vigor.Be placed in 25 ℃ of illumination of culture dish and germinate, use the filter paper moisturizing in culture dish.Carry out 15 days statistics germination rates by the standard germination test method.As shown in Figure 5, through the weather aging wild-type Col of 2 years and mutant hot1 seed germination rate, in various degree decline is arranged, wild-type Col germination rate can also reach 85%, and mutant hot1 seed germination rate has dropped to 60%, in Arabidopis thaliana the hsp101 gene be knocked in rear weather aging process vigor lose faster, more not anti-storage.

Embodiment 5:

More responsive in the temper(ing) process after in Arabidopis thaliana, the hsp101 gene is knocked:

It is 45 ℃ that wild-type Col and mutant hot1 seed are placed on temperature, in the environment of relative humidity 100%, and treatment time 0h, 12h, 24h, 48h, 72h.The taking-up seed that is disposed is placed in 25 ℃ of illumination of culture dish of filter paper moisturizing and germinates.Carry out 15 days statistics germination rates by the standard germination test method.As shown in Figure 6, along with the prolongation of hot and humid ageing treatment time, wild-type Col and mutant hot1 seed are all on a declining curve; Mutant hot1 seed is more responsive, and vigor descends sooner, and burin-in process 24h begins, and germinating energy descends rapidly along with the prolongation of digestion time.During 48h, germination rate is almost 0%.

Embodiment 6:

In wild-type Col and mutant hot1 seed, endogenous hormones detects:

One, the extraction of sample:

Take the methyl alcohol that 0.2g wild-type Col and mutant hot1 seed add 2ml sample extracting solution 80%, grind to form homogenate in ice bath, change the 10ml test tube over to, then with the gradation of 2ml extracting solution, mortar is rinsed well, change in the lump in test tube, be placed on after shaking up in 4 ℃ of refrigerators.4 ℃ are extracted 4h, and 3500 turn/the centrifugal 8min of min, get supernatant liquor.Add the 1ml extracting solution in precipitation, stir evenly, put and extract again 1h under 4 ℃, centrifugal, merge supernatant liquor and recording volume, residue claims dry weight.Supernatant liquor is changed in 15ml glass centrifuge tube, dry up with nitrogen, remove the methyl alcohol in extracting solution, use the sample liquid constant volume.

Two, sample determination (enzyme-linked immunoassay ELISA)

(1) coated: as to add a certain amount of envelope antigen mixing in the coated damping fluid of 10ml, add 100uL in enzyme plate each hole.Then enzyme plate is bandaged with preservative film, in 37 ℃ of lower 3h.

(2) wash plate: the plate place to go that will be coated with, put at room temperature balance.Then get rid of coating buffer.Add washings, place 0.5min and get rid of again washings.Repeat 3 this.

(3) competition: add standard substance, treat test sample and antibody, 37 ℃ of left and right 0.5h.

(4) wash plate: reaction solution is dried, add washings and wash plate four times.

(5) adding two resists: put 37 ℃ of incubation 0.5h.

(6) wash plate: reaction solution is dried, add washings and wash plate four times.

(7) add the substrate nitrite ion: take 10-20mg O-Phenylene Diamine (OPD) and be dissolved in the 10ml substrate buffer solution, add the 2-4ul30% hydrogen peroxide after the dissolving fully.Mixing adds 100ul in every hole, then put into wet box, and after colour developing suitably, every hole adds 50ul 2mol/L sulfuric acid termination reaction.

(8) colorimetric: the OD value at each concentration of sequentially determining standard substance and each sample 490nm place on the enzyme linked immunological spectrophotometer.

Comparison of computational results, as shown in Figure 7, in Arabidopis thaliana, the hsp101 gene is knocked Plant hormones regulators,gibberellins (GA in rear seed ₃) and the rising of growth hormone (IAA) content, and dormin (ABA) content reduces, and is conducive to sprout.

Claims

1. Arabidopis thaliana heat shock protein gene HSP101 and T-DNA insertion mutation strain hot1 thereof the application in the transgenic plant of cultivating the improved seed storage, it is characterized in that Arabidopis thaliana heat shock protein gene HSP101 disappearance makes the Arabidopis thaliana seed responsive to temper(ing), storage endurance not in natural preservation process.