CN102643343A - Human derived anti-rabies virus glycoprotein gene engineering antibody and preparation and application thereof - Google Patents

Human derived anti-rabies virus glycoprotein gene engineering antibody and preparation and application thereof Download PDF

Info

Publication number
CN102643343A
CN102643343A CN2011100408981A CN201110040898A CN102643343A CN 102643343 A CN102643343 A CN 102643343A CN 2011100408981 A CN2011100408981 A CN 2011100408981A CN 201110040898 A CN201110040898 A CN 201110040898A CN 102643343 A CN102643343 A CN 102643343A
Authority
CN
China
Prior art keywords
sequence
seq
antibody
chain antibody
nucleic acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN2011100408981A
Other languages
Chinese (zh)
Other versions
CN102643343B (en
Inventor
孔维
吴永革
谷铁军
姜春来
段冶
张华飞
侯宏嘉
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
CHANGCHUN BCHT BIOTECHNOLOGY Co Ltd
Original Assignee
CHANGCHUN BCHT BIOTECHNOLOGY Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by CHANGCHUN BCHT BIOTECHNOLOGY Co Ltd filed Critical CHANGCHUN BCHT BIOTECHNOLOGY Co Ltd
Priority to CN201110040898.1A priority Critical patent/CN102643343B/en
Publication of CN102643343A publication Critical patent/CN102643343A/en
Application granted granted Critical
Publication of CN102643343B publication Critical patent/CN102643343B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Landscapes

  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention relates to a human derived anti-rabies virus glycoprotein gene engineering antibody and preparation and application thereof, the antibody has a heavy chain variable region sequence as shown in the SEQ ID NO:1 or a variant sequence thereof, a light chain variable region sequence shown in the SEQ ID NO:2 or a variant sequence thereof, and a connecting peptide sequence. The invention also relates to a method for preparing the antibody and purpose thereof for detecting rabies viruses or treating or preventing disease caused by rabies virus infection.

Description

A kind of human source anti-rabies virus glycoprotein gene engineered antibody and preparation thereof and application
Technical field
The present invention relates to a kind of antibody of rabies poison, relate in particular to a kind of human source anti-rabies virus glycoprotein gene engineered antibody and preparation thereof and application.
Background technology
Rabies are the highest transmissible diseases of mortality ratio, and case fatality rate is 100%.Rabies worldwide extensively distribute, and there is that the people dies from rabies more than 60,000 an every year in the whole world.China also belongs to rabies country occurred frequently.At present, the rubies epidemiology peak just forms in China again.Rabic control has become one of most important public health problem of China.
The major measure of rabies control is the prevention after the rabies exposure.For serious resurrectionist, World Health Organization suggestion uses simultaneously that vaccine and anti-rabies antibody carry out initiatively and the combination therapy of passive immunization can reduce viral infection effectively.For the children of immunity system developmental immaturity, reach the crowd that hypoimmunity can not in time produce antibody, must use antibody to prevent and treat after the exposure.
At present existing effective vaccine or antibody come prophylactic propagation, for example use immune serum or Tegeline or monoclonal antibody.For antilyssic or antibody, its application receives the restriction of following factors: because the source of rabies virus people immune serum is very limited, horse immune serum commonly used clinically carries out the treatment after rabies virus exposes.The greatest problem of horse serum treatment is to cause patient's severe anaphylactic reaction.The rabies in people source poison Tegeline also can be used for exposing the back treatment, but it costs an arm and a leg, and because it utilizes the human serum preparation of extracting, possibly polluted by known or unknown human cause of disease, have potential safety hazard.And for human monoclonal antibody, though it shows advantage on using, the limitation of eukaryotic system fermentation technique then becomes one of main bottleneck of its preparation.
The more genetic engineering antibody of report has scFv (single chainFv), scFv-Fc and Fab etc. in the antibody exploitation at present.Wherein, ScFv-Fc and Fab contain a plurality of glycosylation sites because molecule is relatively large, are difficult to accomplish the maturation of antibody in the prokaryotic system; Usually require in eukaryotic system, to express preparation, but the limitation of eukaryotic cell fermentation technique makes it to be difficult to form large-scale production at present.Though scFv has made certain contribution in the diagnosis of multiple disease, but greatly limited its application in clinical treatment owing to its space structure instability.
Because also be not specially adapted to the genetic engineering antibody of rabic treatment and prevention at present, the application of many anti-rabies antibodies still receives the limitation of many factors, therefore need a kind of new potent antibodies of exploitation badly to the rabies poison.
The present invention proposes a kind of new human genetically engineered antibody to rabies virus glycoprotein (G), its can play significant in the effect of rabies virus, thereby be used for rabic detection, prevention and treatment.
Summary of the invention
The invention provides in a kind of ability genetic engineering antibody with rabies virus.
First aspect; The invention provides a kind of human source anti-rabies virus gp single-chain antibody; It has weight chain variabl area sequence (a) or its variant sequence shown in SEQ ID NO:1; Light chain variable region sequence (b) shown in SEQID NO:2 or its variant sequence, and a connection peptides sequence, wherein said variant sequence is for having the sequence of one or more radical amino acid replacements, disappearance, interpolation and/or modification in said sequence (a) or (b).
Second aspect the invention provides the nucleic acid that a kind of code book is invented single-chain antibody.In addition, the present invention also provides carrier and the host cell that comprises nucleic acid of the present invention.
The third aspect the invention provides a kind of compsn, said compsn comprise single-chain antibody of the present invention, code book invention single-chain antibody nucleic acid, contain the carrier of said nucleic acid or contain the host cell of said nucleic acid.
Fourth aspect, the present invention also provides a kind of method for preparing single-chain antibody of the present invention.Single-chain antibody of the present invention can prepare through for example engineered method.In one embodiment, method of the present invention comprises: the goal gene that code book invention single-chain antibody is provided; This goal gene is built up in the expression vector; In the host, express this goal gene; And the results expression product, thereby obtain said single-chain antibody.
The 5th aspect; The nucleic acid, the carrier that contains nucleic acid of the present invention or the host cell that the invention provides single-chain antibody of the present invention (particularly antibody Fv57), code book invention antibody prevent or treat rabic medicine in preparation, perhaps the application in preparation rabies virus detection kit.
Description of drawings
Fig. 1 shows the synoptic diagram that utilizes the synthetic Fv57 antibody gene of SOE-PCR method.
Fig. 2 shows the agarose gel electrophoretogram of SOE-PCR product, and wherein swimming lane 1-5 is respectively F1-F5, and swimming lane 8-12 is respectively S1-S5, and swimming lane 6 is the PCR product of Fv57 antibody gene, and swimming lane 7 is dna molecular amount standard DL2000.
Fig. 3 shows the EcoR I enzyme of recombinant plasmid pBV-Fv57 and cuts the evaluation collection of illustrative plates, and wherein swimming lane 1-4 is that enzyme is cut product, and swimming lane 5 and 6 is respectively dna molecular amount standard: DNA marker1KB and DNA marker DL2000.
Fig. 4 shows the electrophoresis of expressing protein behind recombinant plasmid pBV-Fv57 transformed into escherichia coli (Escherichia coli) BL21 (DE3) cell and identifies collection of illustrative plates.Among the left figure, swimming lane 1 is a protokaryon molecular weight of albumen standard, and swimming lane 2,4,6 is a whole cell albumen before the abduction delivering, and swimming lane 3,5,7 is a whole cell albumen behind the abduction delivering.Among the right figure, swimming lane 1 is a protokaryon molecular weight of albumen standard, and swimming lane 2 is a sample before the column purification; Swimming lane 3 is worn sample for last appearance stream; Swimming lane 4 is a 0mM imidazoles elution samples, and swimming lane 5 and 6 is respectively 300mM imidazoles elution samples (1) and (2), and swimming lane 7 is a 500mM imidazoles elution samples.
Fig. 5 shows Fv57 antibody and combines active detected result with antigen-specific.
Fig. 6 shows the relative affinity of Fv57 antibody and measures the result.
Fig. 7 shows the relative stability result of study of Fv57 antibody.
Fig. 8 A and 8B show Fv57 antibody in the determination of activity result.
The sequence explanation
SEQ ID NO:1 is the weight chain variable region amino acid sequence of single-chain antibody Fv57.
SEQ ID NO:2 is the light chain variable region amino acid sequence of single-chain antibody Fv57.
SEQ ID NO:3 is the aminoacid sequence of single-chain antibody Fv57.
SEQ ID NO:4 is the variable region of heavy chain nucleotide sequence of a coding single-chain antibody Fv57.
SEQ ID NO:5 is the variable region of light chain nucleotide sequence of a coding single-chain antibody Fv57.
SEQ ID NO:6 is the nucleotide sequence of a coding single-chain antibody Fv57.
SEQ ID NO:7 is the aminoacid sequence of connection peptides part among the single-chain antibody Fv57.
SEQ ID NO:8 is the nucleotide sequence of connection peptides part among the single-chain antibody Fv57.
SEQ ID NO:9-13 is the sequence of Oligonucleolide primers FF1-5.
SEQ ID NO:14-18 is the sequence of Oligonucleolide primers SF1-5.
SEQ ID NO:19-23 is the sequence of Oligonucleolide primers FR1-5.
SEQ ID NO:24-28 is the sequence of Oligonucleolide primers SR1-5.
SEQ ID NO:29 is the aminoacid sequence of single-chain antibody dsFv57.
SEQ ID NO:30 is the nucleotide sequence of a coding single-chain antibody dsFv57.
Embodiment
Hereinafter will be described further the present invention.Should be understood that these specifically described embodiments should not constitute limitation of the scope of the invention.
Human source anti-rabies virus gp single-chain antibody of the present invention has variable region of heavy chain as indicated above part, variable region of light chain part and connects this two-part connection peptides (VH-connection peptides-VL).In one embodiment; Human source anti-rabies virus gp single-chain antibody is made up of variable region of heavy chain part of the present invention, variable region of light chain part and connection peptides; Wherein said variable region of heavy chain partly is connected in the N-end or the C-end of said connection peptides, and the variable region of light chain part correspondingly is connected in the other end of said connection peptides.Preferably, said variable region of heavy chain partly is connected in the N-end of said connection peptides.
In an embodiment of single-chain antibody of the present invention, the aminoacid sequence of said variable region of heavy chain and variable region of light chain is respectively shown in SEQ ID NO:1 and SEQ ID NO:2.This heavy chain and variable region of light chain sequence obtain (referring to Cheung based on the aminoacid sequence of humanization anti-rabies monoclonal antibodies MAB57; Et al.; A recombinant human Fab expressed inEscherichia coli neutralizes rabies virus.J.Virol.1992,66 (11): 6714-6720).
In another embodiment of single-chain antibody of the present invention; The aminoacid sequence of said variable region of heavy chain and/or variable region of light chain can be the variant sequence of aminoacid sequence shown in SEQ ID NO:1 and/or the SEQ ID NO:2, and said variant sequence comprises displacement, disappearance, interpolation and/or the modification of one or more amino-acid residues.During the single-chain antibody of the present invention that comprises above-mentioned variant sequence remains with the ability of rabies virus.
Many ordinary methods that the characteristic of the ability of rabies virus " in " of antibody described herein or " in the ability and rabies virus " can be known are by one of skill in the art confirmed.For example can carry out cell in vitro through rapid fluorescence kitchen range inhibition test (RFFIT method) measures; The antibody that in this test, shows the ability that stops the virus infection bsr cell promptly think have in the ability of rabies virus; Perhaps carry out the mouse in vivo tests through neutralisation (MNT method) in the mouse brain, in this test, show antibody that the protection mouse avoids infecting the ability of fatal rabies virus promptly think have in and the ability of rabies virus.
This one side that in single-chain antibody of the present invention, comprises said variant sequence; In a specific embodiments; Said radical amino acid replacement, disappearance, interpolation and/or modification can make between the inner amino-acid residue of antibody molecule of the present invention and produce extra covalently or non-covalently effect; For example between amino-acid residue, produce the disulfide linkage effect; For example, displacement, the disappearance through amino-acid residue, add and/or be modified among SEQ ID NO:1 and/or the SEQ ID NO:2 and introduce the Cys residue suitably.Because the existence of Cys residue can produce intramolecular disulfide bond, thereby make the stability of small molecular antibody be able to strengthen.Those skilled in the art can understand the zone of suitable introducing disulfide linkage in the antibody sequence.For example; Can make the amino acid sites of disulfide linkage to be formed in the antibody variable region be positioned at the conservative framework region of structure; Make it away from complementary determining region (CDR), form disulfide linkage thus and not only can not disturb this antibody to combine, also increased antibody stability simultaneously with antigenic.Especially; On the methodology of antibody construction, can form disulfide linkage between the 100th amino acids residue (H44-L100) of the 44th amino acids residue of heavy chain of antibody and light chain or between the 43rd amino acids residue (H105-L43) of the 105th amino acids residue of heavy chain and light chain; But for concrete aminoacid sequence, above-mentioned site is deviation to some extent, and its accurate position can be through comparing definite with the conserved sequence of antibody DB corresponding position.
In a concrete embodiment, the aminoacid sequence of antibody of the present invention comprises the radical amino acid replacement of Gly102Cys among Gly39Cys among the SEQ IDNO:1 and the SEQ ID NO:2.Thereby in one embodiment, antibody of the present invention is included in the one or more disulfide linkage that form between amino-acid residue.
In another embodiment, said antibody molecule comprises the detection or the purification tag of an interpolation, and the purification tag of six Histidines for example is so that the antibody molecule that comprises this label of gained purifying better.In a concrete embodiment, the invention provides a kind of terminal in sequence shown in SEQ IDNO:3 or the SEQ ID NO:29---for example N-terminal or C-terminal---be added with the antibody molecule of the label of six Histidines.In another embodiment, the one or more amino-acid residues in the antibody of the present invention are modified by another kind of outside agent, for example modify through polyoxyethylene glycol (PEG), form the antibody molecule of PEGization.PEG is attached on the amino-acid residue in the antibody molecular weight that can increase antibody, thereby improves stability of molecule, has also prolonged antibody molecule action time in vivo, helps to improve the ability of its virus that neutralizes in vivo.
Connection peptides in the single-chain antibody of the present invention is generally the sequence of length at least 12 amino-acid residues, and the connection peptides sequence that is present in this antibody can not reduce variable region of heavy chain and variable region of light chain activity partly in this antibody.In one embodiment of the invention, the aminoacid sequence of said connection peptides is (Gly 4Ser) n, wherein n is suitable integer, and preferably, n is the integer that is selected from 3-5, and particularly preferably, n is 4.Said connection peptides also can be other aminoacid sequences, and as an instance, the aminoacid sequence of said connection peptides is AKTTAPSVYPLA.Equally, for the aminoacid sequence of above-mentioned connection peptides, the transformation that can replace, lack, add and/or modify one or more amino-acid residue, improved aminoacid sequence still can be used as connection peptides and is used for single-chain antibody of the present invention.On this meaning, (Gly for example 4Ser) 3Or (Gly 4Ser) 5Can think (Gly 4Ser) 4The connection peptides sequence that after the amino-acid residue transformation, obtains.
In a particularly preferred embodiment of single-chain antibody of the present invention; Said single-chain antibody is the antibody Fv57 with aminoacid sequence shown in SEQ ID NO:3, and its N-holds the sequence set of holding to C-to become SEQ ID NO:1, SEQ ID NO:7 and SEQ ID NO:2.In another embodiment, the aminoacid sequence of said single-chain antibody is the antibody Fv57 variant sequence of the displacement, disappearance, interpolation and/or the modification that comprise one or more amino-acid residues.In this preferred embodiment on the one hand; Said single-chain antibody is the dsFv57 with the aminoacid sequence shown in SEQ ID NO:29; In this embodiment, said antibody comprises the radical amino acid replacement of Gly102Cys among radical amino acid replacement and the SEQ ID NO:2 of Gly39Cys among the SEQ ID NO:1.
The invention provides a kind of nucleic acid of code book invention single-chain antibody.In one embodiment; Said nucleic acid has weight chain variable region nucleotide sequence (i) or its variant sequence shown in SEQ ID NO:4; Light chain variable region nucleotide sequence shown in SEQ ID NO:5 (ii) or its variant sequence; And the nucleotide sequence of coding connection peptides, wherein, said sequence (i) or variant sequence (ii) be said sequence (i) or (ii) in have the sequence of one or more nucleotide subsitutions, disappearance or interpolation.In the embodiment of a nucleic acid of the present invention, said nucleic acid has the weight chain variable region nucleotide sequence (i) shown in the SEQ ID NO:4, the light chain variable region nucleotide sequence shown in SEQ ID NO:5 (ii), and the coding connection peptides nucleotide sequence.In another embodiment of the invention; The nucleic acid of said code book invention single-chain antibody has said sequence (i) and/or variant sequence (ii), and said variant sequence is for having the sequence of displacement, disappearance or the interpolation of one or more Nucleotide at said (i) or (ii).
In a preferred embodiment, said nucleic acid has the nucleotide sequence shown in the SEQ ID NO:6, its 5 ' to 3 ' Nucleotide consist of SEQ ID NO:4, SEQ ID NO:8 and SEQ ID NO:5.In this embodiment, the aminoacid sequence of said nucleic acid encoding antibody Fv57 of the present invention.In another preferred embodiment, said nucleic acid encoding antibody dsFv57 of the present invention.
Nucleic acid of the present invention can be introduced in the carrier and/or import the host cell be used for expressing then so that nucleic acid of the present invention is cloned or expressed.Thus, the invention provides carrier or the host cell that comprises nucleic acid of the present invention.Said carrier can be plasmid vector or virus vector, the genetically modified carrier of animal or universal support.Preferably, said carrier is the plasmid vector that comprises nucleic acid of the present invention.In a concrete preferred embodiment, said carrier is the pBV220 that comprises the nucleotide sequence of SEQ ID NO:6.Said host cell can be the cell of bacterium, yeast, animal or plant, and preferred host cell is a Bacillus coli cells.In a concrete preferred embodiment, said host cell is the Bacillus coli cells that comprises SEQ ID NO:6.
Expression of nucleic acids of the present invention can occur in and be used for the host that target protein is produced, and perhaps occurs among the experimenter (for example people) that need carry out rabies prophylaxis or treatment.
The present invention also provides a kind of and has comprised single-chain antibody of the present invention, nucleic acid, or contained the carrier of this nucleic acid or the compsn of host cell.Can further contain suitable reagent carrier in the said compsn.For example, compsn of the present invention can comprise pharmaceutically acceptable carrier, and to be used for that the experimenter is carried out vivo medicine-feeding, perhaps said compsn can comprise the detection that suitable carriers is used for external rabies virus.Those skilled in the art know these carriers, and how to know suitable carriers and single-chain antibody of the present invention be mixed with together and be used to the compsn that detects, prevent or treat.
Be used for the experimenter is carried out the compsn of the present invention of vivo medicine-feeding, those skilled in the art can select suitable route of administration such as drug administration by injection, for example can carry out administration through vein, subcutaneous, intracutaneous and intramuscular injection.
The invention also discloses a kind of method for preparing single-chain antibody of the present invention through genetic engineering means.Specifically, this preparation method comprises: the goal gene that code book invention single-chain antibody is provided; Goal gene is built up in the carrier; In the host, express this goal gene; And the results expression product, thereby obtain said single-chain antibody.
In another embodiment, method of the present invention also comprises the step of separation and purification antibody of the present invention.The step of said separation and purification can further comprise: with the host cell cracking and collect split product; With split product purifying (for example through chromatography or additive method well known by persons skilled in the art) under the sex change condition; With the purified product renaturation, thereby obtain antibody of the present invention.For improving purification efficiency, can on the object of the invention gene, connect purification tag, for example terminal in gene order, for example 5 ' or 3 ' end, add 6 Histidine (encoding sequence labels of 6 * His).
In purification procedures of the present invention, can use chromatography to carry out, for example affinity chromatography, ion exchange chromatography, hydrophobic chromatography, molecular sieve chromatography etc. are to carry out purifying to target protein.Those skilled in the art also can use other conventional meanses to carry out protein purification in its ken.
In a preferred embodiment, use chromatographic column to purification tag 6 * His (for example Ni-NTA chromatographic column, elutriant is for example for containing the elutriant of imidazoles) to carry out the affinity purification of target protein.
In said renaturation step, can use protein renaturation liquid that the target protein of purifying is carried out protein renaturation, preferably use more than a kind of protein renaturation liquid and carry out renaturation respectively.In one embodiment, employed renaturation solution in the antibody renaturation of the present invention is comprised two kinds of different renaturation solutions, preferably, a kind of glycocoll that contains, and another kind does not contain glycocoll.In a specific embodiments, said single-chain antibody is the Fv57 that Fv57 or N-terminal or C-terminal are added with six Histidines, and said renaturation solution comprises first renaturation solution that contains glycocoll and second renaturation solution that does not contain glycocoll.Said first and second renaturation solutions also can comprise the component that other can be used for protein renaturation liquid, for example Tris-HCl, glycerine and EDTA etc.In a preferred embodiment; Said single-chain antibody is the Fv57 that Fv57 or N-terminal or C-terminal are added with six Histidines; In said renaturation step, use first renaturation solution that comprises glycocoll earlier; Re-use second renaturation solution that does not contain glycocoll, wherein said first and second renaturation solutions also contain Tris-HCl, glycerine and EDTA.In another embodiment, the renaturation solution of antibody of the present invention comprises more than two kinds of renaturation solutions, for example three kinds of renaturation solutions.For example; Be included at antibody of the present invention under the situation of the disulfide linkage that forms between amino-acid residue; For example said antibody is the dsFv57 that dsFv57 or N-terminal or C-terminal are added with six Histidines; Use three kinds of renaturation solutions in the said renaturation step, for example can use above-mentioned second renaturation solution that contains first renaturation solution of glycocoll and do not contain glycocoll, also use the 3rd renaturation solution that contains GSH (reduced glutathion), GSSG (Sleep-promoting factor B).The 3rd renaturation solution preferably used before using said first and second renaturation solutions.Said first, second also can comprise the component that other can be used for protein renaturation liquid with the 3rd renaturation solution, for example Tris-HCl, glycerine and EDTA etc.In a specific embodiments; Said single-chain antibody is the dsFv57 that dsFv57 or N-terminal or C-terminal are added with six Histidines; Use the 3rd renaturation solution that comprises glycocoll, GSH, GSSG in the said renaturation step earlier; Re-use first renaturation solution that comprises glycocoll but do not contain GSH, GSSG, use the 3rd renaturation solution that contains glycocoll, GSH, GSSG at last, wherein said first, second also contains Tris-HCl, glycerine and EDTA with the 3rd renaturation solution.
In preparing the method for single-chain antibody of the present invention; Can carry out codon optimized to the aminoacid sequence of coding single-chain antibody of the present invention; Thereby obtain the goal gene of antibody of the present invention, said goal gene promptly has the nucleotide sequence of above-mentioned nucleic acid molecule of the present invention.In one embodiment; The sequence of said goal gene is made up of the nucleotide coding sequence of nucleotide sequence shown in SEQ ID NO:4 and the SEQ ID NO:5 or its variant sequence and connection peptides, and said variant sequence is the sequence with one or more nucleotide subsitutions, disappearance or interpolation.In a preferred embodiment, the sequence of said goal gene is connected with the sequence of the nucleotide sequence of coding hexahistidine tag shown in SEQ ID NO:6 or SEQ ID NO:30 or for their 5 ' or 3 ' end.
In a preparing method's of the present invention preferred embodiment, the codon of use prokaryotic organism preference carries out said codon optimized, more preferably uses the codon of intestinal bacteria preference.
In an embodiment of the inventive method, said goal gene can or utilize the PCR synthesis method such as the acquisition of overlapping extension PCR (SOE-PCR) method through chemical synthesis process.
When utilizing the SOE-PCR method to synthesize goal gene, goal gene can be divided into a plurality of fragments, carries out many wheel amplifications (for example, taking turns amplification smaller or equal to 5), and the fragment product of amplification is spliced.The fragment length that is used to splice is preferably 300-400bp.In one embodiment, the object of the invention gene preferably is divided into 2 fragments and increases, and carries out 1 splicing.
In an embodiment of the inventive method, but said expression vector plasmid vector or virus vector, the genetically modified carrier of animal or universal support.Preferably, use plasmid vector, for example temperature-induced type prokaryotic expression carrier pBV220 or other prokaryotic expression carriers such as IPTG inductive pET serial carrier.
The host who is used to express goal gene in the inventive method comprises the cell of animal or plant, bacterium or yeast; They also can be genetically modified hosts.In a preferred embodiment of the invention, said method is used prokaryotic cell prokaryocyte host expresses goal gene, and more preferably, the host who expresses is intestinal bacteria.
Can use the nucleic acid of the above-mentioned single-chain antibody of this paper, this antibody of encoding, the carrier that contains this nucleic acid or host cell to detect rabies virus according to the present invention; Perhaps prevent or the treatment rabies; Therefore they can be used for preparing a kind of medicine to experimenter's administration, perhaps are used to prepare a kind of test kit that detects rabies virus.In an embodiment of purposes of the present invention, the single-chain antibody that preferably has the sequence shown in SEQ IDNO:3 or SEQ ID NO:29 is used for prevention or treatment rabies virus infection disease.In another embodiment, the carrier or the host cell that preferably have the gene of the sequence shown in SEQ ID NO:6 or 30 or contain this gene are used for prevention or treatment rabies virus infection disease.
In another embodiment of purposes of the present invention, the single-chain antibody that preferably has the sequence shown in SEQ ID NO:3 or SEQ ID NO:29 is used to detect rabies virus.In another embodiment, the carrier or the host cell that preferably have the gene of the sequence shown in SEQ ID NO:6 or 30 or contain this gene are used to detect rabies virus.
Single-chain antibody of the present invention is simple in structure, is easy to make up, and can be implemented in efficiently expressing of prokaryotic system, thereby also be easy to realize its large-scale industrial production.
The present invention also proved single-chain antibody of the present invention have avidity height, stability better, can be specifically in and many advantages such as rabies virus.
Antibody of the present invention has significant rabies virus neutralising capacity.The gene of the single-chain antibody of the present invention and this antibody of encoding can effectively be applied to rabic detection, prevention and treatment.Because antibody of the present invention is the small molecules single-chain antibody, for full molecular antibody, it strengthens from the ability that blood vessel gets into its hetero-organization (comprising cns), makes its possibility that gets into cns removing rabies virus increase.
Those of ordinary skills describe the present invention in detail through following examples, so that can understand the present invention better.Following embodiment is property purpose presented for purpose of illustration only, is not intended to limit scope of the present invention.Should be understood that except as otherwise noted, used plant and instrument is the conventional equipment of this area among following each embodiment; Except as otherwise noted, employed substratum is the commercially available conventional substratum that gets, and those skilled in the art all know composition and content wherein.For for simplicity, might use various general abbreviations in this article, those skilled in the art can understand its implication fully.
Embodiment
Embodiment 1: codon optimized the reaching of human source anti-rabies virus gp single-chain antibody Fv57 gene synthesized
1.Fv57 gene is codon optimized
According to the MAB57 antibody sequence described in the Cheung et al. (seeing above), obtain variable region of heavy chain and light chain variable region amino acid sequence shown in SEQ ID NO:1 and SEQ ID NO:2.The codon of selection intestinal bacteria preference is optimized the nucleotide sequence of this aminoacid sequence of encoding.
2. utilize SOE PCR method to synthesize Humanized single chain antibody Fv57 gene
The nucleotide sequence of Humanized single chain antibody Fv57 gene (being goal gene) to be synthesized shown in SEQ ID NO:6, total length 756bp.Design 20 Oligonucleolide primers; Upstream primer contains Nco I, EcoR I; Downstream primer comprises several restriction enzyme sites such as Hind III, BamH I and Xho I; Be used for going into dissimilar prokaryotic expression carriers with gene constructed, and before the restriction enzyme site of downstream, establish terminator codon, primer sequence is shown in SEQ ID NO:7-28.Wherein FF1-5, SF1-5 Oligonucleolide primers are followed successively by the primer with the goal gene inphase component; FR1-5, SR1-5 Oligonucleolide primers are followed successively by the primer with the goal gene complementary portion; And back one primer and last primer have the overlap of 13～24bp, and Fig. 1 is seen in the position of each primer in gene.All primer G+C content are controlled at about 50%.This gene is divided into two sections and synthesizes, and takes turns pcr amplification through 5 respectively, takes turns PCR through one more at last and is spliced into complete genome.
3. the clone of splicing product, interpolation protein purification label and sequential analysis
With six take turns SOE-PCR amplified production connect the T carrier (little upgrading grain cut the correct clone of qualification result with enzyme and sent order-checking, selects the clone consistent with aim sequence for pGEM-T Easy, Promega) transformed into escherichia coli (E.coli top10).The correct clone that checks order designs mutant primer, adds that at the C-terminal of gene order (6 * His) labels are convenient to the purifying of target protein to 6 Histidines.Mutant primer is following:
HisF：5′-gactgttctgggtcaccatcatcatcatcactaagcttggatcc-3′
HisR：5′-ggatccaagcttagtgatgatgatgatggtgacccagaacagtc-3′
PCR system: 10 * reaction buffer, 5 μ l, 1 μ l (5-50ng) plasmid template DNA, each 2 μ l of a pair of mutant primer, dNTP 1 μ l, 0.5 μ l Pfu Turbo archaeal dna polymerase (2.5U/ μ l), TV 50 μ l.
Sudden change PCR condition is: 95 ℃ of preheating 5min; 95 ℃, 1min, 55 ℃, 1min, 68 ℃ of 6min, totally 18 circulations; PCR reacts end, in 50 μ l systems, adds 1 μ l DpnI digestion 2-3 hour, gets 1 μ l and transforms, and extracts plasmid, checks order, and selects the clone of correct sudden change.
Embodiment 2: expression, purifying and the renaturation of human source anti-rabies virus gp single-chain antibody Fv57
1. the structure of antibody gene expression vector:
With the correct mutant clon of order-checking with EcoR I and BamH I double digestion after; With expression vector pBV220 (being Science and Technology Ltd.) available from the sky, Shanghai through same double digestion; Connect Transformed E .coli top10 then, little upgrading grain with the T4 ligase enzyme; Enzyme is cut the correct clone of qualification result send order-checking, select the clone consistent with aim sequence.
2. in the host, express goal gene: recombinant plasmid pBV-Fv57 transformed into escherichia coli BL21 (DE3) competent cell that will check order correct.With the LB agar plate screening that contains penbritin.The fresh single colony inoculation of picking is in 5ml LB substratum (containing penbritin 50 μ g/ml), and 37 ℃ of shaking culture are spent the night.Inoculating 50 μ l overnight culture next day contains in the LB nutrient solution of penbritin in 5ml.About 3 hours of 30 ℃ of shaking culture are to OD 600During ≈ 0.4-0.6, improve culture temperature to 42 ℃, and establish control group, abduction delivering 5-6 hour, centrifugal collection bacterium.Electrophoresis is identified the expression of target protein, and the result sees Fig. 4.
3. cultivate and the amplification expressive host: the clone that expressing quantity is high, amplification cultivation is inoculated in the ratio of overnight culture in 1: 50 in the fresh LB nutrient solution, and about 3 hours of 30 ℃ of shaking culture are to OD 600During ≈ 0.4-0.6, improve culture temperature to 42 ℃, and establish control group, abduction delivering 5-6 hour, centrifugal collection bacterium.Get the microbial culture inoculum of great expression, centrifugal 10 minutes of 6000rpm, the collecting cell deposition is abandoned supernatant.
4. purpose expression product separation and purification: with cell precipitation be resuspended in bacterial lysate (50mMTris-HCl, 1mM EDTA, pH8.0) in; Ultrasonication 15min under the ice bath; At 4 ℃ with the centrifugal 30min of 10000rpm; Deposition is used 8M urea, and 100mM Tris-HCl (pH 8.0) dissolving is stirred about 2hr.4 ℃ with the centrifugal 30min of 15000g, get supernatant, behind the filtering with microporous membrane with 0.45 μ m, (Invitrogen) carries out the affinity chromatography under the sex change condition with the Ni-NTA post.At first with 8M urea, the damping fluid balance nickel post of 100mM Tris-HCl (pH8.0) adds the 50-500mM imidazoles again and carries out gradient elution on this damping fluid basis, collect each gradient eluent, electrophoretic analysis purifying situation.The electrophoretic analysis result sees Fig. 4.
5. the antibody behind the purifying is carried out renaturation: collect 300mM imidazoles gradient eluent, the capable SDS-PAGE electrophoresis of the sample that takes a morsel is estimated its protein concentration; The concentration of control recombinant protein is about 200-300 μ g/ml, with renaturation solution G+ (50mM Tris-HCl (pH=8.0), 10% (v/v) glycerine; 1% (m/v) glycocoll, 0.5mM EDTA, 50mM NaCl)) and renaturation solution G-(50mM Tris-HCl (pH=8.0); 10% (v/v) glycerine, 0.5mM EDTA, 50mMNaCl)) dialysis respectively.After renaturation solution is centrifugal, stay supernatant, be stored in-20 ℃, in order to being further purified.
Embodiment 3: the specific antigens of human source anti-rabies virus gp single-chain antibody Fv57 combines active the detection
With rabies virus (aG strain; Jilin Mai Feng Bioceuticals Inc. is so kind as to give) encapsulate 96 orifice plates; Every hole adds 100 μ l, does positive control with rabies poison human normal immunoglobulin (HRIG is available from Jilin Province Disease Control and Prevention Center); Have histidine-tagged irrelevant albumen as negative control with one, PBS makes blank.Seal with 3%BSA-PBS, hatch 1h under 37 ℃.Adding is with the antibody of embodiment 2 preparations of PBS dilution, every hole 100 μ l, 37 ℃ of 1h.The anti-His-Tag antibody that adds the HRP mark, every hole 100 μ l are hatched 1h under 37 ℃; With develop the color liquid (available from sky root biochemical technology ltd) colour developing of TMB, use H 2SO 4After the termination reaction, under the 450nm wavelength, measure the OD value, the result sees Fig. 5.The result shows, human antibody Fv57 can be specific with combines with rabies virus, and the albumen that has nothing to do can not combine with rabies virus, shows that this antibody is the humanized antibody that specificity is directed against rabies virus glycoprotein.
Embodiment 4: the relative affinity of human source anti-rabies virus gp single-chain antibody Fv57 is measured
Adopt the thiocyanate-elution method that the relative affinity of Fv57 antibody is detected.Encapsulate 96 orifice plates with rabies virus (aG strain, Mai Feng Bioceuticals Inc. in Jilin is so kind as to give),, add the humanized antibody of embodiment 2 preparations, with containing different concns NH with the BSA-PBS sealing 4The PBS solution of SCN is hatched, and washes plate.Anti-His-Tag antibody with the HRP mark is anti-as two.With OD 45050% o'clock corresponding N H descends 4The concentration of SCN is as the relative affinity index, and the result sees Fig. 6, and the result shows that its relative affinity index is 1.6mol/L, shows that avidity is better.
Embodiment 5: the relatively stable Journal of Sex Research of human source anti-rabies virus gp single-chain antibody Fv57
Stability is one of most important BA that influences antibody function.Antibody with PBS and embodiment 2 preparations is hatched at 37 ℃ jointly.The antibody sample of getting different time points is centrifugal, gets supernatant.With rabies virus (aG strain, Mai Feng Bioceuticals Inc. in Jilin is so kind as to give) wrapper sheet, with the BSA-PBS sealing, add above-mentioned sample, hatch, wash plate.The anti-His-Tag antibody that adds the HRP mark, every hole 100 μ l are hatched 1h under 37 ℃; With develop the color liquid (available from sky root biochemical technology ltd) colour developing of TMB, use H 2SO 4After the termination reaction, under the 450nm wavelength, measure the OD value, to detect the relative stability of antibody, the result sees Fig. 7.The result shows, Fv57 in PBS 37 ℃ still have activity after following 96 hours.
Embodiment 6: among the human source anti-rabies virus gp single-chain antibody Fv57 with active research
Adopt rapid fluorescence kitchen range inhibition test (RFFIT method) to detect; Standard serum (available from Nat'l Pharmaceutical & Biological Products Control Institute) is earlier through 56 ℃ of deactivations 30 minutes; Sample or standard serum are the CVS virus (CVS-11 of 80% fluorescence kitchen range with infective dose after three times of dilutions; Available from Nat'l Pharmaceutical & Biological Products Control Institute) in 37 ℃ with 1 hour (serum amount is 100 μ l, and virus quantity is 50 μ l), every Kong Zhongzai adds 50 μ l and contains 50000 bsr cells (10 6/ ml is in the DMEM that contains 10% deactivation calf serum), cultivate after 24 hours for 37 ℃, inclining nutrient solution.With containing Ca 2+, Mg 2+PBS embathe 1 time, add precooling to-20 ℃ 80% cold acetone, 50 μ l/ holes ,-20 ℃ fixing 7 minutes (or room temperature 30 minutes).The fluorescence antibody of the rabies poison nucleoprotein of dried slightly back adding working concentration (40 μ l/ holes, invitrogen), after 37 ℃ of lucifuges were hatched 60 minutes, inclining liquid, and PBS embathes 2 times, and 30 seconds for the first time, 1-5 minute for the second time, inclining liquid.Drip glycerine (one in every hole) in the hole, microscopy is observed the pathology rate.ED50 is calculated as: the inverse logarithm of [(50-is lower than 50% pathology rate) ÷ (be higher than 50% pathology rate-be lower than 50% pathology rate) * log extent of dilution+log is lower than the extent of dilution of 50% pathology rate].The unit content of sample is: the ED50 of the ED50 ÷ standard substance of the unit content * sample of standard substance.Calculating Fv57 thus tires and is 198.4IU/ml (87.4IU/mg).As shown in Figure 8; Human antibody Fv57 and commercially available rabies poison serum (positive control; Available from Jilin Province Disease Control and Prevention Center) mad dog CVS virus fully equally can neutralize; Suppress its cells infected, and the inhibition degree is directly proportional with the concentration of antibody fragment (promptly being inversely proportional to extension rate), and negative control (the irrelevant albumen that has the HIS label) is to the infection unrestraint effect of rabies virus.The prepared rabies of this explanation poison G albumen human antibody Fv57 can be special in and rabies virus, stop the absorption of rabies virus to bsr cell, suppressed the infection of rabies virus to target cell, prove absolutely that this antibody has the activity of higher neutralization virus.
In addition; Adopt the interior neutralisation (MNT method) of mouse brain to detecting with activity in the antibody of Fv57; Its concise and to the point process is following: commercially available rabies poison serum (available from Jilin Province Disease Control and Prevention Center), Fv57 antibody are mixed with the CVS virus of different extent of dilution (making 10 times of serial dilutions) respectively; Hatch 1hr for 37 ℃, getting body weight is that 11-13g kunming mice encephalocoele is injected 30 μ l, 6 mouse of each extent of dilution.Same extent of dilution all not add antibody neutral virus liquid as contrast, was observed 14 days, and the record death condition is calculated viral LD50.The calculating of LD50 is according to logLD 50=log (extent of dilution that is higher than 50% mortality ratio)+(distance is than the logarithm of * extension rate), wherein distance is than=(being higher than 50% mortality ratio-50)/(be higher than 50% mortality ratio-be lower than 50% mortality ratio).Finally calculate Fv57 can be fully in the virus of 5623 LD50; Compare with commercially available rabies poison serum; Can reach similar protection mouse and make its infection that exempts from the rabies virus of lethal dose, prove absolutely that this antibody has the activity of higher neutralization virus.
Result of experiment can prove fully that all Fv57 antibody is that a strain specificity is good in above external and the body, the neutralizing antibody of high-affinity, and its acquisition will be to the rabic prevention of China, and diagnosis and treatment provide new approach.
Embodiment 7: the transformation of human source anti-rabies virus gp single-chain antibody Fv57 structure
Amino acid (FR4 district) on the 39th amino acids (FR2 district) of Fv57 weight chain variabl area sequence SEQ ID NO:1 and light chain variable region sequence SEQ ID NO:2 the 102nd is sported halfcystine (Cys); Form an interchain disulfide linkage; To stablize the space structure of whole Fv molecule, its stability is strengthened.Its transformation process is following:
39 amino acids mutant primers:
5′cgccgggtcagtgcctggagtggatggg?3′
5′cccatccactccaggcactgacccggcg?3′
102 amino acids mutant primers:
5′gttgttttcggctgcggtaccaaactgac?3′
5′gtcagtttggtaccgcagccgaaaacaac3′
Make template with the pBV-Fv57 plasmid, replace the Taq enzyme in the regular-PCR system that 39 of Fv57 and 102 amino acids are suddenlyd change, it is sported halfcystine with high-fidelity pfu enzyme.
PCR system: 10 * reaction buffer, 5 μ l, 1 μ l (5-50ng) plasmid template DNA, each 2 μ l of a pair of mutant primer, dNTP1 μ l, 0.5 μ l of Pfu Turbo archaeal dna polymerase (2.5U/ μ l), TV 50 μ l.
Sudden change PCR condition is: 9 ℃ of preheating 5min; 95 ℃, 1min, 55 ℃, 1min, 68 ℃ of 6min, totally 18 circulations; PCR reacts end, in 50 μ l systems, adds 1 μ l DpnI digestion 2-3 hour, gets 1 μ l and transforms, and extracts plasmid, checks order, and selects the clone of correct sudden change.The variant called after dsFv57 that gained is new, its expressing quantity is consistent basically with Fv57, and expression, purification process are identical with Fv57.Prepared and diluted renaturation solution (1.6M urea, 50mMTris-HCl (pH=8.0), 10% (v/v) glycerine, 1% (m/v) glycocoll, 0.5mM EDTA; 50mM NaCl, 1mM GSH, 0.1mM GSSG), drip slowly that protein concentration is 10-50 μ g/ml in sample to the system; Behind 4 ℃ of reaction 48h, GSSG concentration is adjusted to 2mM, 4 ℃ of reaction 12h are with this solution dialysis tubing of packing into; Respectively with renaturation solution G+ (50mM Tris-HCl (pH=8.0), 10% (v/v) glycerine, 1% (m/v) glycocoll, 0.5mM EDTA; 50mMNaCl)) and renaturation solution G-(50mM Tris-HCl (pH=8.0), 10% (v/v) glycerine, 0.5mMEDTA, 50mM NaCl)) dialysis.After renaturation solution is centrifugal, stay supernatant, be stored in-20 ℃, in order to being further purified.
Utilize the thiocyanate-elution method described in the embodiment 4 that the relative affinity of dsFv57 is detected.The result sees Fig. 6, and the result shows that avidity is better, and its relative affinity index is that avidity is higher than Fv57 about 2.0mol/L.
Utilize method described in the embodiment 5 that the dsFv57 relative stability is studied, the result sees Fig. 7.The result shows, dsFv57 in PBS 37 ℃ still have activity after 96 hours, and good stability is in Fv57.
Embodiment 8: other application of human source anti-rabies virus gp neutrality genetic engineering antibody Fv57
Human source anti-rabies virus gp neutrality genetic engineering antibody Fv57 can be used for the development of rabies virus detection kit, can be used to catch or detect rabies virus with this single-chain antibody, develops highly sensitive test kit.Fv57 with suitable concn encapsulates 96 orifice plates, with the BSA-PBS sealing, adds rabies virus antigen, hatches, and washes plate.How anti-(horse serum of rabies poison, or the rabbit anteserum of the rabies of preparation voluntarily poison) that adds the HRP mark, every hole 100 μ l are hatched 1h under 37 ℃.With develop the color liquid (available from sky root biochemical technology ltd) colour developing of TMB, use H 2SO 4After the termination reaction, under the 450nm wavelength, measure the OD value, to detect antigenic concentration.As capture antibody, because cost is low, albumen encapsulates concentration can be bigger, thereby improved the Detection of antigen scope with Fv57.
Figure ISA00000436656100011
Figure ISA00000436656100021
Figure ISA00000436656100041
Figure ISA00000436656100061
Figure ISA00000436656100071
Figure ISA00000436656100081
Figure ISA00000436656100091

Claims (26)

  1. In the ability with the human source anti-rabies virus gp single-chain antibody of rabies virus; It is characterized in that; Said single-chain antibody has weight chain variabl area sequence (a) or its variant sequence shown in SEQ ID NO:1; Light chain variable region sequence (b) shown in SEQ ID NO:2 or its variant sequence; And a connection peptides sequence, wherein said sequence (a) or variant sequence (b) are for having the sequence of displacement, disappearance, interpolation and/or the modification of one or more amino-acid residues in said sequence (a) or (b).
  2. 2. the single-chain antibody of claim 1 is characterized in that, the said weight chain variabl area sequence (a) of said single-chain antibody or its variant sequence are connected in the N-end or the C-end of said connection peptides, and said light chain variable region sequence (b) is connected in the other end of said connection peptides.
  3. 3. claim 1 or 2 single-chain antibody is characterized in that said connection peptides is the sequence that length is at least 12 amino-acid residues.
  4. 4. the single-chain antibody of claim 3 is characterized in that, said connection peptides is (Gly 4Ser) n, wherein n is the integer of 3-5, and preferably n is 4, and perhaps said connection peptides is AKTTAPSVYPLA.
  5. 5. each single-chain antibody of aforementioned claim; It is characterized in that; The displacement of said one or more amino-acid residues, disappearance, interpolation and/or modification make said antibody molecule comprise the disulfide linkage that forms between amino-acid residue; And/or comprise the label of six Histidines, and/or comprise the polyoxyethylene glycol that is attached on the amino-acid residue.
  6. 6. each single-chain antibody of aforementioned claim; It is characterized in that; The aminoacid sequence of said single-chain antibody perhaps is connected with the sequence of hexahistidine tag on the end of SEQ IDNO:3 or SEQ ID NO:29 shown in SEQ ID NO:3 or SEQ ID NO:29.
  7. 7. each nucleic acid of the aforementioned claim of coding.
  8. 8. the nucleic acid of claim 7; It is characterized in that; Said nucleic acid has weight chain variable region nucleotide sequence (i) or its variant sequence shown in SEQ ID NO:4, the light chain variable region nucleotide sequence shown in SEQ ID NO:5 (ii) or its variant sequence, and the nucleotide sequence of coding connection peptides; Wherein, said sequence (i) or variant sequence (ii) be said sequence (i) or (ii) in have the sequence of one or more nucleotide subsitutions, disappearance or interpolation.
  9. 9. the nucleic acid of claim 8 is characterized in that, said connection peptides is the connection peptides described in claim 3 or 4.
  10. 10. claim 7 or 8 nucleic acid; It is characterized in that; The sequence of said nucleic acid perhaps is connected with the sequence of the nucleotide sequence of coding hexahistidine tag for the end in sequence shown in SEQ ID NO:6 or the SEQ ID NO:30 shown in SEQ IDNO:6 or SEQ ID NO:30.
  11. 11. a carrier is characterized in that, said carrier comprises each nucleic acid of claim 7-10.
  12. 12. a host cell is characterized in that, said cell comprises each nucleic acid of claim 7-10.
  13. 13. the host cell of claim 12 is characterized in that, said host cell is a Bacillus coli cells.
  14. 14. a compsn is characterized in that, said compsn comprises each each nucleic acid, the carrier of claim 11 or the host cell of claim 12 or 13 of single-chain antibody, claim 7-10 of claim 1-6.
  15. 15. one kind prepares each the method for single-chain antibody of claim 1-6, it is characterized in that said method comprises:
    Coding claim 1-6 is provided each the goal gene of single-chain antibody,
    This goal gene is built up in the expression vector,
    In the host, express said goal gene; With
    The results expression product, thus said single-chain antibody obtained.
  16. 16. the method for claim 15 is characterized in that, the nucleotides sequence of said goal gene is classified each the nucleotide sequence of nucleic acid of claim 7-10 as.
  17. 17. the method for claim 15 is characterized in that, said expression vector is plasmid vector, virus vector, the genetically modified carrier of animal or universal support.
  18. 18. the method for claim 15 is characterized in that, said host cell is animal, plant, bacterium or zymic cell.
  19. 19. the method for claim 15 is characterized in that, said host cell is colibacillary cell.
  20. 20. each method of claim 15-19 is characterized in that said method also comprises the said single-chain antibody of separation and purification.
  21. 21. the method for claim 20 is characterized in that, said separation and purification comprises:
    (a) with the host cell cracking and collect split product;
    (b) with split product purifying under the sex change condition, and
    (c) with the purified product renaturation.
  22. 22. the method for claim 21 is characterized in that, randomly comprises hexahistidine tag in the aminoacid sequence of said purified product.
  23. 23. the method for claim 21 or 22; It is characterized in that; The aminoacid sequence of said single-chain antibody sequence or for the end of SEQ ID NO:3 is connected with the sequence of six Histidines shown in SEQ ID NO:3, and comprise in said (c) step and use second renaturation solution that contains first renaturation solution of glycocoll and do not contain glycocoll.
  24. 24. the method for claim 21 or 22; It is characterized in that; The aminoacid sequence of said single-chain antibody sequence or for the end of SEQ ID NO:29 is connected with the sequence of six Histidines shown in SEQ ID NO:29, and be included in said (c) step use contain first renaturation solution of glycocoll with second renaturation solution that does not contain glycocoll before use contain the 3rd renaturation solution of GSH and GSSG.
  25. 25. each each nucleic acid, the carrier of claim 11 or the purposes of host cell in the medicine of preparation prevention or treatment rabies virus infection disease of claim 12 or 13 of single-chain antibody, claim 7-10 of claim 1-6.
  26. 26. each each nucleic acid, the carrier of claim 11 or the purposes of host cell in preparation rabies virus detection kit of claim 12 or 13 of single-chain antibody, claim 7-10 of claim 1-6.
CN201110040898.1A 2011-02-17 2011-02-17 Human derived anti-rabies virus glycoprotein gene engineering antibody and preparation and application thereof Active CN102643343B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201110040898.1A CN102643343B (en) 2011-02-17 2011-02-17 Human derived anti-rabies virus glycoprotein gene engineering antibody and preparation and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201110040898.1A CN102643343B (en) 2011-02-17 2011-02-17 Human derived anti-rabies virus glycoprotein gene engineering antibody and preparation and application thereof

Publications (2)

Publication Number Publication Date
CN102643343A true CN102643343A (en) 2012-08-22
CN102643343B CN102643343B (en) 2015-03-25

Family

ID=46656446

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201110040898.1A Active CN102643343B (en) 2011-02-17 2011-02-17 Human derived anti-rabies virus glycoprotein gene engineering antibody and preparation and application thereof

Country Status (1)

Country Link
CN (1) CN102643343B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103998059A (en) * 2011-09-30 2014-08-20 赛特瑞恩股份有限公司 Binding molecule for neutralizing rabies virus
CN104628851A (en) * 2015-02-12 2015-05-20 长春百克生物科技股份公司 Genetically engineered antibody of anti-rabies virus as well as preparation method and application of genetically engineered antibody

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101550189A (en) * 2008-04-25 2009-10-07 中国人民解放军军事医学科学院卫生学环境医学研究所 Anthropogenic antivirulin glycosidoprotein neutralizing genetic engineering antibody RD9 and preparation and application thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101550189A (en) * 2008-04-25 2009-10-07 中国人民解放军军事医学科学院卫生学环境医学研究所 Anthropogenic antivirulin glycosidoprotein neutralizing genetic engineering antibody RD9 and preparation and application thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
SAU C. CHEUNG ET AL.: "A Recombinant Human Fab Expressed in Escherichia coli Neutralizes Rabies Virus", 《JOURNAL OF VIROLOGY》 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103998059A (en) * 2011-09-30 2014-08-20 赛特瑞恩股份有限公司 Binding molecule for neutralizing rabies virus
CN104628851A (en) * 2015-02-12 2015-05-20 长春百克生物科技股份公司 Genetically engineered antibody of anti-rabies virus as well as preparation method and application of genetically engineered antibody
CN104628851B (en) * 2015-02-12 2019-07-30 长春百克生物科技股份公司 A kind of genetic engineering antibody, preparation method and the application of rabies poison

Also Published As

Publication number Publication date
CN102643343B (en) 2015-03-25

Similar Documents

Publication Publication Date Title
CN111690059B (en) Monoclonal antibody 1D7 for resisting SARS-CoV-2
CN111718411A (en) Monoclonal antibody 1F2 for resisting SARS-CoV-2
CN113045647B (en) Neutralizing antibody of novel coronavirus SARS-CoV-2 and application thereof
CN110317267B (en) Bispecific antibodies against rabies virus and uses thereof
CN112521494B (en) Monoclonal antibody 2B11 for resisting SARS-CoV-2
CN102875674B (en) Anti-tetanotoxin antibody, and preparation method and application thereof
CN111732654A (en) Monoclonal antibody 1E10 for resisting SARS-CoV-2
CN102816246A (en) Human cytomegalo virus immunogen fusion protein as well as preparation method and usage thereof
CN102643343A (en) Human derived anti-rabies virus glycoprotein gene engineering antibody and preparation and application thereof
CN101386648B (en) Neutralizing monoclonal antibodies against B type botulinum neurotoxin, preparation method and use thereof
CN108728461A (en) H3N2 type canine influenza virus shuttle intracellular antibodies TAT-4F
Li et al. A novel variable antibody fragment dimerized by leucine zippers with enhanced neutralizing potency against rabies virus G protein compared to its corresponding single-chain variable antibody fragment
CN103725697A (en) Chemically synthesized staphylococcus aureus surface protein FnBPA gene fragment and expression and application thereof
Pavan et al. Nanobodies against SARS-CoV-2 reduced virus load in the brain of challenged mice and neutralized Wuhan, Delta and Omicron Variants
CN103130894B (en) Recombinant single-chain antibody G5-4ScFv of anti-human gamma delta T cell receptor (TCR) monoclonal antibody and encoding gene and application thereof
CN110903385B (en) H1N1 influenza virus antibody and preparation method and application thereof
Pearce et al. Linear gene fusions of antibody fragments with streptavidin can be linked to biotin labelled secondary molecules to form bispecific reagents
CN104628851B (en) A kind of genetic engineering antibody, preparation method and the application of rabies poison
RU2533802C1 (en) Trimerised single-domain antibody that specifically binds with glycoprotein g of rabies virus, neutralising rabies virus
CN113817051A (en) Monoclonal antibody 1B6 for resisting SARS-CoV-2
KR101526886B1 (en) Recombinant Protein Comprising Epitope of Fowl Adenovirus fiber 2 Protein and Antibody thereto
Gupta et al. Recombinant fusion proteins for haemagglutination-based rapid detection of antibodies to HIV in whole blood
CN108610417B (en) Anti-tetanus toxin neutralizing antibody, preparation method and application thereof
CN103848915A (en) Preparation and application of novel anti-rabies virus glycoprotein human-derived genetically-engineered antibody
Gu et al. Identification of binding epitope for anti-rabies virus glycoprotein single-chain Fv fragment FV57

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant