CN102643855A

CN102643855A - Application of arabidopsis thaliana heat shock protein gene HSP101 in seed germination and preservation

Info

Publication number: CN102643855A
Application number: CN2012100123017A
Authority: CN
Inventors: 李唯奇; 禹晓梅; 陶发清; 郁步竹
Original assignee: Kunming Institute of Botany of CAS
Current assignee: Kunming Institute of Botany of CAS
Priority date: 2012-01-16
Filing date: 2012-01-16
Publication date: 2012-08-22
Anticipated expiration: 2032-01-16
Also published as: CN102643855B

Abstract

The invention provides application of arabidopsis thaliana gene HSP101 and T-DNA inserted mutant strain hot1 thereof in changing seed germination and preservation, application of the gene T-DNA inserted mutant strain hot1 in transgenic plants for changing seed germination and preservation, and application of the gene T-DNA inserted mutant strain hot1 in culturing seeds with low content of abscisic acid (ABA), and high content of gibberellin (GA3) and auxin (IAA). According to the modular arabidopsis thaliana, the functions of the heat shock protein gene HSP101 is relevant to seed germination and ageing, the arabidopsis thaliana seeds are sensitive to artificial ageing due to gene deletion and are not easy to store in a natural preservation process, and meanwhile, endogenous hormone abscisic acid (ABA) is reduced, gibberellin (GA3) is increased, and auxin (IAA) is increased, so that the germination is favored. Therefore, based on the invention, the gene HSP101 is manipulated, so that the characteristics of the seed preservation and the seed germination can be changed, and the gene HSP101 has very good application prospect in germplasm conservation and crop production.

Description

The application of Arabidopis thaliana HSP gene HSP101 in seed germination and preservation

Technical field:

The invention belongs to seed physiology and plant genetic engineering field.Particularly; Relate to arabidopsis gene HSP101 and T-DNA thereof and insert the application of mutant strain hot1 in changing seed preservation, seed germination characteristic; Also relate to this gene T-DNA simultaneously and insert the application in the transgenic plant of mutant strain hot1 aspect changing seed germination and preservation; And has low levels dormin (ABA), high-content Plant hormones regulators,gibberellins (GA in cultivation ₃) and the seed of growth hormone (IAA) in application.

Background technology:

The preservation of seed is the important means that plant germplasm resource is preserved, and its protection to species diversity, agriculture prodn is had great importance.According to statistics, the plant germplasm resource of having collected in the world has 6,100,000 parts, wherein 90% is kept in the low temperature germplasm storehouse with the seed form, and the germplasm quantity of China's long storage has reached 340,000 parts, occupies first place in the world.But also there are a lot of problems in the germplasm cryopreservation, and what wherein the blastogenesis integrity is had the greatest impact is exactly the Seed Aging problem, shows as percentage of germination and reduces.Seed germinating power in storing naturally also can be lost weather aging that Here it is (Machado Neto, Custodio et al.2001) gradually.Weather aging lasts longer, is difficult to when in breed improvement, carrying out germplasm screening use; Temper(ing) then can overcome the long deficiency of weather aging required time under the normal temperature, and is widely used in the research of seed storage tolerance, and hot and humid method is often adopted in temper(ing).A series of Physiology and biochemistry and heredity variation can take place in the process of Seed Aging, comprising: the variation of plasma membrane injury, the metabolic variation of matter energy, organic content and kind and variation (Galleschi, the Capocchi et al.2002 of genetic construction; Andreev, Spiridonova et al.2004; Freitas, Dias et al.2006).Therefore, carry out the correlative study of Seed Aging, disclose Seed Aging mechanism and further find out relevant countermeasure, preservation has important practical significance for germ plasm resource.

Seed is the important production means during agricultural, gardening are produced, and it sprouts the production that directly influences agricultural gardening.People manage to make the neat rapidly recovery growth of embryo breaking dormancy for sowing obtains neat seedling shape seedling, for high yield lays the foundation.The sprouting of seed receives the coordinated regulation (Bewley 1997) of environmental factors (like light, temperature and humidity etc.) and internal factor (like the color of gene, hormone, sugar, nitrogenous compound, kind skin and structure etc.).The hormone regulating and controlling aspect, Plant hormones regulators,gibberellins (GA ₃), growth hormone (IAA) and dormin (ABA) be the main plant hormone of regulation and control seed dormancy and sprouting.ABA suppresses to sprout, induced dormancy, and Plant hormones regulators,gibberellins and growth hormone promote to sprout, and are the main factors of antagonism ABA, are seed germination institute essential (Flores, Jurado et al.2006; Rizza, Boccaccini et al.2010).At present, not clear and definite as yet by dormancy to " switch " mechanism of sprouting, especially to the research aspect of seed germination regulation and control genes involved.

Heat shock protein Heat Shock Protein (HSP) extensively is present in (Zhang in the tissues such as plant cell membrane, tenuigenin, chloroplast(id), plastosome; Wang et al.2007); Be the conservative protein of one group of structure; According to the homology of its molecular weight size, can be divided into five types (Papp, Nardai et al.2003) such as small HSPs (sHSPs), HSP60, HSP70, HSP90 and HSP100 with sequence.Their major function has: (1) prevents the protein aggregation of heated denaturalization; (2) the accumulative denatured protein separates; (3) protein folding of auxiliary sex change returns its original configuration; (4) assist to decompose strained protein (Suk-Whan and Elizabeth 2001).Most heat shock protein is a high conservative on developing.With the Antisense Suppression mode, stop the expression of Arabidopis thaliana HSP101, can make mutant strain lose acquired thermotolerance, mutant strain is on 38 ℃ on warp, and still can't surviving at 45 ℃ environment under 90 minutes the pre-treatment, (Gurley 2000; Suk-Whan and Elizabeth 2001).HSP and thermal excited transcryption factor are except working under heat shock, and be also relevant with other multiple abiotic stress, like arid, (Kotak, Larkindale et al.2007) such as high salt and low temperature stress.Tomato sHSP can be by low temperature induction, and HSP21 comes to light and is included in the anti-oxidant approach, and At HSP17.6 then can be induced by osmotic pressure.At seed germination, particularly early stage, genetic transcription is active, and protein is synthetic in a large number, and the propagation of cell and differentiation are very violent, and the environment of cell is in continuous variation, and cell stimulates very responsive to external world.The HSPs in this period changes and effect shows very outstandingly (Hsu, Lai et al.2010).At present, the T-DNA that does not see arabidopsis gene HSP101 disappearance and this gene in the prior art inserts the report that mutant strain hot1 can change seed preservation, seed germination characteristic.

Summary of the invention:

The object of the present invention is to provide a kind of Arabidopis thaliana HSP gene HSP101 and T-DNA thereof to insert the application of mutant strain hot1 in seed germination, preservation and farm crop produce.

The present invention also aims to provide a kind of arabidopsis gene HSP101 and T-DNA thereof to insert the application in the transgenic plant of mutant strain hot1 aspect cultivation has raising seed germination and preservation; And cultivation has low levels dormin (ABA), high-content Plant hormones regulators,gibberellins (GA ₃) and the seed of growth hormone (IAA) in application.

In order to realize above-mentioned purpose of the present invention, the present invention has adopted following technical scheme:

The application of Arabidopis thaliana HSP gene HSP101 in seed germination.

The application of Arabidopis thaliana HSP gene HSP101 in seed storage.

Arabidopis thaliana HSP gene HSP101 has low levels dormin ABA in cultivation, high-content Plant hormones regulators,gibberellins GA ₃With the application in the seed of growth hormone IAA.

Arabidopis thaliana HSP gene HSP101 disappearance makes the Arabidopis thaliana seed have higher vigor.

Arabidopis thaliana HSP gene HSP101 disappearance makes the Arabidopis thaliana seed responsive to temper(ing), storage endurance not in natural preservation process.

Arabidopis thaliana HSP gene HSP101 disappearance makes endogenous hormones dormin ABA reduction in the Arabidopis thaliana seed, Plant hormones regulators,gibberellins GA ₃Raise, growth hormone IAA raises, and helps sprouting.

The T-DNA of arabidopsis gene HSP101 inserts the application of mutant strain hot1 in the transgenic plant of cultivating the improved seed sprouting.

The T-DNA of arabidopsis gene HSP101 inserts the application of mutant strain hot1 in the transgenic plant of cultivating the improved seed storage.

The T-DNA of Arabidopis thaliana HSP101 inserts mutant strain hot1 and has low levels dormin ABA in cultivation, high-content Plant hormones regulators,gibberellins GA ₃With the application in the seed of growth hormone IAA.

The numbering of gene HSP101 of the present invention in GenBank is AT1G74310, the long 2736bp of the CDS of this gene, and 911 amino acid of encoding, its nucleotide sequence and aminoacid sequence are as shown in table 1.The arabidopsis mutant body hot1 that the HSP101 gene T-DNA that utilization obtains from Arabidopis thaliana Biological resources center ABRC (Arabidopsis Biological Resource Center) inserts is as research object; The seed of two mutants strain system is numbered SALK_066374; One section T-DNA that two mutants hot1 comes from the carrier pROK2 inserts in the exon of gene HSP101; Cause transgenation, the flanking sequence that inserts site is as shown in table 2.

The present invention finds the sprouting of HSP gene HSP101 function and seed and aging relevant in the model plant Arabidopis thaliana; This genetically deficient can make the Arabidopis thaliana seed have higher vigor; But it is responsive to temper(ing); Storage endurance not in natural preservation process, endogenous hormones dormin (ABA) reduces simultaneously, Plant hormones regulators,gibberellins (GA ₃) raise, growth hormone (IAA) raises, and helps sprouting.Therefore the present invention finds to operate gene HSP101 and can change the seed preservation and sprout characteristic, germ plasm resource preserve with farm crop production in good application prospects is arranged.

Description of drawings:

Fig. 1 identifies for Western Blot;

Fig. 2 is the PCR test, and Fig. 2 A is a PCR design of primers synoptic diagram; Fig. 2 B is an electrophoresis result theory expectation synoptic diagram;

Fig. 3 identifies electrophoresis result for PCR;

Fig. 4 is an Arabidopis thaliana seed germination gesture;

Fig. 5 is the weather aging of Arabidopis thaliana seed, and Fig. 5 A is Arabidopis thaliana seed weather aging 2 years; Fig. 5 B is 2 years germination rates of Arabidopis thaliana seed weather aging;

Fig. 6 is the temper(ing) of Arabidopis thaliana seed;

Fig. 7 is an Arabidopis thaliana Seed Endogenous Hormones content; Fig. 7 A is seed endogenous GA 3 content; Fig. 7 B is a seed Endogenous IAA content; Fig. 7 C is the seed endogenous aba content.

Embodiment 1:

The acquisition of mutant strain:

The numbering of Arabidopis thaliana HSP gene HSP101 according to the invention in GenBank is AT1G74310, the long 2736bp of the CDS of this gene, and nucleotide sequence is (table 1) shown in sequence table, 911 amino acid of encoding, aminoacid sequence is (table 1) shown in sequence table.The T-DNA insertion strain of having bought this gene from U.S. Arabidopis thaliana Biological resources center Arabidopsis Biological Resource Center (ABRC) is seed (SALK_066374), and the mutant strain name is called hot1, and it inserts site flanking sequence such as table 2.

CDS sequence and the aminoacid sequence of table 1HSP101

1 ATGAATCCAGAGAAATTCACACACAAGACAAACGAGACAATTGCTACAGCTCATGAGCTA

1 METAsnProGluLysPheThrHisLysThrAsnGluThrIleAlaThrAlaHisGluLeu

61?GCTGTGAATGCAGGACATGCTCAATTCACTCCTTTGCATTTAGCTGGTGCTTTGATCTCT

21?AlaValAsnAlaGlyHisAlaGlnPheThrProLeuHisLeuAlaGlyAlaLeuIleSer

121GATCCCACCGGTATATTTCCTCAAGCAATCTCTAGTGCCGGTGGCGAGAACGCAGCTCAA

41?AspProThrGlyIlePheProGlnAlaIleSerSerAlaGlyGlyGluAsnAlaAlaGln

181TCTGCTGAAAGAGTGATCAATCAAGCCTTGAAGAAGCTTCCTTCACAATCTCCTCCACCT

61?SerAlaGluArgValIleAsnGlnAlaLeuLysLysLeuProSerGlnSerProProPro

241GATGATATTCCAGCGAGTTCTAGTCTTATTAAGGTCATTCGTCGTGCTCAAGCTGCTCAG

81?AspAspIleProAlaSerSerSerLeuIleLysValIleArgArgAlaGlnAlaAlaGln

301AAGTCACGAGGTGATACTCATTTGGCTGTTGACCAGTTGATTATGGGTCTTCTTGAAGAT

101LysSerArgGlyAspThrHisLeuAlaValAspGlnLeuIleMETGlyLeuLeuGluAsp

361TCTCAAATCAGGGATTTGTTGAACGAAGTCGGTGTAGCGACGGCGAGGGTAAAGTCTGAG

121SerGlnIleArgAspLeuLeuAsnGluValGlyValAlaThrAlaArgValLysSerGlu

421?GTTGAGAAGCTTCGTGGGAAAGAAGGGAAGAAAGTTGAGAGTGCTTCAGGGGACACAAAT

141?ValGluLysLeuArgGlyLysGluGlyLysLysValGluSerAlaSerGlyAspThrAsn

481?TTTCAAGCTTTAAAGACTTATGGAAGAGATTTGGTTGAGCAAGCAGGGAAGCTTGATCCT

161?PheGlnAlaLeuLysThrTyrGlyArgAspLeuValGluGlnAlaGlyLysLeuAspPro

541?GTGATTGGTCGTGATGAGGAGATTAGAAGAGTCGTGAGGATTCTTTCGAGGAGAACGAAG

181?ValIleGlyArgAspGluGluIleArgArgValValArgIleLeuSerArgArgThrLys

601?AACAATCCTGTGCTATTGGAGAGCCAGGAGTTGGTAAAACAGCTGTGGTTGAAGGTTTA

201?AsnAsnProValLeuIleGlyGluProGlyValGlyLysThrAlaValValGluGlyLeu

661?GCACAAAGGATTGTGAAAGGAGATGTGCCCAACAGTCTTACTGATGTGAGATTAATTTCG

221?AlaGlnArgIleValLysGlyAspValProAsnSerLeuThrAspValArgLeuIleSer

721?TTGGACATGGGTGCGTTAGTTGCTGGTGCTAAATACCGAGGAGAGTTTGAAGAAAGGTTG

241?LeuAspMETGlyAlaLeuValAlaGlyAlaLysTyrArgGlyGluPheGluGluArgLeu

781?AAATCTGTTTTGAAAGAAGTTGAGGACGCTGAAGGCAAAGTGATTCTCTTTATTGATGAG

261?LysSerValLeuLysGluValGluAspAlaGluGlyLysValIleLeuPheIleAspGlu

841?ATTCATTTGGTTCTTGGTGCTGGCAAAACTGAAGGGTCGATGGATGCAGCTAATCTGTTC

281?IleHisLeuValLeuGlyAlaGlyLysThrGluGlySerMETAspAlaAlaAsnLeuPhe

901?AAGCCCATGTTAGCTAGAGGGCAGCTTCGATGCATTGGTGCTACAACGCTTGAAGAATAC

301?LysProMETLeuAlaArgGlyGlnLeuArgCysIleGlyAlaThrThrLeuGluGluTyr

961?AGGAAATATGTTGAGAAAGATGCTGCCTTTGAGAGGAGGTTCCAACAAGTCTATGTTGCG

321?ArgLysTyrValGluLysAspAlaAlaPheGluArgArgPheGlnGlnValTyrValAla

1021GAGCCAAGTGTGCCTGACACCATTAGTATCCTTAGAGGACTCAAGGAGAAGTATGAGGGA

341?GluProSerValProAspThrIleSerIleLeuArgGlyLeuLysGluLysTyrGluGly

1081CATCATGGTGTGCGAATCCAAGACAGAGCTCTTATAAATGCTGCTCAGCTGTCTGCTCGT

361?HisHisGlyValArgIleGlnAspArgAlaLeuIleAsnAlaAlaGlnLeuSerAlaArg

1141TACATAACTGGTCGGCATTTACCGGATAAAGCAATTGATTTGGTTGATGAGGCTTGTGCG

381?TyrIleThrGlyArgHisLeuProAspLysAlaIleAspLeuValAspGluAlaCysAla

1201AATGTGAGAGTCCAGCTTGATAGTCAACCTGAAGAGATTGATAACCTTGAAAGGAAGAGG

401?AsnValArgValGlnLeuAspSerGlnProGluGluIleAspAsnLeuGluArgLysArg

1261ATGCAGCTGGAAATTGAACTTCACGCCTTGGAAAGGGAGAAGGATAAAGCCAGCAAAGCT

421?METGlnLeuGluIleGluLeuHisAlaLeuGluArgGluLysAspLysAlaSerLysAla

1321CGACTTATAGAGGTGCGGAAAGAGCTTGATGACCTGAGAGACAAGCTTCAGCCTCTCACG

441?ArgLeuIleGluValArgLysGluLeuAspAspLeuArgAspLysLeuGlnProLeuThr

1381ATGAAATACAGAAAGGAGAAAGAGAGAATTGATGAGATTCGAAGGCTTAAACAGAAAAGA

461?METLysTyrArgLysGluLysGluArgIleAspGluIleArgArgLeuLysGlnLysArg

1441GAAGAGCTCATGTTTTCTTTGCAGGAGGCAGAACGAAGATATGACCTTGCAAGAGCTGCT

481?GluGluLeuMETPheSerLeuGlnGluAlaGluArgArgTyrAspLeuAlaArgAlaAla

1501GATCTAAGATATGGCGCAATTCAAGAAGTGGAATCTGCAATTGCCCAACTTGAAGGAACT

501?AspLeuArgTyrGlyAlaIleGlnGluValGluSerAlaIleAlaGlnLeuGluGlyThr

1561TCTTCTGAAGAGAATGTGATGCTCACAGAAAACGTTGGGCCTGAACACATTGCTGAGGTT

521?SerSerGluGluAsnValMETLeuThrGluAsnValGlyProGluHisIleAlaGluVal

1621GTGAGCCGTTGGACAGGGATTCCAGTGACGAGACTTGGCCAAAATGAGAAGGAGAGGTTG

541?ValSerArgTrpThrGlyIleProValThrArgLeuGlyGlnAsnGluLysGluArgLeu

1681ATTGGTCTTGCTGATAGGTTGCATAAGCGGGTTGTGGGACAGAATCAAGCGGTAAATGCA

561?IleGlyLeuAlaAspArgLeuHisLysArgValValGlyGlnAsnGlnAlaValAsnAla

1741GTTTCTGAGGCAATTCTAAGGTCAAGGGCAGGACTTGGAAGGCCACAACAGCCAACTGGA

581?ValSerGluAlaIleLeuArgSerArgAlaGlyLeuGlyArgProGlnGlnProThrGly

1801TCATTCTTATTCCTTGGACCAACTGGTGTTGGCAAAACTGAGCTCGCCAAGGCTCTTGCT

601?SerPheLeuPheLeuGlyProThrGlyValGlyLysThrGluLeuAlaLysAlaLeuAla

1861GAGCAGCTGTTTGATGATGAAAACCTCTTAGTTCGGATTGATATGTCGGAATATATGGAA

621?GluGlnLeuPheAspAspGluAsnLeuLeuValArgIleAspMETSerGluTyrMETGlu

1921CAACACTCTGTCTCTCGCCTCATTGGGGCACCACCAGGGTATGTTGGTCACGAGGAAGGT

641?GlnHisSerValSerArgLeuIleGlyAlaProProGlyTyrValGlyHisGluGluGly

1981GGACAACTAACTGAGGCTGTGAGGAGGCGACCTTATTGTGTCATACTCTTTGATGAAGTG

661?GlyGlnLeuThrGluAlaValArgArgArgProTyrCysValIleLeuPheAspGluVal

2041GAGAAGGCTCATGTTGCTGTCTTCAACACTCTGCTCCAAGTTTTGGATGATGGTCGATTG

681?GluLysAlaHisValAlaValPheAsnThrLeuLeuGlnValLeuAspAspGlyArgLeu

2101ACAGACGGGCAAGGCAGGACAGTCGATTTCAGGAACTCGGTGATAATCATGACATCAAAC

701?ThrAspGlyGlnGlyArgThrValAspPheArgAsnSerValIleIleMETThrSerAsn

2161CTTGGTGCTGAACACCTCCTTGCAGGGCTAACTGGGAAAGTAACAATGGAAGTGGCCCGG

721?LeuGlyAlaGluHisLeuLeuAlaGlyLeuThrGlyLysValThrMETGluValAlaArg

2221GACTGTGTGATGCGGGAGGTGAGGAAACACTTCAGACCAGAGCTCTTGAACAGGCTTGAC

741?AspCysValMETArgGluValArgLysHisPheArgProGluLeuLeuAsnArgLeuAsp

2281GAGATTGTGGTGTTCGACCCCCTTTCACATGACCAGTTGAGGAAAGTAGCTCGGCTTCAA

761?GluIleValValPheAspProLeuSerHisAspGlnLeuArgLysValAlaArgLeuGln

2341ATGAAAGACGTTGCTGTCCGGCTTGCTGAAAGAGGAGTTGCTTTGGCAGTCACTGATGCT

781?METLysAspValAlaValArgLeuAlaGluArgGlyValAlaLeuAlaValThrAspAla

2401GCTTTGGACTATATCTTGGCAGAGAGTTATGACCCGGTGTATGGTGCTAGGCCTATAAGG

801?AlaLeuAspTyrIleLeuAlaGluSerTyrAspProValTyrGlyAlaArgProIleArg

2461AGATGGATGGAGAAGAAGGTGGTGACAGAACTGTCAAAGATGGTTGTGCGTGAGGAAATC

821?ArgTrpMETGluLysLysValValThrGluLeuSerLysMETValValArgGluGluIle

2521GATGAAAACTCCACTGTTTACATAGATGCAGGCGCTGGTGATCTTGTGTACCGGGTAGAA

841?AspGluAsnSerThrValTyrIleAspAlaGlyAlaGlyAspLeuValTyrArgValGlu

2581AGTGGAGGTCTAGTGGACGCTTCAACAGGCAAGAAGTCAGATGTGCTGATTCATATTGCT

861?SerGlyGlyLeuValAspAlaSerThrGlyLysLysSerAspValLeuIleHisIleAla

2641AACGGGCCAAAGAGAAGTGATGCAGCTCAGGCGGTGAAGAAGATGAGGATCGAGGAAATA

881?AsnGlyProLysArgSerAspAlaAlaGlnAlaValLysLysMETArgIleGluGluIle

2701GAAGATGACGATAATGAGGAAATGATCGAGGATTAA

901?GluAspAspAspAsnGluGluMETIleGluAsp＊＊＊

Table 2 insertion site flanking sequence

1ATCTC?TGATC?CCACC?GGTAT?ATTTC?CTCAA?GCAAT?CTCTA?GTGCC?GGTGG

51CGAGA?ACGCA?GCTCA?ATCTG?CTGAA?AGAGT?GATCA?ATCAA?GCCTT?GAAGA

101AGCT (Length：104)

Embodiment 2:

The check of mutant strain and homozygote are identified:

Western Blot identifies: wild-type Col and two mutants hot1 seed extract total protein, detect the expression of albumen HSP101 with Western Blot.The result is as shown in Figure 1, and positive findings appears in hsp101 gene normal expression in the wild type seeds, can detect HSP101 albumen; And negative findings appears in two mutants hot1, can not detect HSP101 albumen, explains that this gene has been knocked out really among the two mutants hot1, can not express.

PCR identifies that it is that genotypic evaluation needs three primers that homozygote: T-DNA inserts strain, is respectively: LP (5 '-AAT AAT GCG GCA AAA GAG GAG-3 ') is positioned at T-DNA insertion left arm end place, site on the genome; RP (5 '-CTG CTT GCT CAA AAT CTC-3 ') is positioned at T-DNA and inserts right arm end place, site; Primer BP:LBb3 on the T-DNA left arm end: (5 '-ATTTTGCCGATTTCGGAAC-3) .PCR design of primers is as shown in Figure 2 with reference to SIGNA (http://signa1.salk.edu/tdnaprimers.2.htm1) related data .PCR principle.

Milling and extracting wild-type Col and two mutants hot1 blade genomic dna carry out PCR as template.As shown in Figure 3, when this carries out pcr amplification and carry out electrophoresis primer with LP and RP, in wild-type plant Col, produce a PCR product band, molecular weight approximately is 1100bp, and does not have the PCR product to form in the two mutants hot1 plant; When this increases to primer PCR with RP and LBb3, in the wild-type plant, do not have the PCR product, and a PCR product band is arranged in two mutants hot1 plant.Therefore identify that two mutants hot1 plant is homozygote homozygote (HM).

Embodiment 3:

Have higher vigor in the Arabidopis thaliana behind the hsp101 gene knockout:

Wild-type Col and two mutants hot1 seed place 25 ℃ of illumination of petridish to sprout; Undertaken by standard germination test method, four repetitions are established in each processing, and are isometric with radicle length and seed; It is the germination standard that radicel length reaches seed one half, 6 days calculating germination rates.As shown in Figure 4, wild-type Col seed is lower than two mutants hot1 at 24h, 48h germination rate, and two mutants hot1 seed has higher vigor.

Embodiment 4:

Naturally the vigor forfeiture is faster in storing after the hsp101 gene is knocked out in the Arabidopis thaliana:

Seed is under the condition that preserve in storage or germplasm storehouse naturally, and its germinating power can be lost gradually, and weather aging takes place.This experiment is got the wild-type Col that receives in August, 2009 and two mutants hot1 seed storage at room temperature, gets the seed of storing 2 years in September, 2011 and sprouts the detection vigor of testing.Place 25 ℃ of illumination of petridish to germinate, preserve moisture with filter paper in the petridish.Carry out 15 days statistics germination rates by standard germination test method.As shown in Figure 5; Through the weather aging wild-type Col in 2 years and two mutants hot1 seed germination rate decline is in various degree arranged all; Wild-type Col germination rate can also reach 85%; And two mutants hot1 seed germination rate has dropped to 60%, and to be knocked out in the weather aging process of back the vigor forfeiture faster for the hsp101 gene in the Arabidopis thaliana, more not anti-storage.

Embodiment 5:

It is responsive more in the temper(ing) process that the hsp101 gene is knocked out the back in the Arabidopis thaliana:

It is 45 ℃ that wild-type Col and two mutants hot1 seed are placed on temperature, in the environment of relative humidity 100%, and treatment time 0h, 12h, 24h, 48h, 72h.The taking-up seed that disposes places 25 ℃ of illumination of petridish of preserving moisture with filter paper to germinate.Carry out 15 days statistics germination rates by standard germination test method.As shown in Figure 6, along with the prolongation of hot and humid ageing treatment time, wild-type Col and two mutants hot1 seed are all on a declining curve; Two mutants hot1 seed is responsive more, and vigor descends sooner, and burin-in process 24h begins, and germinating energy descends rapidly along with the prolongation of digestion time.Germination rate is almost 0% during 48h.

Embodiment 6:

Endogenous hormones detects in wild-type Col and the two mutants hot1 seed:

One, the extraction of sample:

Take by weighing the methyl alcohol of 0.2g wild-type Col and two mutants hot1 seed adding 2ml sample extracting solution 80%; In ice bath, grind to form homogenate, change the 10ml test tube over to, with the gradation of 2ml extracting solution mortar is rinsed well again; Change in the lump in the test tube, be placed on after shaking up in 4 ℃ of refrigerators.4 ℃ are extracted 4h, and the centrifugal 8min of 3500 commentaries on classics/min gets supernatant.Add the 1ml extracting solution in the deposition, stir, put and extract 1h under 4 ℃ again, centrifugal, merge supernatant and recording volume, residue is claimed dry weight.Supernatant is changed in the 15ml glass centrifuge tube, dry up, remove the methyl alcohol in the extracting solution, use the sample liquid constant volume with nitrogen.

Two, sample determination (enzyme-linked immunoassay ELISA)

(1) encapsulates: encapsulate a certain amount of envelope antigen mixing of adding in the damping fluid at 10ml, in each hole of enzyme plate, add 100uL.Then enzyme plate is bandaged with preservative film, in 37 ℃ of following 3h.

(2) wash plate: the plate place to go that will encapsulate is placed on balance under the room temperature.Get rid of coating buffer then.Add washings, place 0.5min and get rid of washings again.Repeat 3 this.

(3) competition: add standard substance, treat test sample and antibody, 37 ℃ of left and right sides 0.5h.

(4) wash plate: reaction solution is dried, add washings and wash plate four times.

(5) adding two resists: put 37 ℃ of incubation 0.5h.

(6) wash plate: reaction solution is dried, add washings and wash plate four times.

(7) add substrate colour developing liquid: take by weighing 10-20mg O-Phenylene Diamine (OPD) and be dissolved in the 10ml substrate buffer solution, the dissolving back adds the 2-4ul30% ydrogen peroxide 50 fully.Mixing adds 100ul in every hole, put into wet box then, and after colour developing suitably, every hole adds 50ul 2mol/L sulfuric acid termination reaction.

(8) colorimetric: the OD value at each concentration of sequentially determining standard substance and each sample 490nm place on the enzyme linked immunological spectrophotometer.

Calculation result relatively, and is as shown in Figure 7, and the hsp101 gene is knocked out Plant hormones regulators,gibberellins (GA in the seed of back in the Arabidopis thaliana ₃) and the rising of growth hormone (IAA) content, and dormin (ABA) content reduces, and helps sprouting.

Claims

1. the application of Arabidopis thaliana HSP gene HSP101 in seed germination.

2. the application of Arabidopis thaliana HSP gene HSP101 in seed storage.

3. Arabidopis thaliana HSP gene HSP101 has low levels dormin ABA in cultivation, high-content Plant hormones regulators,gibberellins GA ₃With the application in the seed of growth hormone IAA.

4. according to the application of claim 1, it is characterized in that Arabidopis thaliana HSP gene HSP101 disappearance makes the Arabidopis thaliana seed have higher vigor.

5. according to the application of claim 2, it is characterized in that Arabidopis thaliana HSP gene HSP101 disappearance makes the Arabidopis thaliana seed responsive to temper(ing), storage endurance not in natural preservation process.

6. according to the application of claim 3, it is characterized in that Arabidopis thaliana HSP gene HSP101 disappearance makes endogenous hormones dormin ABA reduction in the Arabidopis thaliana seed, Plant hormones regulators,gibberellins GA ₃Raise, growth hormone IAA raises, and helps sprouting.

7. the T-DNA of arabidopsis gene HSP101 inserts the application of mutant strain hot1 in the transgenic plant of cultivating the improved seed sprouting.

8. the T-DNA of arabidopsis gene HSP101 inserts the application of mutant strain hot1 in the transgenic plant of cultivating the improved seed storage.

9. the T-DNA of Arabidopis thaliana HSP101 insertion mutant strain hot1 has low levels dormin ABA in cultivation, high-content Plant hormones regulators,gibberellins GA ₃With the application in the seed of growth hormone IAA.