CN102643343B - Human derived anti-rabies virus glycoprotein gene engineering antibody and preparation and application thereof - Google Patents
Human derived anti-rabies virus glycoprotein gene engineering antibody and preparation and application thereof Download PDFInfo
- Publication number
- CN102643343B CN102643343B CN201110040898.1A CN201110040898A CN102643343B CN 102643343 B CN102643343 B CN 102643343B CN 201110040898 A CN201110040898 A CN 201110040898A CN 102643343 B CN102643343 B CN 102643343B
- Authority
- CN
- China
- Prior art keywords
- sequence
- seq
- chain antibody
- antibody
- nucleic acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a human derived anti-rabies virus glycoprotein gene engineering antibody and preparation and application thereof, the antibody has a heavy chain variable region sequence as shown in the SEQ ID NO:1 or a variant sequence thereof, a light chain variable region sequence shown in the SEQ ID NO:2 or a variant sequence thereof, and a connecting peptide sequence. The invention also relates to a method for preparing the antibody and purpose thereof for detecting rabies viruses or treating or preventing disease caused by rabies virus infection.
Description
Technical field
The present invention relates to a kind of antibody of rabies poison, particularly relate to a kind of human source anti-rabies virus glycoprotein gene engineered antibody and preparation and application thereof.
Background technology
Rabies are transmissible diseases that mortality ratio is the highest, and case fatality rate is 100%.Rabies worldwide extensively distribute, and the whole world has people more than 60,000 to die from rabies every year.China also belongs to rabies country occurred frequently.At present, rubies epidemiology peak is just formed in China again.Rabic control has become one of most important public health problem of China.
The major measure of Rabies Prevention is the prevention after rabies exposure.For serious resurrectionist, World Health Organization's suggestion, applies vaccine simultaneously and anti-rabies antibody carries out initiatively and the combination therapy of passive immunization can reduce viral infection effectively.For the jejune children of developing immune system, and hypoimmunity can not produce the crowd of antibody in time, and antibody must be used after exposure to prevent and treat.
Existing effective vaccine or antibody carry out prophylactic propagation at present, such as use immune serum or immunoglobulin (Ig) or monoclonal antibody.For antilyssic or antibody, its application is subject to the restriction of following factors: because the source of rabies virus people immune serum is very limited, and conventional horse immune serum carries out the treatment after rabies virus exposure clinically.The greatest problem of horse serum treatment is the anaphylaxis causing patient serious.The rabies poison immunoglobulin (Ig) in people source also can be used for exposing rear treatment, but it is expensive, and utilizes the human serum preparation of extracting due to it, may be polluted, there is potential safety hazard by known or unknown human pathogen.And for human monoclonal antibody, although it shows advantage in application, the limitation of eukaryotic system fermentation technique then becomes one of its Main Bottleneck prepared.
Report that more genetic engineering antibody has scFv (single chainFv), scFv-Fc and Fab etc. in current antibody exploitation.Wherein, scFv-Fc and Fab due to molecule relatively large, containing multiple glycosylation site, in prokaryotic system, be difficult to the maturation of antibody; usually require to express preparation in eukaryotic system, but the limitation of eukaryotic cell fermentation technique makes it to be difficult to form large-scale production at present.Though scFv has made certain contribution in the diagnosis of various diseases, but due to its space structure unstable and significantly limit its application in clinical treatment.
Owing to not also being specially adapted to the genetic engineering antibody of rabic treatment and prevention at present, the application of many anti-rabies antibodies is still subject to the limitation of factors, therefore needs a kind of potent antibodies for rabies poison newly of exploitation badly.
The present invention proposes a kind of human genetically engineered antibody for rabies virus glycoprotein (G) newly, it can play significantly and the effect of rabies virus, thus for rabic detection, prevention and therapy.
Summary of the invention
The invention provides the genetic engineering antibody with rabies virus in a kind of energy.
First aspect, the invention provides a kind of human source anti-rabies virus glycoprotein single-chain antibody, it has weight chain variabl area sequence (a) as shown in SEQ ID NO:1 or its variant sequence thereof, light-chain variable sequence (b) as shown in SEQID NO:2 or its variant sequence thereof, and a connection peptides sequence, wherein said variant sequence thereof is the sequence in described sequence (a) or (b) with one or more radical amino acid replacement, disappearance, interpolation and/or modification.
Second aspect, the invention provides a kind of nucleic acid of code book invention single-chain antibody.In addition, present invention also offers the carrier comprising nucleic acid of the present invention and host cell.
The third aspect, the invention provides a kind of composition, described composition comprise single-chain antibody of the present invention, code book invention single-chain antibody nucleic acid, containing the carrier of described nucleic acid or containing the host cell of described nucleic acid.
Fourth aspect, present invention also offers a kind of method preparing single-chain antibody of the present invention.Single-chain antibody of the present invention prepares by such as engineered method.In one embodiment, method of the present invention comprises: the goal gene providing code book invention single-chain antibody; This goal gene is built up in expression vector; This goal gene is expressed in host; And results expression product, thus obtain described single-chain antibody.
5th aspect, the invention provides single-chain antibody of the present invention (particularly antibody Fv57), code book invention antibody nucleic acid, containing the carrier of nucleic acid of the present invention or host cell in preparation prevention or treat rabic medicine, or preparing the application in Rabies Virus Detection test kit.
Accompanying drawing explanation
Fig. 1 shows the schematic diagram utilizing SOE-PCR method to synthesize Fv57 antibody gene.
Fig. 2 shows the agarose gel electrophoretogram of SOE-PCR product, and wherein swimming lane 1-5 is respectively F1-F5, and swimming lane 8-12 is respectively S1-S5, and swimming lane 6 is the PCR primer of Fv57 antibody gene, and swimming lane 7 is DNA molecular amount standard DL2000.
The EcoR I enzyme that Fig. 3 shows recombinant plasmid pBV-Fv57 cuts qualification collection of illustrative plates, and wherein swimming lane 1-4 is digestion products, and swimming lane 5 and 6 is respectively DNA molecular amount standard: DNA marker1KB and DNA marker DL2000.
Fig. 4 shows the electroresis appraisal collection of illustrative plates of expressing protein after recombinant plasmid pBV-Fv57 transformation of E. coli (Escherichia coli) BL21 (DE3) cell.In left figure, swimming lane 1 is protokaryon Protein Marker, and swimming lane 2,4,6 is whole cell albumen before abduction delivering, and swimming lane 3,5,7 is whole cell albumen after abduction delivering.In right figure, swimming lane 1 is protokaryon Protein Marker, swimming lane 2 is sample before column purification, swimming lane 3 wears sample for loading stream, swimming lane 4 is 0mM imidazoles elution samples, swimming lane 5 and 6 is respectively 300mM imidazoles elution samples (1) and (2), and swimming lane 7 is 500mM imidazoles elution samples.
Fig. 5 shows the detected result of Fv57 antibody and antigen-specific binding activities.
Fig. 6 shows the relative affinity measurement result of Fv57 antibody.
Fig. 7 shows the relative stability result of study of Fv57 antibody.
Fig. 8 A and 8B shows the Neutralization effect measurement result of Fv57 antibody.
Sequence explanation
SEQ ID NO:1 is the heavy chain variable amino acid sequence of single-chain antibody Fv57.
SEQ ID NO:2 is the chain variable region amino acid sequence of single-chain antibody Fv57.
SEQ ID NO:3 is the aminoacid sequence of single-chain antibody Fv57.
SEQ ID NO:4 is the variable region of heavy chain nucleotide sequence of an encode single chain antibodies Fv57.
SEQ ID NO:5 is the variable region of light chain nucleotide sequence of an encode single chain antibodies Fv57.
SEQ ID NO:6 is the nucleotide sequence of an encode single chain antibodies Fv57.
SEQ ID NO:7 is the aminoacid sequence of connection peptides part in single-chain antibody Fv57.
SEQ ID NO:8 is the nucleotide sequence of connection peptides part in a single-chain antibody Fv57.
SEQ ID NO:9-13 is the sequence of Oligonucleolide primers FF1-5.
SEQ ID NO:14-18 is the sequence of Oligonucleolide primers SF1-5.
SEQ ID NO:19-23 is the sequence of Oligonucleolide primers FR1-5.
SEQ ID NO:24-28 is the sequence of Oligonucleolide primers SR1-5.
SEQ ID NO:29 is the aminoacid sequence of single-chain antibody dsFv57.
SEQ ID NO:30 is the nucleotide sequence of an encode single chain antibodies dsFv57.
Embodiment
Hereafter the invention will be further described.Should be understood that these specifically described embodiments should not form limitation of the scope of the invention.
Human source anti-rabies virus glycoprotein single-chain antibody of the present invention has variable region of heavy chain part, variable region of light chain part as described above and connects this two-part connection peptides (VH-connection peptides-VL).In one embodiment, human source anti-rabies virus glycoprotein single-chain antibody is made up of variable region of heavy chain of the present invention part, variable region of light chain part and connection peptides, wherein said variable region of heavy chain part is connected to N-end or the C-end of described connection peptides, and variable region of light chain partial response be connected to the other end of described connection peptides.Preferably, described variable region of heavy chain part is connected to the N-end of described connection peptides.
In an embodiment of single-chain antibody of the present invention, the aminoacid sequence of described variable region of heavy chain and variable region of light chain is respectively as shown in SEQ ID NO:1 and SEQ ID NO:2.This heavy chain and light-chain variable sequence obtain (see Cheung based on the aminoacid sequence of humanization anti-rabies monoclonal antibodies MAB57, et al., A recombinant human Fab expressed inEscherichia coli neutralizes rabies virus.J.Virol.1992,66 (11): 6714-6720).
In another embodiment of single-chain antibody of the present invention, the aminoacid sequence of described variable region of heavy chain and/or variable region of light chain can be the variant sequence thereof of aminoacid sequence shown in SEQ ID NO:1 and/or SEQ ID NO:2, and described variant sequence thereof comprises the displacement of one or more amino-acid residue, disappearance, interpolation and/or modification.With the ability of rabies virus during the single-chain antibody of the present invention comprising above-mentioned variant sequence thereof remains with.
The characteristic of the ability of rabies virus " in and " of antibody described herein or " in energy and rabies virus " is determined by the many ordinary methods known to those skilled in the art.Such as carry out cell in vitro mensuration by rapid fluorescence stove inhibition test (RFFIT method); show in stoping the antibody of the ability of virus infection bsr cell namely to be thought to have in this experiment and the ability of rabies virus; or carry out In-vivo test in mice by neutralisation (MNT method) in mouse brain, show in this experiment antibody that protection mouse avoids the ability infecting fatal rabies virus namely think have in and the ability of rabies virus.
This one side of described variant sequence thereof is comprised in single-chain antibody of the present invention, in a specific embodiment, described radical amino acid replacement, disappearance, interpolation and/or modification can make to produce extra covalently or non-covalently effect between the amino-acid residue of antibody molecule inside of the present invention, such as between amino-acid residue, produce disulfide linkage effect, such as, by displacement, the disappearance of amino-acid residue, add and/or be modified in SEQ ID NO:1 and/or SEQ ID NO:2 and introduce Cys residue suitably.Because the existence of Cys residue can produce intramolecular disulfide bond, thus the stability of small molecular antibody is strengthened.Those skilled in the art can understand the region of suitable introducing disulfide linkage in antibody sequence.Such as, the amino acid sites of disulfide linkage to be formed in antibody variable region can be made to be positioned at the framework region of structural conservation, make it away from complementary determining region (CDR), form the combination that disulfide linkage not only can not disturb this antibody and antigen thus, also add Antibody stability simultaneously.Especially, in the methodology of antibody construction, or disulfide linkage can be formed between the 105th amino acids residue of heavy chain and the 43rd amino acids residue (H105-L43) of light chain between the 100th amino acids residue (H44-L100) of the 44th amino acids residue of heavy chain of antibody and light chain; But for concrete aminoacid sequence, above-mentioned site may deviation to some extent, and its accurate location is determined by comparing with the conserved sequence of antibody database corresponding position.
In a specific embodiment, the aminoacid sequence of antibody of the present invention comprises the radical amino acid replacement of Gly102Cys in Gly39Cys and SEQ ID NO:2 in SEQ IDNO:1.Thus, in one embodiment, antibody of the present invention is included in the one or more disulfide linkage formed between amino-acid residue.
In another embodiment, described antibody molecule comprises the detection or purification tag, the such as purification tag of six Histidines added, to make the antibody molecule comprising this label purifying better of gained.In a specific embodiment, the invention provides one sequence end---such as N-terminal or C-terminal---shown in SEQ IDNO:3 or SEQ ID NO:29 and be added with the antibody molecule of the label of six Histidines.In another embodiment, the one or more amino-acid residues in antibody of the present invention are modified by another kind of outside agent, such as, modified by polyoxyethylene glycol (PEG), form the antibody molecule of PEGization.PEG is attached to the molecular weight that the amino-acid residue in antibody can increase antibody, thus improves stability of molecule, also extends antibody molecule action time in vivo, contributes to improving the ability that it neutralizes virus in vivo.
Connection peptides in single-chain antibody of the present invention is generally the sequence that length is at least 12 amino-acid residues, and the connection peptides sequence be present in this antibody can not reduce the activity of variable region of heavy chain and variable region of light chain part in this antibody.In one embodiment of the invention, the aminoacid sequence of described connection peptides is (Gly
4ser) n, wherein n is suitable integer, and preferably, n is the integer being selected from 3-5, and particularly preferably, n is 4.Described connection peptides also can be other aminoacid sequences, and as an example, the aminoacid sequence of described connection peptides is AKTTAPSVYPLA.Equally, for the aminoacid sequence of above-mentioned connection peptides, the transformation can replaced, lack, add and/or modify one or more amino-acid residue, improved aminoacid sequence still can be used as connection peptides in single-chain antibody of the present invention.In this sense, such as (Gly
4ser)
3or (Gly
4ser)
5(Gly can be thought
4ser)
4the connection peptides sequence obtained after amino-acid residue transformation.
In a particularly preferred embodiment of single-chain antibody of the present invention, described single-chain antibody is for having the antibody Fv57 of aminoacid sequence as shown in SEQ ID NO:3, and its N-holds the sequence set to C-end to become SEQ ID NO:1, SEQ ID NO:7 and SEQ ID NO:2.In another embodiment, the aminoacid sequence of described single-chain antibody is the antibody Fv57 variant sequence thereof comprising the displacement of one or more amino-acid residue, disappearance, interpolation and/or modification.In a preferred embodiment of this one side, described single-chain antibody is for having the dsFv57 of the aminoacid sequence as shown in SEQ ID NO:29, in this embodiment, described antibody comprises the radical amino acid replacement of Gly102Cys in the radical amino acid replacement of Gly39Cys in SEQ ID NO:1 and SEQ ID NO:2.
The invention provides a kind of nucleic acid of code book invention single-chain antibody.In one embodiment, described nucleic acid has weight chain variable region nucleotide sequence (i) as shown in SEQ ID NO:4 or its variant sequence thereof, light chain variable region nucleotide sequence (ii) as shown in SEQ ID NO:5 or its variant sequence thereof, and the nucleotide sequence of coding connection peptides, wherein, the variant sequence thereof of described sequence (i) or (ii) is the sequence in described sequence (i) or (ii) with one or more nucleotide subsitution, disappearance or interpolation.In the embodiment of a nucleic acid of the present invention, described nucleic acid has weight chain variable region nucleotide sequence (i) shown in SEQ ID NO:4, light chain variable region nucleotide sequence (ii) as shown in SEQ ID NO:5, and the nucleotide sequence of coding connection peptides.In another embodiment of the invention, the nucleic acid of described code book invention single-chain antibody has the variant sequence thereof of described sequence (i) and/or (ii), and described variant sequence thereof is the sequence in described (i) or (ii) with the displacement of one or more Nucleotide, disappearance or interpolation.
In a preferred embodiment, described nucleic acid has the nucleotide sequence shown in SEQ ID NO:6, and its Nucleotide of 5 ' to 3 ' consists of SEQ ID NO:4, SEQ ID NO:8 and SEQ ID NO:5.In this embodiment, the aminoacid sequence of described nucleic acid encoding antibody Fv57 of the present invention.In another preferred embodiment, described nucleic acid encoding antibody dsFv57 of the present invention.
Nucleic acid of the present invention can be introduced in carrier and/or then import in the host cell for expressing to make nucleic acid of the present invention carry out cloning or expressing.Thus, the invention provides the carrier comprising nucleic acid of the present invention or host cell.Described carrier can be plasmid vector or virus vector, the carrier of Animal Transgenic or universal support.Preferably, described carrier is the plasmid vector comprising nucleic acid of the present invention.In a concrete preferred embodiment, described carrier is the pBV220 of the nucleotide sequence comprising SEQ ID NO:6.Described host cell can be the cell of bacterium, yeast, animal or plant, and preferred host cell is Bacillus coli cells.In a concrete preferred embodiment, described host cell is the Bacillus coli cells comprising SEQ ID NO:6.
The expression of nucleic acid of the present invention can occur in the host produced for target protein, or occurs in the experimenter (such as people) that needs to carry out rabies prophylaxis or treatment.
Present invention provides and a kind ofly comprise single-chain antibody of the present invention, nucleic acid or containing the carrier of this nucleic acid or the composition of host cell.Can further containing suitable reagent carrier in described composition.Such as, composition of the present invention can comprise pharmaceutically acceptable carrier, carries out vivo medicine-feeding for experimenter, or described composition can comprise the detection of suitable carrier for external rabies virus.Those skilled in the art know these carriers, and know the composition how be mixed with together with single-chain antibody of the present invention by suitable carrier for detecting, preventing or treat.
For carrying out the composition of the present invention of vivo medicine-feeding to experimenter, those skilled in the art can select suitable route of administration as drug administration by injection, such as, carry out administration by vein, subcutaneous, intracutaneous and intramuscular injection.
The invention also discloses a kind of method being prepared single-chain antibody of the present invention by genetic engineering means.Specifically, this preparation method comprises: the goal gene providing code book invention single-chain antibody; Goal gene is built up in carrier; This goal gene is expressed in host; And results expression product, thus obtain described single-chain antibody.
In another embodiment, method of the present invention also comprises the step of separation and purification antibody of the present invention.The step of described separation and purification can comprise further: host cell lysis is collected split product; By split product purifying (such as by chromatography or additive method well known by persons skilled in the art) under Denaturing; By purified product renaturation, thus obtain antibody of the present invention.For improving purification efficiency, can connect purification tag on goal gene of the present invention, such as, at gene order end, such as 5 ' or 3 ' end, adds the encoding sequence label of 6 Histidines (6 × His).
Chromatography can be used in purification procedures of the present invention to carry out, and such as affinity chromatography, ion exchange chromatography, hydrophobic chromatography, molecular sieve chromatography etc., to carry out purifying to target protein.Those skilled in the art also can use other conventional meanses to carry out protein purification in its ken.
In a preferred embodiment, the chromatographic column (such as Ni-NTA chromatographic column, elutriant is such as the elutriant containing imidazoles) for purification tag 6 × His is used to carry out the affinity purification of target protein.
In described renaturation step, protein renaturation liquid can be used to the target protein of purifying to carry out protein renaturation, preferably use and carry out renaturation respectively more than a kind of protein renaturation liquid.In one embodiment, two kinds of different renaturation solutions are comprised to the renaturation solution used in antibody renaturation of the present invention, preferably, a kind of containing glycine, and another kind is not containing glycine.In a specific embodiment, described single-chain antibody is the Fv57 that Fv57 or N-terminal or C-terminal are added with six Histidines, and described renaturation solution comprises containing the first renaturation solution of glycine with not containing the second renaturation solution of glycine.Described first and second renaturation solutions also can comprise other components that can be used for protein renaturation liquid, such as Tris-HCl, glycerine and EDTA etc.In a preferred embodiment, described single-chain antibody is the Fv57 that Fv57 or N-terminal or C-terminal are added with six Histidines, the first renaturation solution comprising glycine is first used in described renaturation step, re-use not containing the second renaturation solution of glycine, wherein said first and second renaturation solutions are also containing Tris-HCl, glycerine and EDTA.In another embodiment, the renaturation solution of antibody of the present invention comprises more than two kinds of renaturation solutions, such as three kinds of renaturation solutions.Such as, when antibody of the present invention is included in the disulfide linkage formed between amino-acid residue, such as described antibody is the dsFv57 that dsFv57 or N-terminal or C-terminal are added with six Histidines, three kinds of renaturation solutions are used in described renaturation step, such as can use above-mentioned the first renaturation solution containing glycine and not containing the second renaturation solution of glycine, also use the 3rd renaturation solution containing GSH (reduced glutathion), GSSG (Sleep-promoting factor B).3rd renaturation solution preferably used before described first and second renaturation solutions of use.Described first, second, and third renaturation solution also can comprise other components that can be used for protein renaturation liquid, such as Tris-HCl, glycerine and EDTA etc.In a specific embodiment, described single-chain antibody is the dsFv57 that dsFv57 or N-terminal or C-terminal are added with six Histidines, the 3rd renaturation solution comprising glycine, GSH, GSSG is first used in described renaturation step, re-use and comprise glycine but the first renaturation solution not containing GSH, GSSG, finally use the 3rd renaturation solution containing glycine, GSH, GSSG, wherein said first, second, and third renaturation solution is also containing Tris-HCl, glycerine and EDTA.
In the method preparing single-chain antibody of the present invention, can carry out codon optimized for the aminoacid sequence of coding single-chain antibody of the present invention, thus obtaining the goal gene of antibody of the present invention, namely described goal gene has the nucleotide sequence of above-mentioned nucleic acid molecule of the present invention.In one embodiment, the sequence of described goal gene is made up of the nucleotide coding sequence of nucleotide sequence shown in SEQ ID NO:4 and SEQ ID NO:5 or its variant sequence thereof and connection peptides, and described variant sequence thereof is the sequence with one or more nucleotide subsitution, disappearance or interpolation.In a preferred embodiment, the sequence of described goal gene is as shown in SEQ ID NO:6 or SEQ ID NO:30 or for holding the sequence of the nucleotide sequence being connected with coding hexahistidine tag in their 5 ' or 3 '.
In a preferred embodiment of preparation method of the present invention, use the codon of prokaryotic organism preference to carry out described codon optimized, more preferably use the codon of intestinal bacteria preference.
In an embodiment of the inventive method, described goal gene is by chemical synthesis process or utilize PCR synthesis method such as Overlap extension PCR (SOE-PCR) method to obtain.
When utilizing SOE-PCR method to synthesize goal gene, goal gene can be divided into multiple fragment, carries out taking turns amplification (such as, be less than or equal to 5 and take turns amplification) more, and splices the fragment products of amplification.Fragment length for splicing is preferably 300-400bp.In one embodiment, goal gene of the present invention is preferably divided into 2 fragments to increase, and carries out 1 splicing.
In an embodiment of the inventive method, but the carrier of described expression vector plasmid vector or virus vector, Animal Transgenic or universal support.Preferably, plasmid vector is used, the pET serial carrier that such as temperature inducible prokaryotic expression carrier pBV220 or other prokaryotic expression carriers induce as IPTG.
Host for expressing goal gene in the inventive method comprises the cell of animal or plant, bacterium or yeast; They also can be genetically modified hosts.In a preferred embodiment of the invention, described method uses prokaryotic cell prokaryocyte host expresses goal gene, and more preferably, the host carrying out expressing is intestinal bacteria.
Hereinbefore single-chain antibody can be used according to the present invention, the nucleic acid of this antibody of encoding, detect rabies virus containing the carrier of this nucleic acid or host cell, or prevention or treatment rabies, therefore they can be used for preparing a kind of medicine to snibject, or for the preparation of a kind of test kit detecting rabies virus.In an embodiment of purposes of the present invention, preferably there is the single-chain antibody of the sequence as shown in SEQ IDNO:3 or SEQ ID NO:29 for prevention or treatment rabies virus infection disease.In another embodiment, preferably have the sequence as shown in SEQ ID NO:6 or 30 gene or containing the carrier of this gene or host cell for prevention or treatment rabies virus infection disease.
In another embodiment of purposes of the present invention, preferably there is the single-chain antibody of the sequence as shown in SEQ ID NO:3 or SEQ ID NO:29 for detecting rabies virus.In another embodiment, preferably have the sequence as shown in SEQ ID NO:6 or 30 gene or containing the carrier of this gene or host cell for detecting rabies virus.
Single-chain antibody structure of the present invention is simple, is easy to build, and can realize the high expression at prokaryotic system, is thus also easy to realize its large-scale industrial and produces.
Invention also demonstrates single-chain antibody of the present invention and have that avidity is high, stability better, can specifically in and the many advantages such as rabies virus.
Antibody of the present invention has significant rabies virus neutralising capacity.The gene of single-chain antibody of the present invention and this antibody of encoding can effectively be applied to rabic detection, prevention and therapy.Because antibody of the present invention is small molecules single-chain antibody, for whole immunoglobulin, its ability entering its hetero-organization (comprising central nervous system) from blood vessel strengthens, and its possibility entering central nervous system removing rabies virus is increased.
The present invention is described in detail, so that those of ordinary skill in the art can understand the present invention better by following examples.Following embodiment, only for exemplary purpose, is not intended to limit scope of the present invention.Should be understood that, except as otherwise noted, plant and instrument used in following each embodiment is the conventional equipment of this area; Except as otherwise noted, the substratum used is commercially available conventional medium, and those skilled in the art all know composition wherein and content.In order to for simplicity, likely use various general abbreviation in this article, those skilled in the art can understand its implication completely.
Embodiment
Embodiment 1: the codon optimized and synthesis of human source anti-rabies virus glycoprotein single-chain antibody Fv57 gene
1.Fv57 gene is codon optimized
According to the MAB57 antibody sequence described in Cheung et al. (seeing above), obtain the variable region of heavy chain as shown in SEQ ID NO:1 and SEQ ID NO:2 and chain variable region amino acid sequence.The nucleotide sequence of the codon of intestinal bacteria preference to this aminoacid sequence of coding is selected to be optimized.
2. utilize SOE PCR method to synthesize Humanized single chain antibody Fv57 gene
The nucleotide sequence of Humanized single chain antibody Fv57 gene (i.e. goal gene) to be synthesized as shown in SEQ ID NO:6, total length 756bp.Design 20 Oligonucleolide primers, upstream primer is containing Nco I, EcoR I, downstream primer comprises several restriction enzyme site such as Hind III, BamH I and Xho I, for by gene constructed enter dissimilar prokaryotic expression carrier, and terminator codon is established before the restriction enzyme site of downstream, primer sequence is as shown in SEQ ID NO:7-28.Wherein FF1-5, SF1-5 Oligonucleolide primers is followed successively by the primer with goal gene inphase component, FR1-5, SR1-5 Oligonucleolide primers is followed successively by the primer with goal gene complementary portion, and a rear primer and last primer have the overlap of 13 ~ 24bp, Fig. 1 is seen in the position of each primer in gene.All primer G+C content controls about 50%.This gene is divided into two sections of synthesis, takes turns pcr amplification respectively through 5, finally takes turns PCR through one again and is spliced into complete genome.
3. splicing product clone, add protein purification label and sequential analysis
The amplified production of taking turns SOE-PCR by six connects carrier T (pGEM-T Easy, Promega) transformation of E. coli (E.coli top10), little upgrading grain, clone enzyme being cut qualification result correct send order-checking, selects the clone consistent with aim sequence.The correct clone that checks order designs mutant primer, adds 6 Histidine (6 × His) labels, be convenient to the purifying of target protein at the C-terminal of gene order.Mutant primer is as follows:
HisF：5′-gactgttctgggtcaccatcatcatcatcactaagcttggatcc-3′
HisR：5′-ggatccaagcttagtgatgatgatgatggtgacccagaacagtc-3′
PCR system: 10 × reaction buffer 5 μ l, 1 μ l (5-50ng) plasmid template DNA, a pair mutant primer each 2 μ l, dNTP 1 μ l, 0.5 μ l Pfu Turbo archaeal dna polymerase (2.5U/ μ l), cumulative volume 50 μ l.
Sudden change PCR condition is: 95 DEG C of preheating 5min; 95 DEG C, 1min, 55 DEG C, 1min, 68 DEG C of 6min, totally 18 circulations; PCR reacts end, adds 1 μ l DpnI and digests 2-3 hour, get 1 μ l and transform, extract plasmid, order-checking in 50 μ l systems, selects the clone of correct sudden change.
Embodiment 2: the expression of human source anti-rabies virus glycoprotein single-chain antibody Fv57, purifying and renaturation
1. the structure of antibody gene expression vector:
By mutant clon correct for order-checking with after EcoR I and BamH I double digestion, with the Expression Vectors pBV220 (purchased from Shanghai Tiancheng Technology Co., Ltd.) through same double digestion, connect with T4 ligase enzyme, then Transformed E .coli top10, little upgrading grain, clone enzyme being cut qualification result correct send order-checking, selects the clone consistent with aim sequence.
2. in host, express goal gene: by recombinant plasmid pBV-Fv57 transformation of E. coli BL21 (DE3) competent cell correct for order-checking.Screen with the LB agar plate containing penbritin.The fresh single colony inoculation of picking is in 5ml LB substratum (containing penbritin 50 μ g/ml), and 37 DEG C of shaking culture are spent the night.Inoculate 50 μ l overnight culture next day in 5ml containing in the LB nutrient solution of penbritin.30 DEG C of shaking culture about 3 hours, to OD
600during ≈ 0.4-0.6, improve culture temperature to 42 DEG C, and establish control group, abduction delivering 5-6 hour, collected by centrifugation bacterium.The expression of electroresis appraisal target protein, the results are shown in Figure 4.
3. cultivate and amplification expressive host: by clone high for expressing quantity, amplification cultivation, by overnight culture in 1: 50 ratio be inoculated in fresh LB nutrient solution, 30 DEG C of shaking culture about 3 hours, to OD
600during ≈ 0.4-0.6, improve culture temperature to 42 DEG C, and establish control group, abduction delivering 5-6 hour, collected by centrifugation bacterium.Get the microbial culture inoculum of great expression, centrifugal 10 minutes of 6000rpm, collecting cell precipitates, and abandons supernatant.
4. object expression product separation and purification: cell precipitation is resuspended in bacterial lysate (50mMTris-HCl, 1mM EDTA, pH8.0); Ultrasonication 15min under ice bath; At 4 DEG C with the centrifugal 30min of 10000rpm; Precipitation uses 8M urea, and 100mM Tris-HCl (pH 8.0) dissolves, and stirs about 2hr.At 4 DEG C with the centrifugal 30min of 15000g, get supernatant, after the filtering with microporous membrane of 0.45 μm, carry out the affinity chromatography under Denaturing with Ni-NTA post (Invitrogen).First with 8M urea, the damping fluid balance nickel post of 100mM Tris-HCl (pH8.0), then on this damping fluid basis, add 50-500mM imidazoles carry out gradient elution, collect each gradient eluent, electrophoretic analysis purifying situation.Electrophoretic analysis the results are shown in Figure 4.
5. the antibody after pair purifying carries out renaturation: collect 300mM imidazole gradient elutriant, the capable SDS-PAGE electrophoresis of the sample that takes a morsel, estimate its protein concentration, control the concentration of recombinant protein at 200-300 μ about g/ml, with renaturation solution G+ (50mM Tris-HCl (pH=8.0), 10% (v/v) glycerine, 1% (m/v) glycine, 0.5mM EDTA, 50mM NaCl)) and renaturation solution G-(50mM Tris-HCl (pH=8.0), 10% (v/v) glycerine, 0.5mM EDTA, 50mMNaCl)) dialyse respectively.After renaturation solution is centrifugal, stay supernatant, be stored in-20 DEG C, in order to being further purified.
Embodiment 3: the specific antigens binding activities of human source anti-rabies virus glycoprotein single-chain antibody Fv57 detects
By rabies virus (aG strain, Jilin Mai Feng Bioceuticals Inc. is so kind as to give) wrap by 96 orifice plates, every hole adds 100 μ l, with rabies poison human normal immunoglobulin (HRIG, purchased from Disease Control and Prevention Center of Jilin Province) do positive control, with one with histidine-tagged unrelated protein as negative control, PBS makes blank.Close with 3%BSA-PBS, at 37 DEG C, hatch 1h.Add the antibody prepared by the embodiment 2 of PBS dilution, every hole 100 μ l, 37 DEG C of 1h.Add the anti-His-Tag antibody of HRP mark, every hole 100 μ l, hatches 1h at 37 DEG C; With TMB nitrite ion (purchased from Tian Gen biochemical technology company limited) colour developing, use H
2sO
4after termination reaction, under 450nm wavelength, measure OD value, the results are shown in Figure 5.Result shows, human antibody Fv57 can specific be combined with rabies virus, and unrelated protein can not be combined with rabies virus, shows that this antibody is the humanized antibody of specificity for rabies virus glycoprotein.
Embodiment 4: the relative affinity of human source anti-rabies virus glycoprotein single-chain antibody Fv57 measures
The relative affinity of Thiocyanate elution to Fv57 antibody is adopted to detect.With rabies virus (aG strain, Jilin Mai Feng Bioceuticals Inc. is so kind as to give) bag by 96 orifice plates, close with BSA-PBS, add humanized antibody prepared by embodiment 2, with containing different concns NH
4the PBS solution of SCN is hatched, and washes plate.Resist using the anti-His-Tag antibody of HRP mark as two.With OD
450decline 50% time corresponding NH
4the concentration of SCN, as relative affinity index, the results are shown in Figure 6, and result shows, and its relative affinity index is 1.6mol/L, shows that avidity is better.
Embodiment 5: the relatively stable Journal of Sex Research of human source anti-rabies virus glycoprotein single-chain antibody Fv57
Stability is one of most important biologic activity affecting antibody function.Jointly hatch at 37 DEG C with antibody prepared by PBS and embodiment 2.The antibody samples getting different time points is centrifugal, gets supernatant.With rabies virus (aG strain, Jilin Mai Feng Bioceuticals Inc. is so kind as to give) wrapper sheet, close with BSA-PBS, add above-mentioned sample, hatch, wash plate.Add the anti-His-Tag antibody of HRP mark, every hole 100 μ l, hatches 1h at 37 DEG C; With TMB nitrite ion (purchased from Tian Gen biochemical technology company limited) colour developing, use H
2sO
4after termination reaction, under 450nm wavelength, measure OD value, to detect the relative stability of antibody, the results are shown in Figure 7.Result shows, and Fv57 still has activity after 96 hours at 37 DEG C in PBS.
Embodiment 6: the research of human source anti-rabies virus glycoprotein single-chain antibody Fv57 Neutralization effect
Rapid fluorescence stove inhibition test (RFFIT method) is adopted to detect, standard serum (purchased from Nat'l Pharmaceutical & Biological Products Control Institute) is first through 56 DEG C of deactivations 30 minutes, sample or standard serum are the CVS virus (CVS-11 of 80% fluorescence stove with infective dose after three times of dilutions, purchased from Nat'l Pharmaceutical & Biological Products Control Institute) in 37 DEG C and (serum amount was 100 μ l in 1 hour, virus quantity is 50 μ l), every Kong Zhongzai adds 50 μ l containing 50000 bsr cells (10
6/ ml, in the DMEM containing 10% deactivation calf serum), cultivate after 24 hours, incline and nutrient solution for 37 DEG C.With containing Ca
2+, Mg
2+pBS embathe 1 time, add 80% cold acetone being chilled to-20 DEG C in advance, 50 μ l/ holes, fix 7 minutes (or room temperature 30 minutes) for-20 DEG C.Add the fluorescence antibody (40 μ l/ holes, invitrogen) of the rabies poison nucleoprotein of working concentration after slightly dry, after 37 DEG C of lucifuges hatch 60 minutes, incline and liquid, PBS embathes 2 times, 30 seconds first times, and second time 1-5 minute, inclines and liquid.Drip glycerine (one, every hole) in hole, microscopy observes pathology rate.ED50 is calculated as: the antilogarithm of [the pathology rate of 50% (50-lower than) ÷ (the pathology rate higher than 50%-pathology rate) lower than 50% × log extent of dilution+log is lower than the extent of dilution of 50% pathology rate].The unit content of sample is: the ED50 of the ED50 ÷ standard substance of the unit content × sample of standard substance.Calculate Fv57 thus to tire as 198.4IU/ml (87.4IU/mg).As shown in Figure 8, human antibody Fv57 and commercially available rabies poison serum (positive control, purchased from Disease Control and Prevention Center of Jilin Province) equally can neutralize mad dog CVS virus completely, suppress its cells infected, and suppression degree is directly proportional to the concentration of antibody fragment (being namely inversely proportional to extension rate), and negative control (unrelated protein with HIS label) is to the infection unrestraint effect of rabies virus.This illustrate prepared by rabies poison G-protein human antibody Fv57 can special in and rabies virus, stop rabies virus to the absorption of bsr cell, inhibit rabies virus to the infection of target cell, absolutely prove that this antibody has the activity of higher neutralization virus.
In addition, neutralisation (MNT method) in mouse brain is adopted to detect the antibody neutralization of Fv57, its simplified process is as follows: commercially available rabies poison serum (purchased from Disease Control and Prevention Center of Jilin Province), Fv57 antibody are mixed from the CVS virus of different extent of dilution (making 10 times of serial dilutions) respectively, hatch 1hr for 37 DEG C, getting body weight is that 11-13g kunming mice encephalocoele injects 30 μ l, each extent of dilution 6 mouse.Same extent of dilution all not add the virus liquid of antibody neutralization as contrast, is observed 14 days, and record death condition, calculates the LD50 of virus.The calculating of LD50 is according to logLD
50=log (extent of dilution higher than 50% mortality ratio)+(distance is than the logarithm of × extension rate), its middle distance is than=(mortality ratio-50 higher than 50%)/(mortality ratio higher than 50%-mortality ratio) lower than 50%.Finally calculate Fv57 can completely in and the virus of 5623 LD50; compared with commercially available rabies poison serum; can reach similar protection mouse makes it exempt from the infection of the rabies virus of lethal dose, absolutely proves that this antibody has the activity of higher neutralization virus.
The result of testing from above in vitro and in vivo can sufficient proof Fv57 antibody be all that a strain specificity is good, and the neutralizing antibody of high-affinity, its acquisition will to the rabic prevention of China, and Diagnosis and Treat provides new approach.
Embodiment 7: the transformation of human source anti-rabies virus glycoprotein single-chain antibody Fv57 structure
Amino acid (FR4 district) on the 102nd of 39th amino acids (FR2 district) of Fv57 weight chain variabl area sequence SEQ ID NO:1 and light-chain variable sequence SEQ ID NO:2 is sported halfcystine (Cys), form the disulfide linkage of an interchain, to stablize the space structure of whole Fv molecule, its stability is strengthened.Its transformation process is as follows:
39 amino acids mutant primers:
5′cgccgggtcagtgcctggagtggatggg 3′
5′cccatccactccaggcactgacccggcg 3′
102 amino acids mutant primers:
5′gttgttttcggctgcggtaccaaactgac 3′
5′gtcagtttggtaccgcagccgaaaacaac3′
Make template with pBV-Fv57 plasmid, replace the Taq enzyme in regular-PCR system to suddenly change to 39 of Fv57 and 102 amino acids with high-fidelity pfu enzyme, sported halfcystine.
PCR system: 10 × reaction buffer 5 μ l, 1 μ l (5-50ng) plasmid template DNA, a pair each 2 μ l, dNTP1 μ l of mutant primer, 0.5 μ l of Pfu Turbo archaeal dna polymerase (2.5U/ μ l), cumulative volume 50 μ l.
Sudden change PCR condition is: 9 DEG C of preheating 5min; 95 DEG C, 1min, 55 DEG C, 1min, 68 DEG C of 6min, totally 18 circulations; PCR reacts end, adds 1 μ l DpnI and digests 2-3 hour, get 1 μ l and transform, extract plasmid, order-checking in 50 μ l systems, selects the clone of correct sudden change.The variant called after dsFv57 that gained is new, its expressing quantity and Fv57 are substantially consistent, express, purification process is identical with Fv57.Prepared and diluted renaturation solution (1.6M urea, 50mMTris-HCl (pH=8.0), 10% (v/v) glycerine, 1% (m/v) glycine, 0.5mM EDTA, 50mM NaCl, 1mM GSH, 0.1mM GSSG), in slow dropping sample to system, protein concentration is 10-50 μ g/ml, after 4 DEG C of reaction 48h, GSSG concentration is adjusted to 2mM, 4 DEG C of reaction 12h, this solution is loaded dialysis tubing, respectively with renaturation solution G+ (50mM Tris-HCl (pH=8.0), 10% (v/v) glycerine, 1% (m/v) glycine, 0.5mM EDTA, 50mMNaCl)) and renaturation solution G-(50mM Tris-HCl (pH=8.0), 10% (v/v) glycerine, 0.5mMEDTA, 50mM NaCl)) dialysis.After renaturation solution is centrifugal, stay supernatant, be stored in-20 DEG C, in order to being further purified.
The relative affinity of the Thiocyanate elution described in embodiment 4 to dsFv57 is utilized to detect.The results are shown in Figure 6, result shows that avidity is better, and its relative affinity index is about 2.0mol/L, and avidity is higher than Fv57.
Utilize method described in embodiment 5 to study dsFv57 relative stability, the results are shown in Figure 7.Result shows, and dsFv57 in PBS 37 DEG C, still have activity, and good stability is in Fv57 after 96 hours.
Embodiment 8: other application of human source anti-rabies virus glycoprotein neutrality genetic engineering antibody Fv57
Human source anti-rabies virus glycoprotein neutrality genetic engineering antibody Fv57 can be used for the development of Rabies Virus Detection test kit, can be used for catching or detecting rabies virus with this single-chain antibody, develop highly sensitive test kit.Wrap by 96 orifice plates with the Fv57 of suitable concn, close with BSA-PBS, add rabies virus antigen, hatch, wash plate.Add many anti-(horse serums of rabies poison, or the rabbit anteserum of the rabies poison prepared voluntarily) of HRP mark, every hole 100 μ l, hatches 1h at 37 DEG C.With TMB nitrite ion (purchased from Tian Gen biochemical technology company limited) colour developing, use H
2sO
4after termination reaction, under 450nm wavelength, measure OD value, with the concentration of detectable antigens.Using Fv57 as capture antibody, because cost is low, albumen bag can be larger by concentration, thus improve Detection of antigen scope.
Claims (27)
1. in an energy and the human source anti-rabies virus glycoprotein single-chain antibody of rabies virus, it is characterized in that, described single-chain antibody has weight chain variabl area sequence (a) as shown in SEQ ID NO:1 or its variant sequence thereof, light-chain variable sequence (b) as shown in SEQ ID NO:2 or its variant sequence thereof, and a connection peptides sequence, the variant sequence thereof of wherein said sequence (a) or (b) is the sequence being replaced into halfcystine in described sequence (a) 39 amino acids and sequence (b) 102 amino acids.
2. the single-chain antibody of claim 1, it is characterized in that, the described weight chain variabl area sequence (a) of described single-chain antibody or its variant sequence thereof are connected to N-end or the C-end of described connection peptides, and described light-chain variable sequence (b) is connected to the other end of described connection peptides.
3. the single-chain antibody of claim 1 or 2, is characterized in that, described connection peptides is the sequence that length is at least 12 amino-acid residues.
4. the single-chain antibody of claim 3, is characterized in that, described connection peptides is (Gly
4ser) n, wherein n is the integer of 3-5.
5. the single-chain antibody of claim 4, wherein n is 4.
6. the single-chain antibody of claim 3, wherein said connection peptides is AKTTAPSVYPLA.
7. the single-chain antibody of aforementioned any one of claim, it is characterized in that, the aminoacid sequence of described single-chain antibody as shown in SEQ ID NO:3 or SEQ ID NO:29, or is connected with the sequence of hexahistidine tag on the end of SEQ ID NO:3 or SEQ ID NO:29.
8. the nucleic acid of the aforementioned any one of claim of coding.
9. the nucleic acid of claim 8, it is characterized in that, described nucleic acid has weight chain variable region nucleotide sequence (i) as shown in SEQ IDNO:4 or its variant sequence thereof, light chain variable region nucleotide sequence (ii) as shown in SEQID NO:5 or its variant sequence thereof, and the nucleotide sequence of coding connection peptides, wherein, the variant sequence thereof of described sequence (i) or (ii) is that described sequence (i) 115-117 position Nucleotide replaces with 314-316 position Nucleotide in TGT/C and sequence (ii) and replaces with the sequence of TGT/C.
10. the nucleic acid of claim 9, is characterized in that, described connection peptides is the connection peptides described in claim 3-6.
The nucleic acid of 11. claims 8 or 9, it is characterized in that, the sequence of described nucleic acid as shown in SEQ ID NO:6 or SEQ ID NO:30, or for shown in SEQ ID NO:6 or SEQ ID NO:30 the end of sequence be connected with the sequence of nucleotide sequence of coding hexahistidine tag.
12. 1 kinds of carriers, is characterized in that, described carrier comprises the nucleic acid of any one of claim 8-11.
13. 1 kinds of host cells, is characterized in that, described cell comprises the nucleic acid of any one of claim 8-11.
The host cell of 14. claims 13, is characterized in that, described host cell is Bacillus coli cells.
15. 1 kinds of compositions, is characterized in that, described composition comprises the host cell of the single-chain antibody of any one of claim 1-7, the nucleic acid of any one of claim 8-11, the carrier of claim 12 or claim 13 or 14.
16. 1 kinds of methods preparing the single-chain antibody of any one of claim 1-7, it is characterized in that, described method comprises:
The goal gene of the single-chain antibody of any one of coding claim 1-6 is provided,
This goal gene is built up in expression vector,
Described goal gene is expressed in host; With
Results expression product, thus obtain described single-chain antibody.
The method of 17. claims 16, is characterized in that, the nucleotides sequence of described goal gene is classified as the nucleotide sequence of the nucleic acid of any one of claim 8-11.
The method of 18. claims 16, is characterized in that, described expression vector is plasmid vector, virus vector, the carrier of Animal Transgenic or universal support.
The method of 19. claims 16, is characterized in that, described host cell is the cell of animal, plant, bacterium or yeast.
The method of 20. claims 16, is characterized in that, described host cell is colibacillary cell.
The method of 21. any one of claim 16-20, is characterized in that, described method also comprises single-chain antibody described in separation and purification.
The method of 22. claims 21, is characterized in that, described separation and purification comprises:
A () is by host cell lysis and collect split product;
(b) by split product purifying under Denaturing, and
C () is by purified product renaturation.
The method of 23. claims 22, is characterized in that, optionally comprises hexahistidine tag in the aminoacid sequence of described purified product.
The method of 24. claims 22 or 23, it is characterized in that, aminoacid sequence sequence or the end for SEQ ID NO:3 as shown in SEQ ID NO:3 of described single-chain antibody are connected with the sequence of six Histidines, and described (c) step comprises the first renaturation solution using and contain glycine and the second renaturation solution not containing glycine.
The method of 25. claims 22 or 23, it is characterized in that, aminoacid sequence sequence or the end for SEQ ID NO:29 as shown in SEQ ID NO:29 of described single-chain antibody are connected with the sequence of six Histidines, and are included in the 3rd renaturation solution used containing using before the first renaturation solution of glycine and the second renaturation solution not containing glycine containing GSH and GSSG in described (c) step.
The host cell of the single-chain antibody of 26. any one of claim 1-7, the nucleic acid of any one of claim 8-11, the carrier of claim 12 or claim 13 or 14 purposes in the medicine of preparation prevention or treatment rabies virus infection disease.
The host cell of the single-chain antibody of 27. any one of claim 1-7, the nucleic acid of any one of claim 8-11, the carrier of claim 12 or claim 13 or 14 is preparing the purposes in Rabies Virus Detection test kit.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110040898.1A CN102643343B (en) | 2011-02-17 | 2011-02-17 | Human derived anti-rabies virus glycoprotein gene engineering antibody and preparation and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110040898.1A CN102643343B (en) | 2011-02-17 | 2011-02-17 | Human derived anti-rabies virus glycoprotein gene engineering antibody and preparation and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102643343A CN102643343A (en) | 2012-08-22 |
| CN102643343B true CN102643343B (en) | 2015-03-25 |
Family
ID=46656446
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110040898.1A Active CN102643343B (en) | 2011-02-17 | 2011-02-17 | Human derived anti-rabies virus glycoprotein gene engineering antibody and preparation and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102643343B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103998059B (en) * | 2011-09-30 | 2016-01-20 | 赛特瑞恩股份有限公司 | For in and the binding molecule of rabies virus |
| CN104628851B (en) * | 2015-02-12 | 2019-07-30 | 长春百克生物科技股份公司 | A kind of genetic engineering antibody, preparation method and the application of rabies poison |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101550189A (en) * | 2008-04-25 | 2009-10-07 | 中国人民解放军军事医学科学院卫生学环境医学研究所 | Anthropogenic antivirulin glycosidoprotein neutralizing genetic engineering antibody RD9 and preparation and application thereof |
-
2011
- 2011-02-17 CN CN201110040898.1A patent/CN102643343B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101550189A (en) * | 2008-04-25 | 2009-10-07 | 中国人民解放军军事医学科学院卫生学环境医学研究所 | Anthropogenic antivirulin glycosidoprotein neutralizing genetic engineering antibody RD9 and preparation and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| A Recombinant Human Fab Expressed in Escherichia coli Neutralizes Rabies Virus;SAU C. CHEUNG et al.;《JOURNAL OF VIROLOGY》;19921231;第66卷(第11期);6716-6718页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102643343A (en) | 2012-08-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20220372113A1 (en) | Nano antibody for neutralizing toxicity of sars-cov-2 and preparation method and application thereof | |
| CN111718411A (en) | Monoclonal antibody 1F2 for resisting SARS-CoV-2 | |
| Duan et al. | A novel disulfide-stabilized single-chain variable antibody fragment against rabies virus G protein with enhanced in vivo neutralizing potency | |
| CN108503698B (en) | Immunogenicity of Acinetobacter baumannii Ata protein | |
| CN102643343B (en) | Human derived anti-rabies virus glycoprotein gene engineering antibody and preparation and application thereof | |
| Wang et al. | Expression, purification and characterization of a human single-chain Fv antibody fragment fused with the Fc of an IgG1 targeting a rabies antigen in Pichia pastoris | |
| NL2038235A (en) | Preparation and application of universal vaccine against severe acute respiratory syndrome coronavirus-2 mutants for c-terminal receptor binding domain | |
| CN113045662B (en) | Nano antibody for specifically recognizing PD-L1 and application thereof | |
| CN114316036A (en) | O-type foot-and-mouth disease virus structural protein VP1 broad-spectrum neutralizing antibody, preparation method and application thereof | |
| CN116474081B (en) | Acinetobacter baumannii vaccine and preparation method thereof | |
| CN101386648B (en) | Neutralizing monoclonal antibody for resisting botulinum neurotoxin type B, preparation method and application thereof | |
| Li et al. | A novel variable antibody fragment dimerized by leucine zippers with enhanced neutralizing potency against rabies virus G protein compared to its corresponding single-chain variable antibody fragment | |
| CN103130894B (en) | Recombinant single-chain antibody G5-4ScFv of anti-human gamma delta T cell receptor (TCR) monoclonal antibody and encoding gene and application thereof | |
| CN104628851A (en) | Genetically engineered antibody of anti-rabies virus as well as preparation method and application of genetically engineered antibody | |
| CN103848915A (en) | Preparation and application of novel anti-rabies virus glycoprotein human-derived genetically-engineered antibody | |
| CN110903385B (en) | H1N1 influenza virus antibody and preparation method and application thereof | |
| CN114316040A (en) | Fully human monoclonal antibody for resisting novel coronavirus and application thereof | |
| KR20110131159A (en) | Expression of tomato yellow leaf curl virus(tylcv)-c4 gene in escherichia coli and production of polyclonal antibody against the recombinant tylcv-c4 protein | |
| CN106349348A (en) | Preparation method of GyV7 ring virus VP3 protein | |
| CN113817051A (en) | Monoclonal antibody 1B6 for resisting SARS-CoV-2 | |
| CN109021099A (en) | A kind of nano antibody of 1 type duck hepatitis A virus of specific recognition | |
| CN104630172A (en) | Mutant of schistosoma japonicum glutathione-S-transferase and application thereof | |
| CN110759975B (en) | Polypeptide, antibody with strong ADCC effect and application | |
| CN108864273A (en) | A kind of simulation human antibiotic peptide and preparation method thereof | |
| CN113862227B (en) | Hybridoma cell strain resisting intermediate pallas pit viper GintexinA PLA2 toxin, antibody and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |