CN103173431B - Applications of insertion of Arabidopis thaliana heat shock protein gene HSP101 and its T-DNA to mutant strain hot1 - Google Patents
Applications of insertion of Arabidopis thaliana heat shock protein gene HSP101 and its T-DNA to mutant strain hot1 Download PDFInfo
- Publication number
- CN103173431B CN103173431B CN201310076606.9A CN201310076606A CN103173431B CN 103173431 B CN103173431 B CN 103173431B CN 201310076606 A CN201310076606 A CN 201310076606A CN 103173431 B CN103173431 B CN 103173431B
- Authority
- CN
- China
- Prior art keywords
- seed
- hsp101
- arabidopis thaliana
- gene
- hot1
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Abstract
The invention provides applications of the insertion of an Arabidopis thaliana heat shock protein gene HSP101 and its T-DNA to a mutant strain hot1 in the change of seed germination and preservation, comprising an application of the insertion of the gene T-DNA to the mutant strain hot1 in transgenic plants for changing the seed germination and preservation, and an application in the cultivation of seeds having a low abscisic acid (ABA) content, a high gibberellin (GA3) content and a high indoleacetic acid (IAA) content. In the invention, a case that the Arabidopis thaliana heat shock protein gene HSP101 in a mode plant Arabidopis thaliana has seed germination and ageing related functions, and the deletion of the gene makes Arabidopis thaliana seeds be sensitive to artificial ageing and not resist storage in the natural preservation process, the endogenous hormone ABA is reduced, the GA3 is risen, and the IAA is risen, and it is in favor of germination. The operation gene HSP101 can change the seed preservation and germination characteristics, and has a good application prospect in the genetic resource preservation and crop production.
Description
The application is the divisional application of patent application " application of Arabidopis thaliana heat shock protein gene HSP101 in seed germination and preservation " (application number: 2012100123017, the applying date: on January 16th, 2012).
Technical field:
The invention belongs to seed physiology and plant genetic engineering field.Particularly, relate to arabidopsis gene HSP101 and T-DNA insertion mutation strain hot1 thereof in the application changing in seed preservation, Germination Characteristics, also relate to the application in the transgenic plant of this gene T-DNA insertion mutation strain hot1 aspect changing seed germination and preservation simultaneously, and there is low levels dormin (ABA) in cultivation, high-content Plant hormones regulators,gibberellins (GA
3) and the seed of growth hormone (IAA) in application.
Background technology:
The preservation of seed is the important means of Preservation of plant germplasin, its protection to species diversity, agriculture production is had great importance.According to statistics, the plant germplasm resource of having collected in the world has 6,100,000 parts, wherein 90% is kept in low temperature Germplasm Bank with seed form, and the germplasm quantity of the long-term storage of China has reached 340,000 parts, occupies first place in the world.But germplasm cryopreservation also exists a lot of problems, what wherein Genetic Integrity of Germplasm Resource is had the greatest impact is exactly Seed Aging problem, shows as percentage of germination and reduces.Seed germinating power in naturally storing also can be lost gradually, weather aging that Here it is (Machado Neto, Custodio et al.2001).Weather aging lasts longer, is difficult to application in breed improvement while carrying out germplasm screening; Temper(ing) can overcome the deficiency that under normal temperature, weather aging required time is grown, and is widely used in the research of Seed Storability, and temper(ing) often adopts hot and humid method.In the process of Seed Aging, can there is a series of Physiology and biochemistry and heredity variation; comprise: the variation of variation, organic content and kind and the variation of genetic construction (Galleschi, the Capocchi et al.2002 of plasma membrane injury, material energy metabolism; Andreev, Spiridonova et al.2004; Freitas, Dias et al.2006).Therefore, carry out the correlative study of Seed Aging, disclose Mechanism of Seed Aging and further find out relevant countermeasure, preserve and have important practical significance for germ plasm resource.
Seed is the important production means in agricultural, horticultural production, and it sprouts the production that directly affects agricultural gardening.People manage to make the neat recovery growth rapidly of embryo breaking dormancy for sowing obtains neat seedling shape seedling, for high yield lays the foundation.The sprouting of seed is subject to the coordinated regulation (Bewley1997) of environmental factors (as light, temperature and humidity etc.) and internal factor (as color and the structure etc. of gene, hormone, sugar, nitrogenous compound, seed coat).Hormone regulating and controlling aspect, Plant hormones regulators,gibberellins (GA
3), growth hormone (IAA) and dormin (ABA) be the main plant hormone of regulation and control seed germination and dormancy.ABA suppresses to sprout, induced dormancy, and Plant hormones regulators,gibberellins and growth hormone promote to sprout, and are the Main Factors of antagonism ABA, are seed germination institute essential (Flores, Jurado et al.2006; Rizza, Boccaccini et al.2010).At present, not yet clear and definite to " switch " mechanism of sprouting by dormancy, the especially research aspect to Regulation in Seed Germination genes involved.
Heat shock protein Heat Shock Protein(HSP) be extensively present in (Zhang in the tissue such as plant cell membrane, tenuigenin, chloroplast(id), plastosome, Wang et al.2007), one group of protein that structure is conservative, according to the homology of its molecular size range and sequence, can be divided into five classes (Papp, Nardai et al.2003) such as small HSPs (sHSPs), HSP60, HSP70, HSP90 and HSP100.Their major function has: (1) prevents the protein aggregation of heated denaturalization; (2) by the denatured protein of having assembled separately; (3) protein folding of auxiliary sex change returns its original configuration; (4) assist to decompose strained protein (Suk-Whan and Elizabeth2001).Most heat shock protein is high conservative on developing.In Antisense Suppression mode, stop the expression of Arabidopis thaliana HSP101, can make mutant strain lose acquired thermotolerance, mutant strain, still cannot be at the environment existence (Gurley2000 of 45 DEG C under the pre-treatment of 90 minutes through 38 DEG C; Suk-Whan and Elizabeth2001).Heat shock protein and thermal excited transcryption factor except working under heat shock, also relevant with other multiple abiotic stress, as arid, and high salt and low temperature stress etc. (Kotak, Larkindale et al.2007).Tomato sHSP can be by low temperature induction, and HSP21 is found to be included in anti-oxidant approach, and At HSP17.6 can be induced by osmotic pressure.At seed germination, particularly early stage, genetic transcription is active, and protein is synthetic in a large number, and the propagation of cell and differentiation are very violent, and the environment of cell is in continuous variation, and cell stimulates very responsive to external world.The HSPs in this period changes and effect shows very outstandingly (Hsu, Lai et al.2010).At present, the T-DNA insertion mutation strain hot1 that has no arabidopsis gene HSP101 disappearance and this gene in prior art can change the report of seed preservation, Germination Characteristics.
Summary of the invention:
The object of the present invention is to provide a kind of Arabidopis thaliana heat shock protein gene HSP101 and T-DNA insertion mutation strain hot1 thereof the application in seed germination, preservation and farm crop produce.
The present invention also aims to provide the application in a kind of arabidopsis gene HSP101 and the transgenic plant of T-DNA insertion mutation strain hot1 aspect cultivation has raising seed germination and preservation thereof, and cultivation has low levels dormin (ABA), high-content Plant hormones regulators,gibberellins (GA
3) and the seed of growth hormone (IAA) in application.
In order to realize above-mentioned purpose of the present invention, the present invention has adopted following technical scheme:
The application of Arabidopis thaliana heat shock protein gene HSP101 in seed germination.
The application of Arabidopis thaliana heat shock protein gene HSP101 in seed storage.
Arabidopis thaliana heat shock protein gene HSP101 has low levels dormin ABA in cultivation, high-content Plant hormones regulators,gibberellins GA
3with the application in the seed of growth hormone IAA.
Arabidopis thaliana heat shock protein gene HSP101 disappearance makes Arabidopis thaliana seed have higher vigor.
Arabidopis thaliana heat shock protein gene HSP101 disappearance makes Arabidopis thaliana seed to temper(ing) sensitivity, storage endurance not in natural preservation process.
Arabidopis thaliana heat shock protein gene HSP101 disappearance reduces endogenous hormones dormin ABA in Arabidopis thaliana seed, Plant hormones regulators,gibberellins GA
3raise, growth hormone IAA raises, and is conducive to sprout.
The application of the T-DNA insertion mutation strain hot1 of arabidopsis gene HSP101 in the transgenic plant of cultivating improved seed sprouting.
The application of the T-DNA insertion mutation strain hot1 of arabidopsis gene HSP101 in the transgenic plant of cultivating improved seed storage.
The T-DNA insertion mutation strain hot1 of Arabidopis thaliana HSP101 has low levels dormin ABA in cultivation, high-content Plant hormones regulators,gibberellins GA
3with the application in the seed of growth hormone IAA.
The numbering of gene HSP101 of the present invention in GenBank is AT1G74310, the long 2736bp of CDS of this gene, and 911 amino acid of encoding, its nucleotide sequence and aminoacid sequence are as shown in table 1.Utilize the Arabidopsis Mutants hot1 of the HSP101 gene T-DNA insertion obtaining from Arabidopis thaliana Biological resources center ABRC (Arabidopsis Biological Resource Center) as research object, the seed of mutant strain is numbered SALK_066374, one section of T-DNA that mutant hot1 comes from carrier pROK2 inserts in the exon of gene HSP101, cause transgenation, the flanking sequence at insertion point place is as shown in table 2.
The present invention finds the sprouting of heat shock protein gene HSP101 function and seed and aging relevant in model plant Arabidopis thaliana, this genetically deficient can make Arabidopis thaliana seed have higher vigor, but to temper(ing) sensitivity, storage endurance not in natural preservation process, endogenous hormones dormin (ABA) reduces simultaneously, Plant hormones regulators,gibberellins (GA
3) raise, growth hormone (IAA) raises, and is conducive to sprout.Therefore the present invention finds to operate gene HSP101 and can change seed preservation and Germination characteristics, germ plasm resource preserve and farm crop production in have good application prospect.
Brief description of the drawings:
Fig. 1 is Western Blot qualification;
Fig. 2 is PCR test, and Fig. 2 A is PCR design of primers schematic diagram; Fig. 2 B is electrophoresis result theory expectation schematic diagram;
Fig. 3 is PCR qualification electrophoresis result;
Fig. 4 is Seed Germination of Arabidopsis Pumila gesture;
Fig. 5 is the weather aging of Arabidopis thaliana seed, and Fig. 5 A is Arabidopis thaliana seed weather aging 2 years; Fig. 5 B is 2 years germination rates of Arabidopis thaliana seed weather aging;
Fig. 6 is the temper(ing) of Arabidopis thaliana seed;
Fig. 7 is Arabidopis thaliana Seed Endogenous Hormones content; Fig. 7 A is seed endogenous GA 3 content; Fig. 7 B is seed Endogenous IAA content; Fig. 7 C is seed endogenous aba content.
Embodiment 1:
The acquisition of mutant strain:
The numbering of Arabidopis thaliana heat shock protein gene HSP101 of the present invention in GenBank is AT1G74310, the long 2736bp of CDS of this gene, nucleotide sequence is (table 1) as shown in sequence table, 911 amino acid of encoding, and aminoacid sequence is (table 1) as shown in sequence table.The T-DNA that has bought this gene from U.S.'s Arabidopis thaliana Biological resources center Arabidopsis Biological Resource Center (ABRC) inserts strain seed (SALK_066374), mutant strain name is called hot1, and its insertion point flanking sequence is as table 2.
CDS sequence and the aminoacid sequence of table 1HSP101
1 ATGAATCCAGAGAAATTCACACACAAGACAAACGAGACAATTGCTACAGCTCATGAGCTA
1 METAsnProGluLysPheThrHisLysThrAsnGluThrIleAlaThrAlaHisGluLeu
61 GCTGTGAATGCAGGACATGCTCAATTCACTCCTTTGCATTTAGCTGGTGCTTTGATCTCT
21 AlaValAsnAlaGlyHisAlaGlnPheThrProLeuHisLeuAlaGlyAlaLeuIleSer
121 GATCCCACCGGTATATTTCCTCAAGCAATCTCTAGTGCCGGTGGCGAGAACGCAGCTCAA
41 AspProThrGlyIlePheProGlnAlaIleSerSerAlaGlyGlyGluAsnAlaAlaGln
181 TCTGCTGAAAGAGTGATCAATCAAGCCTTGAAGAAGCTTCCTTCACAATCTCCTCCACCT
61 SerAlaGluArgValIleAsnGlnAlaLeuLysLysLeuProSerGlnSerProProPro
241 GATGATATTCCAGCGAGTTCTAGTCTTATTAAGGTCATTCGTCGTGCTCAAGCTGCTCAG
81 AspAspIleProAlaSerSerSerLeuIleLysValIleArgArgAlaGlnAlaAlaGln
301 AAGTCACGAGGTGATACTCATTTGGCTGTTGACCAGTTGATTATGGGTCTTCTTGAAGAT
101 LysSerArgGlyAspThrHisLeuAlaValAspGlnLeuIleMETGlyLeuLeuGluAsp
361 TCTCAAATCAGGGATTTGTTGAACGAAGTCGGTGTAGCGACGGCGAGGGTAAAGTCTGAG
121 SerGlnIleArgAspLeuLeuAsnGluValGlyValAlaThrAlaArgValLysSerGlu
421 GTTGAGAAGCTTCGTGGGAAAGAAGGGAAGAAAGTTGAGAGTGCTTCAGGGGACACAAAT
141 ValGluLysLeuArgGlyLysGluGlyLysLysValGluSerAlaSerGlyAspThrAsn
481 TTTCAAGCTTTAAAGACTTATGGAAGAGATTTGGTTGAGCAAGCAGGGAAGCTTGATCCT
161 PheGlnAlaLeuLysThrTyrGlyArgAspLeuValGluGlnAlaGlyLysLeuAspPro
541 GTGATTGGTCGTGATGAGGAGATTAGAAGAGTCGTGAGGATTCTTTCGAGGAGAACGAAG
181 ValIleGlyArgAspGluGluIleArgArgValValArgIleLeuSerArgArgThrLys
601 AACAATCCTGTGCTATTGGAGAGCCAGGAGTTGGTAAAACAGCTGTGGTTGAAGGTTTA
201 AsnAsnProValLeuIleGlyGluProGlyValGlyLysThrAlaValValGluGlyLeu
661 GCACAAAGGATTGTGAAAGGAGATGTGCCCAACAGTCTTACTGATGTGAGATTAATTTCG
221 AlaGlnArgIleValLysGlyAspValProAsnSerLeuThrAspValArgLeuIleSer
721 TTGGACATGGGTGCGTTAGTTGCTGGTGCTAAATACCGAGGAGAGTTTGAAGAAAGGTTG
241 LeuAspMETGlyAlaLeuValAlaGlyAlaLysTyrArgGlyGluPheGluGluArgLeu
781 AAATCTGTTTTGAAAGAAGTTGAGGACGCTGAAGGCAAAGTGATTCTCTTTATTGATGAG
261 LysSerValLeuLysGluValGluAspAlaGluGlyLysValIleLeuPheIleAspGlu
841 ATTCATTTGGTTCTTGGTGCTGGCAAAACTGAAGGGTCGATGGATGCAGCTAATCTGTTC
281 IleHisLeuValLeuGlyAlaGlyLysThrGluGlySerMETAspAlaAlaAsnLeuPhe
901 AAGCCCATGTTAGCTAGAGGGCAGCTTCGATGCATTGGTGCTACAACGCTTGAAGAATAC
301 LysProMETLeuAlaArgGlyGlnLeuArgCysIleGlyAlaThrThrLeuGluGluTyr
961 AGGAAATATGTTGAGAAAGATGCTGCCTTTGAGAGGAGGTTCCAACAAGTCTATGTTGCG
321 ArgLysTyrValGluLysAspAlaAlaPheGluArgArgPheGlnGlnValTyrValAla
1021 GAGCCAAGTGTGCCTGACACCATTAGTATCCTTAGAGGACTCAAGGAGAAGTATGAGGGA
341 GluProSerValProAspThrIleSerIleLeuArgGlyLeuLysGluLysTyrGluGly
1081 CATCATGGTGTGCGAATCCAAGACAGAGCTCTTATAAATGCTGCTCAGCTGTCTGCTCGT
361 HisHisGlyValArgIleGlnAspArgAlaLeuIleAsnAlaAlaGlnLeuSerAlaArg
1141 TACATAACTGGTCGGCATTTACCGGATAAAGCAATTGATTTGGTTGATGAGGCTTGTGCG
381 TyrIleThrGlyArgHisLeuProAspLysAlaIleAspLeuValAspGluAlaCysAla
1201 AATGTGAGAGTCCAGCTTGATAGTCAACCTGAAGAGATTGATAACCTTGAAAGGAAGAGG
401 AsnValArgValGlnLeuAspSerGlnProGluGluIleAspAsnLeuGluArgLysArg
1261 ATGCAGCTGGAAATTGAACTTCACGCCTTGGAAAGGGAGAAGGATAAAGCCAGCAAAGCT
421 METGlnLeuGluIleGluLeuHisAlaLeuGluArgGluLysAspLysAlaSerLysAla
1321 CGACTTATAGAGGTGCGGAAAGAGCTTGATGACCTGAGAGACAAGCTTCAGCCTCTCACG
441 ArgLeuIleGluValArgLysGluLeuAspAspLeuArgAspLysLeuGlnProLeuThr
1381 ATGAAATACAGAAAGGAGAAAGAGAGAATTGATGAGATTCGAAGGCTTAAACAGAAAAGA
461 METLysTyrArgLysGluLysGluArgIleAspGluIleArgArgLeuLysGlnLysArg
1441 GAAGAGCTCATGTTTTCTTTGCAGGAGGCAGAACGAAGATATGACCTTGCAAGAGCTGCT
481 GluGluLeuMETPheSerLeuGlnGluAlaGluArgArgTyrAspLeuAlaArgAlaAla
1501 GATCTAAGATATGGCGCAATTCAAGAAGTGGAATCTGCAATTGCCCAACTTGAAGGAACT
501 AspLeuArgTyrGlyAlaIleGlnGluValGluSerAlaIleAlaGlnLeuGluGlyThr
1561 TCTTCTGAAGAGAATGTGATGCTCACAGAAAACGTTGGGCCTGAACACATTGCTGAGGTT
521 SerSerGluGluAsnValMETLeuThrGluAsnValGlyProGluHisIleAlaGluVal
1621 GTGAGCCGTTGGACAGGGATTCCAGTGACGAGACTTGGCCAAAATGAGAAGGAGAGGTTG
541 ValSerArgTrpThrGlyIleProValThrArgLeuGlyGlnAsnGluLysGluArgLeu
1681 ATTGGTCTTGCTGATAGGTTGCATAAGCGGGTTGTGGGACAGAATCAAGCGGTAAATGCA
561 IleGlyLeuAlaAspArgLeuHisLysArgValValGlyGlnAsnGlnAlaValAsnAla
1741 GTTTCTGAGGCAATTCTAAGGTCAAGGGCAGGACTTGGAAGGCCACAACAGCCAACTGGA
581 ValSerGluAlaIleLeuArgSerArgAlaGlyLeuGlyArgProGlnGlnProThrGly
1801 TCATTCTTATTCCTTGGACCAACTGGTGTTGGCAAAACTGAGCTCGCCAAGGCTCTTGCT
601 SerPheLeuPheLeuGlyProThrGlyValGlyLysThrGluLeuAlaLysAlaLeuAla
1861 GAGCAGCTGTTTGATGATGAAAACCTCTTAGTTCGGATTGATATGTCGGAATATATGGAA
621 GluGlnLeuPheAspAspGluAsnLeuLeuValArgIleAspMETSerGluTyrMETGlu
1921 CAACACTCTGTCTCTCGCCTCATTGGGGCACCACCAGGGTATGTTGGTCACGAGGAAGGT
641 GlnHisSerValSerArgLeuIleGlyAlaProProGlyTyrValGlyHisGluGluGly
1981 GGACAACTAACTGAGGCTGTGAGGAGGCGACCTTATTGTGTCATACTCTTTGATGAAGTG
661 GlyGlnLeuThrGluAlaValArgArgArgProTyrCysValIleLeuPheAspGluVal
2041 GAGAAGGCTCATGTTGCTGTCTTCAACACTCTGCTCCAAGTTTTGGATGATGGTCGATTG
681 GluLysAlaHisValAlaValPheAsnThrLeuLeuGlnValLeuAspAspGlyArgLeu
2101 ACAGACGGGCAAGGCAGGACAGTCGATTTCAGGAACTCGGTGATAATCATGACATCAAAC
701 ThrAspGlyGlnGlyArgThrValAspPheArgAsnSerValIleIleMETThrSerAsn
2161 CTTGGTGCTGAACACCTCCTTGCAGGGCTAACTGGGAAAGTAACAATGGAAGTGGCCCGG
721 LeuGlyAlaGluHisLeuLeuAlaGlyLeuThrGlyLysValThrMETGluValAlaArg
2221 GACTGTGTGATGCGGGAGGTGAGGAAACACTTCAGACCAGAGCTCTTGAACAGGCTTGAC
741 AspCysValMETArgGluValArgLysHisPheArgProGluLeuLeuAsnArgLeuAsp
2281 GAGATTGTGGTGTTCGACCCCCTTTCACATGACCAGTTGAGGAAAGTAGCTCGGCTTCAA
761 GluIleValValPheAspProLeuSerHisAspGlnLeuArgLysValAlaArgLeuGln
2341 ATGAAAGACGTTGCTGTCCGGCTTGCTGAAAGAGGAGTTGCTTTGGCAGTCACTGATGCT
781 METLysAspValAlaValArgLeuAlaGluArgGlyValAlaLeuAlaValThrAspAla
2401 GCTTTGGACTATATCTTGGCAGAGAGTTATGACCCGGTGTATGGTGCTAGGCCTATAAGG
801 AlaLeuAspTyrIleLeuAlaGluSerTyrAspProValTyrGlyAlaArgProIleArg
2461 AGATGGATGGAGAAGAAGGTGGTGACAGAACTGTCAAAGATGGTTGTGCGTGAGGAAATC
821 ArgTrpMETGluLysLysValValThrGluLeuSerLysMETValValArgGluGluIle
2521 GATGAAAACTCCACTGTTTACATAGATGCAGGCGCTGGTGATCTTGTGTACCGGGTAGAA
841 AspGluAsnSerThrValTyrIleAspAlaGlyAlaGlyAspLeuValTyrArgValGlu
2581 AGTGGAGGTCTAGTGGACGCTTCAACAGGCAAGAAGTCAGATGTGCTGATTCATATTGCT
861 SerGlyGlyLeuValAspAlaSerThrGlyLysLysSerAspValLeuIleHisIleAla
2641 AACGGGCCAAAGAGAAGTGATGCAGCTCAGGCGGTGAAGAAGATGAGGATCGAGGAAATA
881 AsnGlyProLysArgSerAspAlaAlaGlnAlaValLysLysMETArgIleGluGluIle
2701 GAAGATGACGATAATGAGGAAATGATCGAGGATTAA
901 GluAspAspAspAsnGluGluMETIleGluAsp***
Table 2 insertion point flanking sequence
1ATCTC TGATC CCACC GGTAT ATTTC CTCAA GCAAT CTCTA GTGCC GGTGG
51CGAGA ACGCA GCTCA ATCTG CTGAA AGAGT GATCA ATCAA GCCTT GAAGA
101AGCT(Length:104)
Embodiment 2:
The inspection of mutant strain and homozygote qualification:
Western Blot qualification: wild-type Col and mutant hot1 seed extract total protein, detects the expression of albumen HSP101 with Western Blot.As shown in Figure 1, in wild type seeds, there is positive findings in hsp101 gene normal expression to result, HSP101 albumen can be detected; And there is negative findings in mutant hot1, HSP101 albumen can not be detected, illustrate that in mutant hot1, this gene has been knocked really, can not express.
PCR identifies that homozygote: T-DNA inserts the genotypic qualification of strain and needs three primers, respectively: LP (5 '-AAT AAT GCG GCA AAA GAG GAG-3 '), is positioned at T-DNA insertion point left arm end place on genome; RP (5 '-CTG CTT GCT CAA AAT CTC-3 '), is positioned at T-DNA insertion point right arm end place; Primer BP:LBb3:(5 '-ATTTTGCCGATTTCGGAAC-3 on T-DNA left arm end) .PCR design of primers is with reference to SIGNA (http://signa1.salk.edu/tdnaprimers.2.htm1) related data .PCR principle as shown in Figure 2.
Milling and extracting wild-type Col and mutant hot1 leaves genomic DNA carry out PCR as template.As shown in Figure 3, in the time that this carries out pcr amplification and carry out electrophoresis primer with LP and RP, produce a PCR product band in wild-type plant Col, molecular weight is approximately 1100bp, and in mutant hot1 plant, does not have PCR product to form; In the time that this increases to primer PCR with RP and LBb3, in wild-type plant, there is no PCR product, and in mutant hot1 plant, have a PCR product band.Therefore identify that mutant hot1 plant is homozygote homozygote(HM).
Embodiment 3:
In Arabidopis thaliana, after hsp101 gene knockout, there is higher vigor:
Wild-type Col and mutant hot1 seed are placed in 25 DEG C of illumination of culture dish and sprout, undertaken by standard germination test method, four repetitions are established in each processing, isometric with radicle length and seed, it is germination standard that radicel length reaches seed one half, within 6 days, calculates germination rate.As shown in Figure 4, wild-type Col seed is at 24h, 48h germination rate lower than mutant hot1, and mutant hot1 seed has higher vigor.
Embodiment 4:
In Arabidopis thaliana hsp101 gene be knocked rear naturally storage in vigor lose faster:
Seed is under the condition that storage or Germplasm Bank are preserved naturally, and its germinating power can be lost gradually, and weather aging occurs.This experiment is got the wild-type Col that receives in August, 2009 and mutant hot1 seed storage at room temperature, gets the seed of having stored 2 years in September, 2011 and sprouts the detection vigor of testing.Be placed in 25 DEG C of illumination of culture dish and germinate, in culture dish, use filter paper moisturizing.Carry out 15 days statistics germination rates by standard germination test method.As shown in Figure 5, there is decline in various degree through the weather aging wild-type Col of 2 years and mutant hot1 seed germination rate, wild-type Col germination rate can also reach 85%, and mutant hot1 seed germination rate has dropped to 60%, in Arabidopis thaliana hsp101 gene be knocked in rear weather aging process vigor lose faster, more not resistance to storage.
Embodiment 5:
In Arabidopis thaliana, hsp101 gene is more responsive in temper(ing) process after being knocked:
It is 45 DEG C that wild-type Col and mutant hot1 seed are placed on to temperature, in the environment of relative humidity 100%, and treatment time 0h, 12h, 24h, 48h, 72h.The taking-up seed that is disposed, is placed in and germinates with 25 DEG C of illumination of culture dish of filter paper moisturizing.Carry out 15 days statistics germination rates by standard germination test method.As shown in Figure 6, along with the prolongation of hot and humid ageing treatment time, wild-type Col and mutant hot1 seed are all on a declining curve; Mutant hot1 seed is more responsive, and vigor declines sooner, and burin-in process 24h starts, and along with the prolongation of digestion time, germinating energy declines rapidly.When 48h, germination rate is almost 0%.
Embodiment 6:
In wild-type Col and mutant hot1 seed, endogenous hormones detects:
One, the extraction of sample:
Take the methyl alcohol that 0.2g wild-type Col and mutant hot1 seed add 2ml sample extracting solution 80%, in ice bath, grind to form homogenate, proceed to 10ml test tube, then mortar is rinsed well with the gradation of 2ml extracting solution, proceed in the lump in test tube, after shaking up, be placed in 4 DEG C of refrigerators.4 DEG C are extracted 4h, and the centrifugal 8min of 3500 turn/min, gets supernatant liquor.In precipitation, add 1ml extracting solution, stir evenly, put at 4 DEG C and extract again 1h, centrifugal, merge supernatant liquor recording volume, residue claims dry weight.Supernatant liquor is proceeded in 15ml glass centrifuge tube, dry up with nitrogen, remove the methyl alcohol in extracting solution, use sample liquid constant volume.
Two, sample determination (enzyme-linked immunoassay ELISA)
(1) coated: in the coated damping fluid of 10ml, to add a certain amount of envelope antigen to mix, in the each hole of enzyme plate, add 100uL.Then enzyme plate is bandaged to 3h at 37 DEG C with preservative film.
(2) wash plate: by the plate place to go being coated with, put at room temperature balance.Then get rid of coating buffer.Add washings, place 0.5min and get rid of again washings.Repeat 3 this.
(3) competition: add standard substance, treat test sample and antibody, 37 DEG C of left and right 0.5h.
(4) wash plate: reaction solution is dried, add washings and wash plate four times.
(5) adding two resists: put 37 DEG C of incubation 0.5h.
(6) wash plate: reaction solution is dried, add washings and wash plate four times.
(7) add substrate nitrite ion: take 10-20mg O-Phenylene Diamine (OPD) and be dissolved in 10ml substrate buffer solution, after dissolving completely, add 2-4ul30% hydrogen peroxide.Mix, in every hole, add 100ul, then put into wet box, when after colour developing suitably, every hole adds 50ul2mol/L sulfuric acid termination reaction.
(8) colorimetric: the OD value at the each concentration of sequentially determining standard substance and each sample 490nm place on enzyme linked immunological spectrophotometer.
Comparison of computational results, as shown in Figure 7, in Arabidopis thaliana, hsp101 gene is knocked Plant hormones regulators,gibberellins (GA in rear seed
3) and the rising of growth hormone (IAA) content, and dormin (ABA) content reduces, and is conducive to sprout.
Claims (1)
1. Arabidopis thaliana heat shock protein gene HSP101 and T-DNA insertion mutation strain hotl thereof have low levels dormin ABA in cultivation, high-content Plant hormones regulators,gibberellins GA
3with the application in the seed of growth hormone IAA, it is characterized in that Arabidopis thaliana heat shock protein gene HSP101 disappearance reduces endogenous hormones dormin ABA in Arabidopis thaliana seed, Plant hormones regulators,gibberellins GA
3raise, growth hormone IAA raises, and is conducive to sprout; The numbering of described gene HSP101 in GenBank is AT1G74310, and one section of T-DNA that described mutant strain hotl comes from carrier pROK2 inserts in the exon of gene HSP101, and the seed of mutant hotl strain is numbered SALK_066374.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201310076606.9A CN103173431B (en) | 2012-01-16 | 2012-01-16 | Applications of insertion of Arabidopis thaliana heat shock protein gene HSP101 and its T-DNA to mutant strain hot1 |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201310076606.9A CN103173431B (en) | 2012-01-16 | 2012-01-16 | Applications of insertion of Arabidopis thaliana heat shock protein gene HSP101 and its T-DNA to mutant strain hot1 |
Related Parent Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN 201210012301 Division CN102643855B (en) | 2012-01-16 | 2012-01-16 | Application of arabidopsis thaliana heat shock protein gene HSP101 in seed germination and preservation |
Publications (2)
Publication Number | Publication Date |
---|---|
CN103173431A CN103173431A (en) | 2013-06-26 |
CN103173431B true CN103173431B (en) | 2014-08-06 |
Family
ID=48633623
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201310076606.9A Expired - Fee Related CN103173431B (en) | 2012-01-16 | 2012-01-16 | Applications of insertion of Arabidopis thaliana heat shock protein gene HSP101 and its T-DNA to mutant strain hot1 |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN103173431B (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN117551632B (en) * | 2024-01-11 | 2024-04-05 | 三亚中国农业科学院国家南繁研究院 | Gene for regulating growth and development of plant root hair and application thereof |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2001070929A2 (en) * | 2000-03-20 | 2001-09-27 | Arch Development Corporation | Transgenic plants containing heat shock protein |
-
2012
- 2012-01-16 CN CN201310076606.9A patent/CN103173431B/en not_active Expired - Fee Related
Non-Patent Citations (3)
Title |
---|
Hsp101 is necessary for heat tolerance but dispensable for development and germination in the absence of stress;Suk-Whan Hong and Elizabeth Vierling;《The Plant Journal》;20010731;第27卷(第1期);25-35 * |
Suk-Whan Hong and Elizabeth Vierling.Hsp101 is necessary for heat tolerance but dispensable for development and germination in the absence of stress.《The Plant Journal》.2001,第27卷(第1期),25-35. |
William B. Gurley.HSP101:a key component for the acquisition of thermotolerance in plants.《The Plant Cell》.2000,第12卷(第4期),457-460. * |
Also Published As
Publication number | Publication date |
---|---|
CN103173431A (en) | 2013-06-26 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Khan et al. | Coping with drought: stress and adaptive mechanisms, and management through cultural and molecular alternatives in cotton as vital constituents for plant stress resilience and fitness | |
Blum et al. | Plant water relations, plant stress and plant production | |
Araújo et al. | Abiotic stress responses in legumes: strategies used to cope with environmental challenges | |
Jan et al. | Morpho-biochemical evaluation of Brassica rapa sub-species for salt tolerance | |
Sabagh et al. | Salinity stress in maize: Effects of stress and recent developments of tolerance for improvement | |
Liu et al. | Uniconazole and diethyl aminoethyl hexanoate increase soybean pod setting and yield by regulating sucrose and starch content | |
Zhou et al. | Morpholoical and enzymatic responses to waterlogging in three Prunus species | |
Torabi et al. | Effect of exogenous silicon on germination and seedling establishment in Borago officinalis L | |
CN114480482B (en) | Application of OsPUT family gene in regulation and control of rice paraquat resistance | |
Duncan | The association of plant senescence with root and stalk diseases in sorghum | |
CN104611359A (en) | Applications of ZmSPL1 protein and coding gene thereof in corn kernel development regulation | |
CN107466522A (en) | A kind of vernalization breeding method of sorghum | |
He et al. | Co-expression of genes ApGSMT2 and ApDMT2 for glycinebetaine synthesis in maize enhances the drought tolerance of plants | |
Sharma et al. | Ultrastructure, adaptability, and alleviation mechanisms of photosynthetic apparatus in plants under waterlogging: A review | |
CN102643855B (en) | Application of arabidopsis thaliana heat shock protein gene HSP101 in seed germination and preservation | |
Gupta et al. | Effect of water stress on photosynthetic attributes, membrane stability and yield in contrasting wheat genotypes | |
Saeidi et al. | Phaseolus vulgaris genome possesses CAMTA genes, and phavuCAMTA1 contributes to the drought tolerance | |
Valluru et al. | Food security through translational biology between wheat and rice | |
CN103173431B (en) | Applications of insertion of Arabidopis thaliana heat shock protein gene HSP101 and its T-DNA to mutant strain hot1 | |
Zhang et al. | Change of water use efficiency and its relation with root system growth in wheat evolution | |
Magyar-Tábori et al. | Models and tools for studying drought stress responses in peas | |
CN103468712B (en) | Application of GhTZF1 gene to reinforcement on drought resistance of plants and senility delay | |
Reinoso et al. | ABA increased soybean yield by enhancing production of carbohydrates and their allocation in seed | |
Sun et al. | Relationship between seed germination physiological characteristics and germination percentages of direct-seeded hybrid Indica rice under low-temperature and anaerobic interaction | |
Lotfi et al. | Influence of salicylic acid and silicon on seed development and quality of mung bean under salt stress |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140806 Termination date: 20190116 |