CN109021099A - A kind of nano antibody of 1 type duck hepatitis A virus of specific recognition - Google Patents

A kind of nano antibody of 1 type duck hepatitis A virus of specific recognition Download PDF

Info

Publication number
CN109021099A
CN109021099A CN201810945485.XA CN201810945485A CN109021099A CN 109021099 A CN109021099 A CN 109021099A CN 201810945485 A CN201810945485 A CN 201810945485A CN 109021099 A CN109021099 A CN 109021099A
Authority
CN
China
Prior art keywords
nano antibody
antibody
seq
nano
virus
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201810945485.XA
Other languages
Chinese (zh)
Other versions
CN109021099B (en
Inventor
姜世金
薛文湘
张瑞华
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shandong Agricultural University
Original Assignee
Shandong Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shandong Agricultural University filed Critical Shandong Agricultural University
Priority to CN201810945485.XA priority Critical patent/CN109021099B/en
Publication of CN109021099A publication Critical patent/CN109021099A/en
Application granted granted Critical
Publication of CN109021099B publication Critical patent/CN109021099B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/08—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from RNA viruses
    • C07K16/1009—Picornaviridae, e.g. hepatitis A virus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56983—Viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565—Complementarity determining region [CDR]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/569—Single domain, e.g. dAb, sdAb, VHH, VNAR or nanobody®
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/005—Assays involving biological materials from specific organisms or of a specific nature from viruses
    • G01N2333/08—RNA viruses
    • G01N2333/085—Picornaviridae, e.g. coxsackie virus, echovirus, enterovirus

Abstract

The invention discloses a kind of nano antibodies of 1 type duck hepatitis A virus of specific recognition, and the amino acid sequence of the nano antibody is as shown in SEQ ID NO.1.The molecular mass of nano antibody of the invention is small, stability is strong, antigen binding performance is excellent, easy expression, provides the foundation for the detection of 1 type duck hepatitis A virus and the exploitation of therapeutic agent.It using nano antibody provided by the present invention as precursor, is transformed by random or site-directed mutagenesis technique, the better mutant such as compatibility, specificity, stability can be obtained, be further used for medicine, industry, agriculture protein or polypeptide for developing.

Description

A kind of nano antibody of 1 type duck hepatitis A virus of specific recognition
Technical field
The present invention relates to technical field of molecular biology, and in particular to a kind of 1 type duck hepatitis A virus of specific recognition is received Meter Kang Ti.
Background technique
1 type duck hepatitis A virus (DHAV-1) is the single strand plus RNA virus based on a kind of 3 week old of infection or less duckling, is belonged to In Picornaviridae (Picornaviridae).Virus full length 7.8kb or so includes 5 ' noncoding region (untranslated Region, UTR), big an open reading frame (open-reading frame, ORF) and 3 ' UTR (3 ' untranslated ) and poly (A) tail regions.RNA guidance one intact proteins of synthesis of virus, referred to as polyprotein.Polyprotein is being translated Small fragment albumen, respectively structural proteins (VP1, VP0, VP3) are constantly resolved by the protease hydrolytic that itself is encoded in the process With non-structural protein (2A1,2A2,2A3,2B, 2C, 3A, 3B, 3C, 3D).Wherein, VP1 full length gene 714bp encodes 238 aa Polypeptide.In picornavirus, VP1 albumen is main host's protected protein, contains main antigen site and has master The specificity wanted neutralizes site, can induce body and generates protective neutralizing antibody.Therefore, VP1 albumen is that DHAV-1 exploitation is new Type detection method and first choice as antiviral drugs target spot.
Currently, the detection technique of DHAV-1 mainly has enzyme-linked immunosorbent assay (ELISA), serum neutralization test, SPA association With agglutination test etc., antibody used in detection is monoclonal antibody and polyclonal antibody mostly, but monoclonal antibody is ground Hair and production process and its cumbersome and complicated；Polyclonal antibody limited source, this makes testing cost higher, is not suitable for base Hospital carries out fast inspection by extensive primary dcreening operation and bed.
Nano antibody technology is biomedical science man on the basis of conventional antibodies, with Protocols in Molecular Biology knot The antibody engineering revolution that the concept of nanoparticle science carries out is closed, thus the newest and the smallest antibody molecule developed.1993 The reports such as year Hamers, camel body is interior, and there is the heavy chain antibody of natural deletions light chain and heavy chain constant region 1 (CH1), Ke Longqi Variable region obtains the single domain antibody being only made of a heavy chain variable region, referred to as VHH (variable domain of heavy Chain of heavy-chain antibody), it is renamed as " nano antibody " (nanobody, Nb).With routine Antibody is compared, and nano antibody has many advantages, such as that acid and alkali-resistance, high temperature resistant, specificity is high, molecular weight is small and can be mass-produced.Nanometer Antibody use can be very big reduce cost, have a extensive future.But at present also not about 1 type duck hepatitis A of specific recognition The report of the nano antibody of virus.
Summary of the invention
For the above-mentioned prior art, the object of the present invention is to provide a kind of nanometers of 1 type duck hepatitis A virus of specific recognition Antibody, the molecular mass of the nano antibody is small, stability is strong, antigen binding performance is excellent, easy expression, is 1 type duck hepatitis A virus Detection and the exploitation of therapeutic agent provide the foundation.
To achieve the above object, the present invention adopts the following technical scheme:
The first aspect of the present invention, provides a kind of nano antibody of 1 type duck hepatitis A virus of specific recognition, and the nanometer is anti- Body includes complementary determining region；
The complementary determining region is made of CDR1, CDR2 and CDR3；
The amino acid sequence of the CDR1 is the 26-38 amino acids of SEQ ID NO.1 in sequence table；
The amino acid sequence of the CDR2 is the 53-72 amino acids of SEQ ID NO.1 in sequence table；
The amino acid sequence of the CDR3 is the 103-111 amino acids of SEQ ID NO.1 in sequence table.
Further, above-mentioned nano antibody is made of the complementary determining region and framework region；The amino of the nano antibody Acid sequence is as shown in SEQ ID NO.1.
The second aspect of the present invention, provides the gene for encoding above-mentioned nano antibody, and the nucleotides sequence of the gene is classified as down 1) or 2) it states:
1) nucleotide sequence shown in SEQ ID NO.2；
2) there is 75% or 75% or more identity with the nucleotide sequence 1) limited, and encodes the core of the nano antibody Nucleotide sequence.
Those skilled in the art can adopt by known method, such as the method for directed evolution and point mutation, to the present invention SEQ ID NO.2 shown in nucleotide sequence be mutated, property (water solubility, stability, affinity and spy can be obtained Opposite sex etc.) quite or better mutant.Those by manually modified, have with shown in SEQ ID NO.2 of the present invention The amino acid of 75% or 75% or more identity of nucleotide sequence, as long as encoding the nano antibody and there is equivalent or similar work Property, it is derived from nucleotide sequence of the invention and to be equal to sequence of the invention.
Term " identity " used herein refers to the sequence similarity with native nucleotide sequence.Identity can use calculating Machine software is evaluated.
Above-mentioned 75% or 75% or more identity, can be same for 75%, 80%, 85%, 90% or 95% or higher Property.
The third aspect of the present invention provides biomaterial relevant to above-mentioned nano antibody, for a) to any one of d):
A) carrier comprising nucleotide sequence shown in SEQ ID NO.2；
B) expression cassette comprising nucleotide sequence shown in SEQ ID NO.2；
C) contain the recombinant microorganism of a) carrier；
D) contain the transgenetic animal cell system of a) carrier.
In above-mentioned biomaterial, the carrier can be plasmid, bacteriophage or viral vectors.
In above-mentioned biomaterial, the expression cassette is to refer to express nano antibody of the invention in host cell DNA, the DNA not only may include the promoter of promotor gene transcription, may also include terminator and enhancer sequence.
In above-mentioned biomaterial, the transgenetic animal cell system does not include propagation material.
The fourth aspect of the present invention provides the derivative antibody of above-mentioned nano antibody, for a) to any one of c):
A) contain the single-chain antibody of the nano antibody；
B) contain the fusion antibody of the nano antibody；
C) contain the coupled antibody of the nano antibody.
The fifth aspect of the present invention provides the preparation method of the nano antibody, including that will encode the nano antibody Nucleic acid molecules import the transgenic cell that recipient cell obtains expressing the nano antibody, cultivate the transgenic cell, obtain The nano antibody.
In above-mentioned preparation method, the nucleotide sequence such as SEQ ID NO.2 institute of the nucleic acid molecules of the nano antibody is encoded Show.
The sixth aspect of the present invention provides above-mentioned nano antibody in the reagent or reagent of preparation 1 type duck hepatitis A virus of detection Application in box.
Further, the present invention also provides a kind of methods for detecting DHAV-1, containing of the present invention for DHAV-1's Single domain heavy chain antibody.Energy based on the single domain heavy chain antibody provided by the invention for DHAV-1 and DHAV-1 specific binding Power establishes the detection method of DHAV-1.Wherein, preferred method includes enzyme linked immunosorbent assay (Enzyme-linked Immunosorbent assay, ELISA), fluorescent immune method (Fluoroimmunoassay, FIA), immuno-chip method is affine Chromatography and immunochromatographic method etc..
The seventh aspect of the present invention provides above-mentioned nano antibody, biomaterial or above-mentioned relevant to above-mentioned nano antibody Application of the derivative antibody of nano antibody in the drug of preparation prevention or treatment 1 type duck hepatitis A virus infection.
The eighth aspect of the present invention, provides a kind of for detecting the kit of 1 type duck hepatitis A virus, wraps in the kit Derivative antibody containing above-mentioned nano antibody or above-mentioned nano antibody.
Beneficial effects of the present invention:
Nano antibody provided by the present invention, due to making the nanometer with unique CDR1, CDR2 and CDR3 region sequence Antibody has special identification and binding ability to 1 type duck hepatitis A virus, and does not have with other non-specific cross-reaction albumen There is reaction.Nano antibody of the invention can be applied to the research and development of 1 type duck hepatitis A virus detection reagent and the system of antiviral drugs It is standby.Using nano antibody provided by the present invention as precursor, it is transformed by random or site-directed mutagenesis technique, it can be acquired Matter (compatibility, specificity, stability etc.) better mutant is further used for medicine, industry, agriculture albumen for developing Matter or polypeptide.
Specific embodiment
It is noted that following detailed description is all illustrative, it is intended to provide further instruction to the application.Unless another It indicates, all technical and scientific terms used herein has usual with the application person of an ordinary skill in the technical field The identical meanings of understanding.
Term explanation:
Structural domain: the fundamental structural unit of tertiary protein structure usually has the function of certain.
IMGT number: one of IMGT database (The International ImMunoGeneTics Datbase) Normalised antibody amino acids sequence method for numbering serial.Specific method for numbering serial can with bibliography (Ehrenman, F., Q.Kaas, et.al. (2010) .IMGT/3D structure-DB and IMGT/DomainGapAlign:a databaseand a tool for immunoglobulins or antibodies,T cell receptors,MHC, IgSF and MhcSF.Nucleic Acids Res38(Database issue):D301-307.Lefranc,M.P., C.Pommie,et al.(2003).IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Igsuperfamily V-like domains Dev comp Immunol 27 (1): 55-77.) in description.
Codon (codon): also known as three disjunctor codons (triplet code), refer to the core corresponding to certain amino acid Thuja acid triplet.The position of polypeptide chain in this kind of amino acid insertion growth is determined during translation.
As background technology part is introduced, nano antibody has that acid and alkali-resistance, high temperature resistant, specificity is high, molecular weight is small The advantages that with can be mass-produced.Nano antibody use can be very big reduce cost, have a extensive future.But at present also not There is the report for the nano antibody for capableing of 1 type duck hepatitis A virus of specific recognition.Based on this, the object of the present invention is to provide a kind of needles To the nano antibody (also referred to as single domain heavy chain antibody) of DHAV-1.
Nano antibody of the invention has amino acid sequence shown in SEQ ID NO.1.The IMGT of its amino acid sequence is compiled Number and structural domain division include four framework regions (Framework region, FR) and three complementary determining regions (Complementarity determining region,CDR)。
The important feature of nano antibody first is that have longer antigen complementary determining region (CDR), can in conjunction with it is some often The epitope that rule antibody can not approach.Nano antibody of the invention, due to the unique area CDR1, CDR2 and CDR3 sequence Column make the nano antibody have special identification and binding ability to 1 type duck hepatitis A virus, and intersect with other non-specificity Proteins C reactive does not react.
Amino acid sequence (SEQ ID NO.1) provided by the present invention can be used as precursor, pass through random or rite-directed mutagenesis Technology is transformed, and can obtain property (water solubility, stability, affinity and specificity etc.) better mutant, this is prominent Variant can be specifically bound with DHAV-1.
The nucleic acid molecules for encoding the nano antibody can obtain the specific of the nucleic acid molecules by genetic codon at any time Sequence.In a preferred embodiment of the present invention, the nucleotide sequence of the nucleic acid molecules is as shown in SEQ ID NO.2.
Nucleotide sequence provided by the present invention or at least partly sequence can carry out table by suitable expression system Up to obtain corresponding protein or polypeptide.These expression systems include bacterium, saccharomycete, filamentous fungi, zooblast, insect Cell, plant cell or Cell free expression system.
In order to enable those skilled in the art can clearly understand the technical solution of the application, below with reference to tool The technical solution of the application is described in detail in the embodiment of body.
Test material used in the embodiment of the present invention is the test material of this field routine, can pass through commercial channel It is commercially available.The experimental method that detailed conditions are not specified is said according to conventional methods or according to operation proposed by supplier What bright book carried out.
Embodiment 1: the structure of anti-DHAV-1 single domain heavy chain antibody (being directed to the single domain heavy chain antibody of DHAV-1) non-immune libraries It builds
3ml DHAV-1 inactivated vaccine is taken to carry out subcutaneous multi-point injection to two-humped camel immune.Booster immunization 3ml DHAV-1 goes out Live vaccine is spaced 2 weeks and carries out, and venous blood sampling after being immunized 7 days every time measures serum titer using indirect elisa method, selects serum The highest sample of potency separates lymphocyte, extracts RNA.
The extraction of RNA is carried out referring to TAKARA company RNAiso reagent specification.Using RNA as template, oligo dT is to draw Object synthesizes the first chain of cDNA referring to TAKARA company reverse transcriptase specification.
Using PrimeSTAR high-fidelity DNA polymerase, the variable region encoding gene for obtaining heavy chain antibody through nest-type PRC (is adopted 1) primer is shown in Table.First round PCR expands cDNA respectively with primer CALL001 and CALL002, and reaction condition is 98 DEG C, 10s, 55 DEG C, 20s, 72 DEG C, 1min, 20 circulations, 98 DEG C, 10s, 68 DEG C, 1min, 72 DEG C extension 10min.
By 1.2% agarose gel electrophoresis of first round PCR product, the DNA fragmentation of 600bp~750bp is recycled, as The template of second wheel PCR, is expanded with primer VHH-FOR and VHH-REV respectively, and reaction condition is 98 DEG C, 10s, and 50 DEG C, 20s, 72 DEG C, 40s, 5 circulations, 98 DEG C, 10s, 68 DEG C, 40s, 30 circulations, 72 DEG C of extension 10min.It recycles and tries through DNA fragmentation Agent box recycles, is quantitative, saves backup in -20 DEG C.Phasmid pCANTAB 5E and pcr amplification product are used into Not I, Pst respectively I double digestion, with 1: 3 molar ratio, at 16 DEG C, connects overnight after Ago-Gel recycling, quantitative.
Table 1: primer used in library construction and identification
Note: the sequence of underscore label is restriction enzyme site；R=A/G.
Connection product is dissolved in 10 μ L sterile waters after ethanol precipitation, carries out Electroporation Transformation e. coli tg1 in ten times. Bacterium solution doubling dilution after taking 10 μ L electric shock, culture, is coated with 2 × YT of ampicillin culture plate, calculates storage capacity.Rest part is complete Portion is coated on 24cm × 24cm ampicillin 2 × YT culture plate, 37 DEG C, is inverted 13~16h of culture.It is cultivated with 10mL, 2 × YT After base scrapes the lawn on culture plate, 20~30% glycerol of final concentration is added, packing, -80 DEG C save backup.
According to the storage capacity of calculating as a result, inoculation 10 times of storage capacities living cells in 20mL 2 × YT (contain 2% glucose, 100 μ g/mL ampicillins), 37 DEG C, 200r/min is cultivated to OD600 up to 0.5, and helper phage is added by infection multiplicity 20: 1 Body, 37 DEG C, 200r/min, 60min.Culture is centrifuged, (contains 100 μ g/mL ampicillins and 50 μ g/ with 2 × YT of 50mL ML kanamycins) precipitating is resuspended, 37 DEG C, after 200r/min is incubated overnight, 5 × PEG/NaCl is added in 8000rpm centrifuging and taking supernatant Solution places 1.5h or 4 DEG C overnight on ice, and 8000rpm is centrifuged 30min, and resuspension is deposited in the phosphate buffer containing 10% glycerol (PBS, 0.01M, pH 7.4) takes 10 μ L to measure titre to get anti-DHAV-1 single domain heavy chain antibody non-immune libraries are arrived, remaining packing It is saved backup in -80 DEG C.
Embodiment 2: the elutriation and identification of anti-DHAV-1 single domain heavy chain antibody
Using method elutriation from the 1 anti-DHAV-1 single domain heavy chain antibody non-immune libraries of gained of embodiment of the affine elutriation of solid phase For the single domain heavy chain antibody of DHAV-1.It is added the 100 μ L diluted DHAV-1 VP1 albumen of PBS into each enzyme mark hole, 4 DEG C, overnight, the peridium concentration of every wheel elutriation is respectively 100,80,40 μ g/mL to coating；Suction coating buffer, PBS board-washing 5 times, every hole 200 μ L, 5% skimmed milk power is added, 37 DEG C, closes 2h；PBS board-washing 5 times, be added 100 μ L phage antibody libraries (containing about 5 × 1010CFU), 37 DEG C, it is incubated for 2h；Unbonded bacteriophage is sucked out, with PBST (containing 0.5%Tween-20) board-washing 3-5 times (by wheel Increase by 5 times), then with PBS board-washing 15-25 times；Enzyme mark hole is adsorbed on the elution of 100 μ L eluents (glycine-HCI, pH 2.2) In bacteriophage, neutralize eluate with 35 μ L Tris-HCl (1mol/L, pH 8.0), take 10 μ L for titer determination, remaining Next round elutriation is used for after the amplification of 125 μ L eluates.
After three-wheel elutriation, is rescued, respectively obtained using monoclonal of the helper phage M13K07 to random picking Show antibody variable region phage particle, then with indirect phage-ELISA measurement phage particle combination activity and specifically Property, experiment setting control, specific load procedure is shown in Table 2.
Table 2: indirect phage-ELISA is loaded table
It send biotechnology service company to carry out sequencing ELISA positive colony, obtains the DNA sequence dna of Insert Fragment, It encodes the single domain heavy chain antibody for being directed to DHAV-1.
Embodiment 3: the scale preparation of anti-DHAV-1 single domain heavy chain antibody
It encodes the acquisition of the DNA fragmentation of anti-DHAV-1 single domain heavy chain antibody: being polymerize using TAKARA company EX Taq DNA Enzyme, the variable region encoding gene (primer of use is shown in Table 3) of heavy chain antibody is obtained through PCR, and agarose gel electrophoresis recycling is anti- DHAV-1 single domain heavy chain antibody genes.
Table 3: amplification antibody heavy chain variable region primer
Primer Primer sequence (5 ' -3 ') Sequence number
VHH-F GGGGGATCCCAGGTCCAACTGCAGGAGTCT SEQ ID NO.8
VHH-R GCCAAGCTTTGAGGAGACGGTGACCTGGG SEQ ID NO.9
Note: the sequence of underscore label is restriction enzyme site.
Obtained anti-DHAV-1 single domain heavy chain antibody genes segment is cloned into expression vector pET28as, and (N-terminal fusion has 6XHis label and SUMO label), it is identified through PCR and digestion, the Escherichia coli table of anti-DHAV-1 single domain heavy chain antibody is completed in building Up to plasmid.
Expression plasmid is converted to Escherichia coli Rosetta (DE3), picking single colonie carries out inducing expression.By single colonie It accesses in 5mL LB-A (100 μ g/mL ampicillin of Luria-Bertani broth with) fluid nutrient medium, 37 DEG C, 220r/min shaken cultivation 12h；It is transferred in 50mL LB-A fluid nutrient medium with the inoculum concentration of 1% culture volume, 37 DEG C, 220r/min shaken cultivation to OD600 reach 0.5 (about needing 3~3.5h), be added the IPTG of final concentration 0.1mM, 30 DEG C, 200r/min Fiber differentiation.
Induced cultures 8000r/min centrifugation is added 25mL phosphate buffer (pH 7.4) in cell precipitation and mixes, 8000r/min centrifugation, removes supernatant, retains cell precipitation；15mL same buffer is added in cell precipitation, mixes, surpasses on ice Sound wave clasmatosis processing, ultrasonication condition are 200W, are crushed 2s, interval 5s, totally 250 circulations, broken to cell at 4 DEG C The 8000r/min that minces is centrifuged 15min, and supernatant is taken to carry out affinitive layer purification and SDS-PAGE electrophoretic analysis, or adds in supernatant Enter the glycerol of final concentration 20%, mix, is stored in -20 DEG C for use.
By optimizing inducing expression condition (such as host strain, expression vector, Fiber differentiation time, temperature and IPTG concentration Deng), it can be further improved destination protein (single domain heavy chain antibody) expression quantity, largely to prepare anti-DHAV-1 single domain heavy chain antibody Provide approach.
Embodiment 4: the reactivity test of anti-DHAV-1 single domain heavy chain antibody
It is measured by the reactivity that ELISA tests confrontation DHAV-1 single domain heavy chain antibody, experimental method is as follows:
The 100 μ L diluted DHAV-1 VP1 albumen of PBS is added into each enzyme mark hole, 4 DEG C, overnight, packet is sucked out in coating By liquid, PBS board-washing 5 times, 200 μ L, 5% skimmed milk power is added in every hole, 37 DEG C, closes 2h；PBS board-washing 5 times, it is anti-that 100 μ L are added DHAV-1 single domain heavy chain antibody (2000 μ g/ml, 1000 μ g/ml, 500 μ g/ml, 250 μ g/ml, 125 μ g/ml), is incubated for by 37 DEG C 2h；Unbonded anti-DHAV-1 single domain heavy chain antibody is sucked out, with PBST (containing 0.5%Tween-20) board-washing 3-5 times, 100 μ are added The anti-His label mouse monoclonal antibody of L, is incubated for 1.5h by 37 DEG C；With PBST (containing 0.5%Tween-20) board-washing 3-5 times, it is added 100 μ L Goat anti-mouse IgG (HRP), is incubated for 1.5h by 37 DEG C；With PBST (containing 0.5%Tween-20) board-washing 3-5 times, often 100 μ L TMB developing solutions are added in hole, and develop the color 15min, and 100 μ L 2M H are added in every hole2SO4Reaction is terminated, OD450 is measured.
The results show that the maximum dilution concentration that anti-DHAV-1 single domain heavy chain resists can reach 250 μ g/ml, have preferable anti- Ying Xing.
Embodiment 5: the specific test of anti-DHAV-1 single domain heavy chain antibody
It is measured by the specificity that ELISA tests confrontation DHAV-1 single domain heavy chain antibody, experimental method is as follows:
This experiment chooses DHAV-1 VP0 and VP3 as reference protein and carries out spy except coating DHAV-1 VP1 target protein Opposite sex experiment.
100 μ L diluted DHAV-1VP1, VP0, VP3 albumen of PBS is added into each enzyme mark hole, 4 DEG C, coating is stayed overnight, Coating buffer is sucked out, PBS board-washing 5 times, 200 μ L, 5% skimmed milk power is added in every hole, 37 DEG C, closes 2h；It PBS board-washing 5 times, is added The anti-DHAV-1 single domain heavy chain antibody of 100 μ L, is incubated for 2h by 37 DEG C；Unbonded anti-DHAV-1 single domain heavy chain antibody is sucked out, uses PBST (containing 0.5%Tween-20) board-washing 3-5 times is added the anti-His label mouse monoclonal antibody of 100 μ L, 37 DEG C, is incubated for 1.5h；With PBST (containing 0.5%Tween-20) board-washing 3-5 times is added 100 μ L Goat anti-mouse IgG (HRP), 37 DEG C, is incubated for 1.5h；With PBST (containing 0.5%Tween-20) board-washing 3-5 times, 100 μ L TMB developing solutions are added in every hole, and develop the color 15min, every hole 100 μ L 2M H are added2SO4Reaction is terminated, OD450 is measured.
The results show that the anti-single-minded effective identification DHAV-1VP1 of DHAV-1 single domain heavy chain antibody, and do not occur with other albumen Reaction.
The foregoing is merely preferred embodiment of the present application, are not intended to limit this application, for the skill of this field For art personnel, various changes and changes are possible in this application.Within the spirit and principles of this application, made any to repair Change, equivalent replacement, improvement etc., should be included within the scope of protection of this application.
SEQUENCE LISTING
<110>Shandong Agricultural University
<120>a kind of nano antibody of 1 type duck hepatitis A virus of specific recognition
<130> 2018
<160> 9
<170> PatentIn version 3.5
<210> 1
<211> 122
<212> PRT
<213>nano antibody of 1 type duck hepatitis A virus of specific recognition
<400> 1
Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Ser Val Gln Ala Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ser Ile Ser Glu Tyr Thr Tyr Arg Gly Phe
20 25 30
Arg Asn Leu Cys Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg
35 40 45
Glu Trp Val Ala Ala Ile Ala Thr Gly Ala Thr Gly Ala Asp Tyr Thr
50 55 60
Tyr Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn
65 70 75 80
Ala Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu Asp
85 90 95
Thr Ala Val Tyr Tyr Cys Ala Thr Gly Cys Thr Arg His Arg Val Trp
100 105 110
Gly Gln Gly Thr Gln Val Thr Val Ser Ser
115 120
<210> 2
<211> 366
<212> DNA
<213>gene of nano antibody is encoded
<400> 2
caggtccaac tgcaggagtc tgggggaggc tcggtgcagg ctggaggctc tctgagactc 60
tcctgttcaa tctctgaata cacctaccga ggtttccgta acctctgcat ggggtggttc 120
cgccaggctc cagggaagga gcgcgagtgg gtcgcagcta ttgctactgg tgctactggt 180
gctgattaca catactatgc cgactccgtg aagggccgat tcaccatctc cagagacaac 240
gccaagaaca cgctgtatct acaaatgaac agcctgaaaa ctgaggacac tgccgtgtat 300
tactgcgcca cgggatgtac acggcatagg gtctggggcc aggggaccca ggtcaccgtc 360
tcctca 366
<210> 3
<211> 23
<212> DNA
<213>artificial sequence
<400> 3
gtcctggctg ctcttctaca agg 23
<210> 4
<211> 23
<212> DNA
<213>artificial sequence
<400> 4
ggtacgtgct gttgaactgt tcc 23
<210> 5
<211> 29
<212> DNA
<213>artificial sequence
<400> 5
caggtgcagc tgcaggagtc tgggggagr 29
<210> 6
<211> 34
<212> DNA
<213>artificial sequence
<400> 6
ctagtgcggc cgctgaggag acggtgacct gggt 34
<210> 7
<211> 20
<212> DNA
<213>artificial sequence
<400> 7
aatacgcaaa ccgcctctcc 20
<210> 8
<211> 30
<212> DNA
<213>artificial sequence
<400> 8
gggggatccc aggtccaact gcaggagtct 30
<210> 9
<211> 29
<212> DNA
<213>artificial sequence
<400> 9
gccaagcttt gaggagacgg tgacctggg 29

Claims (10)

1. a kind of nano antibody of 1 type duck hepatitis A virus of specific recognition, which is characterized in that the nano antibody is determined comprising complementation Determine area；
The complementary determining region is made of CDR1, CDR2 and CDR3；
The amino acid sequence of the CDR1 is the 26-38 amino acids of SEQ ID NO.1 in sequence table；
The amino acid sequence of the CDR2 is the 53-72 amino acids of SEQ ID NO.1 in sequence table；
The amino acid sequence of the CDR3 is the 103-111 amino acids of SEQ ID NO.1 in sequence table.
2. nano antibody according to claim 1, which is characterized in that the nano antibody is by the complementary determining region and frame Frame district's groups at；The amino acid sequence of the nano antibody is as shown in SEQ ID NO.1.
3. encoding the gene of nano antibody described in claim 1 or claim 2, which is characterized in that the nucleotide of the gene Sequence be it is following 1) or 2):
1) nucleotide sequence shown in SEQ ID NO.2；
2) there is 75% or 75% or more identity with the nucleotide sequence 1) limited, and encodes the nucleotide of the nano antibody Sequence.
4. biomaterial relevant to nano antibody described in claim 1 or claim 2, for a) to any one of d):
A) carrier comprising nucleotide sequence shown in SEQ ID NO.2；
B) expression cassette comprising nucleotide sequence shown in SEQ ID NO.2；
C) contain the recombinant microorganism of a) carrier；
D) contain the transgenetic animal cell system of a) carrier.
5. the derivative antibody of nano antibody described in claim 1 or claim 2, for a) to any one of c):
A) contain the single-chain antibody of the nano antibody；
B) contain the fusion antibody of the nano antibody；
C) contain the coupled antibody of the nano antibody.
6. the preparation method of nano antibody described in claim 1 or claim 2, which is characterized in that including it will encode described in The nucleic acid molecules of nano antibody import the transgenic cell that recipient cell obtains expressing the nano antibody, cultivate the transgenosis Cell obtains the nano antibody.
7. preparation method according to claim 6, which is characterized in that encode the nucleosides of the nucleic acid molecules of the nano antibody Acid sequence is as shown in SEQ ID NO.2.
8. nano antibody described in claim 1 or claim 2 is in the reagent or kit of preparation 1 type duck hepatitis A virus of detection In application.
9. nano antibody described in claim 1 or claim 2, biomaterial as claimed in claim 4 or claim 5 institute Application of the derivative antibody stated in the drug of preparation prevention or treatment 1 type duck hepatitis A virus infection.
10. a kind of for detecting the kit of 1 type duck hepatitis A virus, which is characterized in that include claim 1 in the kit Or derivative antibody described in nano antibody as claimed in claim 2 or claim 5.
CN201810945485.XA 2018-08-20 2018-08-20 Nano antibody for specifically recognizing type 1 duck hepatitis A virus Active CN109021099B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201810945485.XA CN109021099B (en) 2018-08-20 2018-08-20 Nano antibody for specifically recognizing type 1 duck hepatitis A virus

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810945485.XA CN109021099B (en) 2018-08-20 2018-08-20 Nano antibody for specifically recognizing type 1 duck hepatitis A virus

Publications (2)

Publication Number Publication Date
CN109021099A true CN109021099A (en) 2018-12-18
CN109021099B CN109021099B (en) 2020-05-05

Family

ID=64631254

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201810945485.XA Active CN109021099B (en) 2018-08-20 2018-08-20 Nano antibody for specifically recognizing type 1 duck hepatitis A virus

Country Status (1)

Country Link
CN (1) CN109021099B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116514965A (en) * 2023-06-15 2023-08-01 上海精翰生物科技有限公司 Hepatitis A virus antibody and application thereof

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101704890A (en) * 2009-11-13 2010-05-12 烟台绿叶动物保健品有限公司 Preparation method of duck hepatitis antibody
CN104404630A (en) * 2014-12-11 2015-03-11 东南大学 Natural nanometer antibody library for Bactrian camel phage display as well as construction method and usage thereof
CN103525772B (en) * 2013-10-18 2015-05-20 江苏省农业科学院 Strain of duck viral hepatitis virus and application thereof
CN106188297A (en) * 2015-07-20 2016-12-07 广西医科大学 Nano antibody Nb91 of anti-CTLA 4 and preparation method and application

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101704890A (en) * 2009-11-13 2010-05-12 烟台绿叶动物保健品有限公司 Preparation method of duck hepatitis antibody
CN103525772B (en) * 2013-10-18 2015-05-20 江苏省农业科学院 Strain of duck viral hepatitis virus and application thereof
CN104404630A (en) * 2014-12-11 2015-03-11 东南大学 Natural nanometer antibody library for Bactrian camel phage display as well as construction method and usage thereof
CN106188297A (en) * 2015-07-20 2016-12-07 广西医科大学 Nano antibody Nb91 of anti-CTLA 4 and preparation method and application

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116514965A (en) * 2023-06-15 2023-08-01 上海精翰生物科技有限公司 Hepatitis A virus antibody and application thereof
CN116514965B (en) * 2023-06-15 2023-11-10 上海精翰生物科技有限公司 Hepatitis A virus antibody and application thereof

Also Published As

Publication number Publication date
CN109021099B (en) 2020-05-05

Similar Documents

Publication Publication Date Title
CN108659129A (en) A kind of nano antibody and its preparation method and application of resisting GPC 3 albumen
CN108892723B (en) Single-domain heavy chain antibody for detecting porcine epidemic diarrhea virus, preparation method and application
CN113527476A (en) Novel nano antibody for resisting H5 subtype avian influenza virus and application thereof
CN109160948A (en) A kind of hepatitis B surface antigen nano antibody and nucleic acid molecules and application
CN106046152A (en) Nano antibody for specifically identifying histidine label
CN115976076A (en) HBC-SpyTag003 fusion gene, expression vector thereof, monoclonal antibody and application thereof
CN109306008B (en) Single-chain antibody of swine-origin anti-classical swine fever virus and preparation method thereof
CN103725697B (en) The surface protein FnBPA genetic fragment of the staphylococcus aureus of chemosynthesis and expression, application
CN109021099A (en) A kind of nano antibody of 1 type duck hepatitis A virus of specific recognition
CN106188279A (en) A kind of nano antibody of the specific recognition immunoglobulin Fc section in immune library source
CN106117350A (en) A kind of nano antibody of the binding domain-immunoglobulin Fc section in immune library source
CN105949320A (en) Preparation and application of echovirus type 1 VP1 protein specific antigen epitope and fusion protein thereof
CN110702913B (en) Monoclonal antibody composition for quantitatively detecting coxiella burnetii I strain
CN105906716A (en) Echovirus type-9 VP1 protein specific antigen epitope and preparation method and application of fusion protein thereof
CN107043417A (en) A kind of nano antibody for aflatoxin
CN106831990A (en) A kind of nano antibody that can specifically bind c Myc labels
CN107043421A (en) The single domain heavy chain antibody of anti-c Myc labels
CN106831991A (en) The nano antibody of anti-c Myc labels
CN106946990A (en) A kind of nano antibody for c Myc labels
CN107759692A (en) A kind of nano antibody of anti-CA 125
CN106117349A (en) A kind of single domain heavy chain antibody of the specific recognition immunoglobulin Fc section in immune library source
CN110759975B (en) Polypeptide, antibody with strong ADCC effect and application
CN108623663B (en) Immunogenic functional polypeptide of mycoplasma hyopneumoniae P97 protein and encoding gene and application thereof
CN108060113B (en) Genetically engineered single-chain antibody strain capable of stably expressing interferon gamma and application thereof
CN106946993A (en) It is a kind of to specifically bind the single domain heavy chain antibody of c Myc labels

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant