CN102552452B - Pharmaceutical composition used for treating virus B hepatitis and its preparing method and application - Google Patents

Abstract

The invention provides a pharmaceutical composition used for preventing and treating virus B hepatitis. The pharmaceutical composition is a preparation prepared from the following bulk drugs by weight: 1 to 20 parts of gentrin knotweed, 1 to 15 parts of bushy sophora, 1 to 24 parts of Penthorum chinense Pursh and 1 to 10 parts of coptis. The invention also provides a preparing method and application of the pharmaceutical composition. The pharmaceutical composition provided in the invention can increase the level of mRNA of OAS and PKR in a cell and improve the protein level of OAS and PKR, thereby having a good anti-HBV effect, can improve liver injury, having an obvious liver protecting effect, can increase secretory volume of bile, having a certain gallbladder benefiting effect, has a substantial effect on strengthening capability of mouse peritoneal macrophages in phagocytosing chicken red blood cells, enables the phagocytosis rate of the mouse peritoneal macrophages and phagocytosis indexes to be substantially increased compared to control groups, and has an obvious effect on improving low formation of mouse hemolysin antibodies caused by cyclophosphamide.

Description

A kind of pharmaceutical composition and preparation method and purposes for the treatment of hepatitis B

Technical field

The present invention relates to a kind of pharmaceutical composition of hepatitis B and Use and preparation method of this pharmaceutical composition for the treatment of.

Background technology

Hepatitis B is one of common viral hepatitis, mainly be divided into clinically acute hepatitis B, chronic hepatitis B and heavy hepatitis B etc., can propagate through modes such as blood, mother and baby, damaged skin and property contacts, be also common chronic infectious disease.According to World Health Organization (WHO) (WHO), chronic hepatitis B accounts in the global top ten disease cause of the death the 7th, wherein 30% hepatitis B patient develops into liver cirrhosis and hepatocarcinoma the most at last, and only China just has 300,000 people to die from the disease that hepatitis B virus infection causes every year.At present, adopt nucleoside analog and interferon to treat hepatitis B and hepatitis B virus carriers more.Wherein, the normal nucleoside analog using has lamivudine, Adefovir Dipivoxil, Entecavir, Sebivo, tenofovir disoproxil etc., its overall security and toleration are good, but can there is rare, rare serious adverse reaction in clinical practice, as renal insufficiency, myositis, rhabdomyolysis, lactic acidosis etc., once and drug withdrawal, most of patient's hepatitis B virus DNA polymerase parameter bounce-back, higher before some ratio treatments.

At Western medicine, to treating hepatitis B poor effect in the situation that, people start to turn one's attention to Chinese medicine.At present, find the effectively new drug for the treatment of hepatic disease taking theory of Chinese medical science as basis, become the new direction of current medical personnel's research.

Summary of the invention

Technical program of the present invention lies in providing a kind of pharmaceutical composition of effective treatment hepatitis B.Another technical scheme of the present invention has been to provide preparation method and the purposes of this pharmaceutical composition.

The invention provides a kind of pharmaceutical composition of preventing and treating hepatitis B, it is the preparation being prepared from by the crude drug of following weight proportion:

Rhizoma Polygoni Cuspidati 1-20 part, Radix Sophorae Tonkinensis 1-15 part, Penthorum chinense 1-24 part, Rhizoma Coptidis 1-10 part.

Further preferably, it is the preparation being prepared from by the crude drug of following weight proportion:

Rhizoma Polygoni Cuspidati 9-15 part, Radix Sophorae Tonkinensis 3-6 part, Penthorum chinense 9-24 part, Rhizoma Coptidis 2-5 part.

Still more preferably, it is the preparation being prepared from by the crude drug of following weight proportion:

12 parts of Rhizoma Polygoni Cuspidati, 6 parts of Radix Sophorae Tonkinensiss, 12 parts of Penthorum chinense, 2 parts of Rhizoma Coptidis.

Pharmaceutical composition of the present invention is to be active component by the raw material medicated powder of Rhizoma Polygoni Cuspidati, Radix Sophorae Tonkinensis, Penthorum chinense, Rhizoma Coptidis or extractive with organic solvent, adds pharmaceutically acceptable adjuvant or complementary composition to be prepared into pharmaceutically conventional preparation.

Wherein, described preparation is decoction, powder, pill, granule, tablet, capsule, oral liquid or drop pill.

Wherein, in described capsule, every contains Rhizoma Polygoni Cuspidati with emodin C ₁₅h ₁₀o ₅meter, must not be less than 4.50mg.

The present invention also provides a kind of method of preparing described pharmaceutical composition, and it comprises the steps:

(1) get the crude drug of recipe quantity, pulverize, medicated powder is for subsequent use; Or

(2) get the crude drug of recipe quantity, add water or organic solvent extraction, the active component that extracts gained is for subsequent use;

(3) get the medicated powder of step (1) gained or the active component of step (2) gained, add pharmaceutically conventional adjuvant or complementary composition, be prepared into pharmaceutically conventional preparation.

Wherein, described preparation is capsule, and its preparation method is:

A, get Rhizoma Polygoni Cuspidati 1-100 part and Radix Sophorae Tonkinensis 1-100 part, add the 60%-80% ethanol of 6-8 times of medical material weight, reflux, extract, 1-3 time, each 60-120min, merges alcohol extract, filters, decompression recycling ethanol, concentrated, concentrated solution is for subsequent use;

B, get Penthorum chinense 1-100 part, add 6-10 times of medical material weight water, soak 30-45min, decocts 1-3 time, each 60-90min, merge extractive liquid,, after concentrating under reduced pressure, adds ethanol to reaching 60% containing alcohol amount, precipitate with ethanol, filtration, decompression recycling ethanol, concentrates, and concentrated solution is for subsequent use;

C, get Rhizoma Coptidis 1-100 part, add 6-10 times of medical material weight water, soak 30-60min, decocts 1-3 time, each 40-80min, merging Rhizoma Coptidis extract, after remove impurity, concentrates, and concentrated solution is for subsequent use;

D, merge above-mentioned each concentrated solution, after adopting conventional method of granulating to granulate, encapsulated, to obtain final product.

The preparation method of further preferably, described capsule is:

A, get 6 parts of 12 parts of Rhizoma Polygoni Cuspidati and Radix Sophorae Tonkinensiss, add 60% ethanol of 8 times of medical material weight, reflux, extract, 3 times, each 120min, merge alcohol extract, filter, under 80 DEG C of temperature, vacuum-0.08～-0.1Mpa, reclaim ethanol, the clear paste that is concentrated into relative density 1.03～1.05 (60 DEG C) is for subsequent use;

B, get 12 parts of Penthorum chinense, add 10 times of medical material weight water, soak 45min, decoct 3 times, each 90min, merges Penthorum chinense extracting solution, and under 80 DEG C of temperature, vacuum-0.08～-0.1Mpa, being concentrated into relative density is 1.15-1.18, add ethanol to reaching 60% containing alcohol amount, stir, leave standstill 24h, filter, under 80 DEG C of temperature, vacuum-0.08～-0.1Mpa, reclaim ethanol, the clear paste that is concentrated into relative density 1.03～1.05 (60 DEG C) is for subsequent use;

C, get 2 parts of Rhizoma Coptidis, add 8 times of medical material weight water, soak 45min, decoct 3 times, each 60 minutes, merge Rhizoma Coptidis extract, taking rotating speed as 6000r/min centrifugal, the clear paste that is concentrated into relative density 1.03～1.05 (60 DEG C) under 80 DEG C of temperature, vacuum-0.08～-0.1Mpa is for subsequent use;

D, merge above-mentioned each clear paste, be that under 90～100 DEG C of conditions, spraying is dry in 180～200 DEG C of inlet temperature, leaving air temp, collect spray powder, in relative humidity lower than 60.5%, dry granulation under the condition that temperature is 18～22 DEG C (principal pressure 4.5～5.5Mpa, lateral pressure 0.25Mpa), sieve, collect the granule of 40～60 mesh sieves, encapsulated, to obtain final product.

The present invention also provides the purposes of this pharmaceutical composition in the medicine of preparation prevention or treatment hepatitis B.

The present invention also provides the purposes in this pharmaceutical composition protected the liver, strengthens immunity or function of gallbladder promoting medicine in preparation.

Rhizoma Polygoni Cuspidati in drug regimen raw material of the present invention is dry rhizome and the root of Polygonaceae Polygonaceae plant polygonum cuspidatum Polygonum cuspidatum Sieb.et Zucc..Micro-hardship, is slightly cold, and returns liver, gallbladder, lung meridian.Function eliminating damp-heat, promoting the function of the gallbladder to alleviate jaundice, blood circulation promoting and blood stasis dispelling, removing toxic substances pain relieving, modern study thinks, its effective ingredient is mainly Anthraquinones and diphenylethylene compounds, has antibacterial, antioxidation, prevents and treats heart disease, the multiple effect such as anticancer, blood fat reducing, reduction cholesterol.Radix Sophorae Tonkinensis, is the dry root and rhizome of dicotyledon medicine leguminous plant Sophora tonkinensis Gagnep. Sophorae Tonkinensis Gagnep., nature and flavor: hardship, and cold.Heat-clearing and toxic substances removing, relieving sore throat and diminishing swelling, modern study thinks, Radix Sophorae Tonkinensis is containing abundant flavone, alkaloid and Saponin composition, and contains phenolic constituent and lignan component, has the physiologically actives such as arrhythmia, anti-hepatitis, antiinflammatory.Penthorum chinense, for the herb of Crassulaceae penthorum plant Penthorum chinense Penthorum chinense Pursh, sweet in the mouth, slightly warm in nature, function cures mainly: diuretic dehumidifying, stasis-dispelling and pain-killing, for jaundice, edema, traumatic injury is controlled in external, modern study thinks, its main effective ingredient is Quercetin and Galla Turcica (Galla Helepensis) class.Rhizoma Coptidis is the dry rhizome of ranunculaceae plant Rhizoma Coptidis Coptis chinensis Franch. Coptis deltoidea C.Y.Cheng et Hsiao Coptis deltoidea C.Y.Chenget Hsiao or Coptis Teeta Wall Coptis teeta Wall., bitter in the mouth, cold in nature, heat clearing and damp drying, eliminating fire and detoxication, for damp and hot feeling of fullness, vomiting acid regurgitation, dysentery, jaundice, unconsciousness due to high fever, hyperactivity of heart-fire, dysphoria and insomnia, heat in blood is told nosebleed, conjunctival congestion, toothache, quenches one's thirst, carbuncle furuncle, external treatment eczema, eczema, auditory meatus is suppurated, main containing Protoberberine Alkoloids, there is the effect of broad ectrum antibiotic.

In raw material prescription of the present invention, taking the blood stasis dispelling of Rhizoma Polygoni Cuspidati clearing heat, detoxicating, dispelling dampness as monarch, be aided with Radix Sophorae Tonkinensis heat-clearing and toxic substances removing, Penthorum chinense dampness removing jaundice eliminating, dissolving blood stasis and detoxication, assistant is with Rhizoma Coptidis heat clearing and damp drying, eliminating fire and detoxication.Full side's eliminating damp-heat, removing toxic substances pain relieving, dissipating blood stasis protects the liver, and can increase the mRNA level of OAS, PKR in cell, strengthens OAS, PKR protein level, has good anti-HBV effect.Pharmaceutical composition of the present invention can also improve hepatic injury, has obvious hepatoprotective effect; Improve choleresis, there is certain choleretic effect; Turnover of Mouse Peritoneal Macrophages is engulfed to chicken red blood cell ability and be significantly increased, Turnover of Mouse Peritoneal Macrophages phagocytic rate, phagocytic index are significantly increased compared with matched group; Cyclophosphamide is caused to mice hemolytic antibody and generate the effect that is lowly significantly improved.

Brief description of the drawings

Fig. 1: pharmaceutical composition of the present invention is on HBeAg (OD) impact (wherein, DMSO represents 0.1% dimethyl sulfoxide, and LAM represents lamivudine, and HH represents medicine capsule of the present invention)

Fig. 2: pharmaceutical composition of the present invention affects HBsAg (OD)

Fig. 3: pharmaceutical composition of the present invention affects extracellular HBVDNA

Fig. 4: pharmaceutical composition of the present invention is on HBVDNA impact in cell

Fig. 5: pharmaceutical composition of the present invention is on OAS, PKRmRNA impact in cell

Fig. 6: pharmaceutical composition of the present invention is on OAS, the impact of PKR albumen in cell

Fig. 7: OAS, PKR Western blot figure

Detailed description of the invention

The preparation of embodiment 1 pharmaceutical composition of the present invention

A, get Rhizoma Polygoni Cuspidati 1333.3g and Radix Sophorae Tonkinensis 666.7g, add 60% ethanol of 8 times of medical material weight, reflux, extract, 3 times, each 120min, merge alcohol extract, filter, under 80 DEG C of temperature, vacuum-0.08～-0.1Mpa, reclaim ethanol, the clear paste that is concentrated into relative density 1.03～1.05 (60 DEG C) is for subsequent use;

B, get Penthorum chinense 1333.3g, add 10 times of medical material weight water, soak 45min, decoct 3 times, each 90min, merges Penthorum chinense extracting solution, and under 80 DEG C of temperature, vacuum-0.08～-0.1Mpa, being concentrated into relative density is 1.15-1.18, add ethanol to reaching 60% containing alcohol amount, stir, leave standstill 24h, filter, under 80 DEG C of temperature, vacuum-0.08～-0.1Mpa, reclaim ethanol, the clear paste that is concentrated into relative density 1.03～1.05 (60 DEG C) is for subsequent use;

C, get Rhizoma Coptidis 222.2g, add 8 times of medical material weight water, soak 45min, decoct 3 times, each 60 minutes, merge Rhizoma Coptidis extract, taking rotating speed as 6000r/min centrifugal, the clear paste that is concentrated into relative density 1.03～1.05 (60 DEG C) under 80 DEG C of temperature, vacuum-0.08～-0.1Mpa is for subsequent use;

D, merge above-mentioned each clear paste, be that under 90～100 DEG C of conditions, spraying is dry in 180～200 DEG C of inlet temperature, leaving air temp, collect spray powder, in relative humidity lower than 60.5%, dry granulation under the condition that temperature is 18～22 DEG C (principal pressure 4.5～5.5Mpa, lateral pressure 0.25Mpa), sieve, collect the granule of 40～60 mesh sieves, encapsulated, obtain 1000 medicament composition capsule agent of the present invention.

The preparation of embodiment 2 pharmaceutical compositions of the present invention

Get the clear paste of A, B in embodiment 1, C step gained, after merging, be concentrated into relative density 1.1-1.30 (60 DEG C), add appropriate dextrin or starch to be prepared into granule;

After encapsulated the granule preparing, obtain capsule.

The preparation of embodiment 3 pharmaceutical compositions of the present invention

Get Rhizoma Polygoni Cuspidati 12g, Radix Sophorae Tonkinensis 6g, Penthorum chinense 12g, Rhizoma Coptidis 2g, decocts with water 3 times, and each 30 minutes, merge decocting liquid, filter, be concentrated into relative density 1.1-1.30 (60 DEG C), add appropriate soluble starch to be prepared into granule;

By the granule preparing, then add appropriate magnesium stearate, tabletting, obtains tablet.

The preparation of embodiment 4 pharmaceutical compositions of the present invention

Get Rhizoma Polygoni Cuspidati 1g, Radix Sophorae Tonkinensis 1g, Penthorum chinense 1g, Rhizoma Coptidis 100g, decocts with water 1 time, 60 minutes, decocting liquid filtered, concentrated, added after appropriate ethanol or chitosan remove impurity the centrifugal precipitation of removing, supernatant adds appropriate antiseptic and correctives after suitably concentrating, and fill, prepares oral liquid of the present invention.

The preparation of embodiment 5 pharmaceutical compositions of the present invention

Get Rhizoma Polygoni Cuspidati 20g, Radix Sophorae Tonkinensis 1g, Penthorum chinense 1g, Rhizoma Coptidis 1g, after pulverizing, adds suitable adjuvant, general pill agent.

The preparation of embodiment 6 pharmaceutical compositions of the present invention

Get Rhizoma Polygoni Cuspidati 1g, Radix Sophorae Tonkinensis 15g, Penthorum chinense 20g, Rhizoma Coptidis 10g, after decocting with water, remove impurity, obtains pharmaceutical composition decoction of the present invention.

The preparation method of embodiment 1-5 to pharmaceutical composition of the present invention; should not be understood as limiting the scope of the invention; all based on above-mentioned technological thought, utilize amendment, replacement, the change that ordinary skill knowledge and customary means are made all to belong to scope of the present invention.

The quality standard of embodiment 7 embodiment 1 capsules

1, assay

Rhizoma Polygoni Cuspidati is our monarch drug, main containing Anthraquinone derivative: emodin, chrysophanol, physcione are antimicrobial component.Still containing flavone compounds such as resvertrol, polygonin, tannin and Quercetins, modern pharmacological research shows, the anthraquinones such as emodin have antivirus action, can suppress the hepatitis B antigen positive.Therefore select emodin as the index components of controlling this product.The content assaying method of emodin, that has reported mostly is high performance liquid chromatography, and this standard, with reference to related documents, has been set up the content of emodin in high effective liquid chromatography for measuring this product.Detection to emodin peak is mainly uv detection method, and its wavelength is 254nm, selects Agilent Eclipse XDB-C in test ₁₈post (5 μ m, 150mm × 4.6mm) carry out methodology examination, with methanol-0.1% phosphoric acid solution (80: 20) and mobile phase the separating sample such as methanol-0.1% phosphoric acid solution (85: 15), result is during taking mobile phase ratio as methanol-0.1% phosphoric acid solution (80: 20), the separation at Yu Lin peak, emodin peak is good, and the theoretical cam curve at emodin peak is higher.

(1) instrument and reagent

Instrument: Agilent 1100 type high performance liquid chromatographs, Agilent company of the U.S.; Agilent chromatographic work station; VWD UV-detector, Agilent company of the U.S.; Sartorius BP211D electronic balance (0.01mg), Germany; Ultrasonic extractor, 726 of Zhong Chuan No. 7 Institutes.

Reagent: high performance liquid chromatogram methanol is chromatographically pure (Fisher company of U.S. product), and water is ultra-pure water (self-control), and other reagent is analytical pure.

Reference substance: emodin reference substance provides (lot number 110756-200110, for assay) by Nat'l Pharmaceutical & Biological Products Control Institute

Sample: embodiment 1 makes (lot number: 060801,060802,060803).

(2) chromatographic condition

Chromatographic column: Agilent Eclipse XDB-C18 (5 μ m, 150mm × 4.6mm); Guard column: Agilent ZORBAX XDB-C18 (5 μ m, 4mm × 4mm); Mobile phase: methanol-0.1% phosphoric acid solution (80: 20); Flow velocity: 1.0ml/min; Column temperature: 30 DEG C; Detect wavelength 254nm.

This chromatographic condition is noiseless to the mensuration feminine gender of emodin, its retention time is about 6.5 minutes, the separating of emodin peak and adjacent peak good (Rs > 1.5), pressing emodin peak calculates, number of theoretical plate is more than 9000, for making quantitative analysis more accurate, therefore regulation number of theoretical plate is not less than 6000 in system suitability.

(3) examination of linear relationship

Precision takes emodin reference substance 5.46mg, puts in 50ml measuring bottle, with dissolve with methanol and be settled to scale, obtains the reference substance solution of every 1ml containing emodin 0.1092mg.Above-mentioned solution 2,4,6,8, the 10 μ l of accurate absorption, inject hplc determination respectively, the results are shown in Table 1.

Table 1 emodin reference substance linear relationship examination measurement result

Taking sample size X (μ g) as abscissa, peak area integrated value Y is vertical coordinate mapping, carries out linear regression, obtains regression equation and is: Y=4076.08X-125.5481, r=0.99998.

From above result, emodin is good in 0.2184 μ g～1.092 μ g scope internal linear relation.

(4) preparation of need testing solution

" in Rhizoma Polygoni Cuspidati assay of Chinese Pharmacopoeia 2005 version, emodin content assay method is that sample adds chloroform and sulphuric acid extraction, therefore the extraction solvent of this product is adopted to chloroform, and in the time extracting, add sulfuric acid solution to be hydrolyzed, extracting method adopts heat reflow method, and the sulphuric acid hydrolysis time is examined or check.

Get this product content, porphyrize, gets about 0.5g, accurately weighed, and precision adds chloroform 50ml and 2.5mol/L sulfuric acid solution 20ml, and weighed weight is put in 80 DEG C of water-baths respectively reflux 1,1.5,2h, cold really to room temperature.Weighed weight again, adds chloroform and supplies the weight of less loss, shakes up.Divide and get chloroform liquid, precision measures 2ml, evaporate to dryness, and residue adds methanol to be made to dissolve, and is transferred in 10ml measuring bottle, adds methanol and is diluted to scale, and centrifugal, supernatant is as need testing solution.According to content in content assaying method working sample, the results are shown in Table 2.

Table 2 hydrolysis time examination result

Above result shows, more than hydrolysis 1.5h on the content results impact of emodin not quite, is to ensure extraction effect, and selection hydrolysis time is 2h.

In sum, the preparation method of need testing solution is: get this product content, porphyrize, get about 0.5g, accurately weighed, precision adds chloroform 50ml and 2.5mol/L sulfuric acid solution 20ml, weighed weight, puts difference reflux 2h in 80 DEG C of water-baths, cold really to room temperature.Weighed weight again, adds chloroform and supplies the weight of less loss, shakes up.Divide and get chloroform liquid, precision measures 2ml, evaporate to dryness, and residue adds methanol to be made to dissolve, and is transferred in 10ml measuring bottle, adds methanol and is diluted to scale, and centrifugal, supernatant is as need testing solution.

(5) precision test

Accurate suction line sexual relationship examination lower reference substance solution (concentration is a 0.1092mg/ml) 5 μ l, continuous sample introduction 5 times, RSD=0.235, shows that this mensuration system precision is good.

(6) repeatability test

To 5 parts of same batch sample (lot number 060801) samplings, measure by the content assaying method of drafting respectively, RSD=2.521%, shows that repeatability is good.

(7) stability test

The accurate reference substance solution 5 μ l that draw, respectively at 0 hour, 2 hours, 4 hours, 8 hours, 24 hours, inject high performance liquid chromatograph, measure the peak area of emodin, and RSD=0.737%, shows that reference substance solution is good at 24 hours internal stabilities.

(8) recovery test

Get the about 0.25g of sample (lot number 060301) of known content (11.16mg/g), add respectively emodin reference substance appropriate, measure by the preparation method of aforementioned finished product need testing solution and chromatographic condition, average recovery rate is 98.59%, RSD=1.977%, shows that this law response rate is good.

(9) mensuration of sample

Get the sample of different lot numbers, measure by the aforementioned content assaying method of drafting, the results are shown in Table 3.

The measurement result of emodin (n=2) in table 3 sample

According to above measurement result, consider emodin content difference in the source of medical material and medical material, and the factor such as preparation production, storage, therefore this standard tentative every containing Rhizoma Polygoni Cuspidati with emodin (C ₁₅h ₁₀o ₅) meter, must not be less than 4.50mg.

Embodiment 8 pharmaceutical composition preparation technology's of the present invention screening

1, Rhizoma Polygoni Cuspidati, the research of Radix Sophorae Tonkinensis alcohol extraction process

1.1 inhale the examination of alcohol rate

In prescription ratio, take Rhizoma Polygoni Cuspidati, Radix Sophorae Tonkinensis 72g, add 10 times of amount 60% soak with ethanol to the saturating heart, filter, record and inhale alcohol rate, the results are shown in Table 4.

Table 4 is inhaled alcohol rate measurement result

Above result shows, the suction alcohol rate of Rhizoma Polygoni Cuspidati, Radix Sophorae Tonkinensis is 163.12%, should additionally add approximately 1.6 times of amount alcohol to supply the suction alcohol amount of medical material while therefore extraction for the first time.

1.2 experimental technique

The factor that affects Chinese crude drug alcohol extraction effect mainly contains: pulverizing medicinal materials granularity, extraction temperature, soak time, concentration of alcohol, alcohol adding amount, return time, reflow's cycle etc.Therefore, this research is respectively established three levels to concentration of alcohol, alcohol adding amount, return time, four factors of reflow's cycle, according to L ₉(3 ⁴) orthogonal table arrangement test, factor level is in table 5.Due to monarch drug in the Rhizoma Polygoni Cuspidati side of being, emodin is its main component, therefore taking the content of emodin as examination index, because paste-forming rate is the material base of performance curative effect, is therefore that index is evaluated with the yield of dry cream equally.

Table 5 Rhizoma Polygoni Cuspidati, Radix Sophorae Tonkinensis factor level table

Take Rhizoma Polygoni Cuspidati, Radix Sophorae Tonkinensis in prescription ratio, extract by orthogonal test condition, filter, merging filtrate, for subsequent use.

The assay method of each evaluation index

1. the assay of emodin

The assay of emodin: adopt high performance liquid chromatography.

Chromatographic condition: Agilent 1100 type high performance liquid chromatographs, VWD UV-detector, chromatographic column Agilent Eclipse XDB-C18 post (4.6 × 150mm, 5um); Mobile phase is methanol: 0.1% phosphoric acid (85: 15); Flow velocity: 1ml/min; 30 DEG C of column temperatures; Ultraviolet detection wavelength: 254nm.

The preparation of reference substance solution: get emodin reference substance 5.42mg (lot number 0756-9908), in 50ml volumetric flask, add dissolve with methanol and add methanol and be diluted to scale, shake up, get again in 1ml to 10ml measuring bottle, add methanol and be diluted to scale, shake up, obtain the emodin reference substance solution of 0.01084mg/ml.

The preparation of need testing solution: get the extracting solution under orthogonal test item, measure cumulative volume, therefrom a certain amount of medicinal liquid of accurate absorption is in 100ml measuring bottle, add methanol and be diluted to scale, shake up, filter, precision measures subsequent filtrate 10ml, put in 100ml round-bottomed flask, volatilize, add 2.5mol/L sulfuric acid solution 20ml, reflux 1 hour, slightly cold, add the about 30ml of chloroform, continue to reflux 2 hours, cooling, in dislocation separatory funnel, with a small amount of chloroform washing container, washing liquid is incorporated in separatory funnel, divide and get in chloroform stratification 50ml measuring bottle, acid solution chloroform extraction 2 times, each about 8ml, chloroform liquid is incorporated in 50ml measuring bottle, add chloroform to scale, shake up, obtain.

The preparation of negative sample solution: measure and have noiselessly for investigating emodin content, need prepare negative sample.Get the medical material that lacks Rhizoma Polygoni Cuspidati, extract by orthogonal test, precision measures extracting liquid volume, is made in the same way of negative sample solution by method under the preparation of need testing solution.

The drafting of standard curve: according to high performance liquid chromatography " annex VID test of Chinese Pharmacopoeia 2005 version, accurate emodin reference substance solution 2,4,6,8,10, the 20 μ l that draw inject high performance liquid chromatograph respectively, measure peak area taking peak area integrated value (Y) as vertical coordinate according to above-mentioned chromatographic condition, (μ is g) abscissa to the content (X) of emodin reference substance, obtain regression equation: Y=1812.01X-5.78131, r=0.99999

Algoscopy: accurate reference substance solution 10, the 20 μ l of absorption and need testing solution 10 μ l inject high performance liquid chromatograph respectively, measure, and calculate the content of emodin with two points external standard method.

In amount (the mg)/orthogonal test of the content of emodin=record emodin by the amount (mg) × 100% of medical material

2. the yield of dry cream

It is a certain amount of that precision measures under orthogonal test item extracting solution, puts in the evaporating dish that is dried to constant weight, in water-bath after evaporate to dryness, is dried to constant weight in 105 DEG C, moves in exsiccator, and cooling 30 minutes, rapid accurately weighed weight, calculated yield of extract.

Dry cream yield=survey heavily (g)/orthogonal test that gets dry extract is the amount (g) × 100% with medical material

Orthogonal experiments and analysis in table 6,7,8.

Table 6 orthogonal experiments

The variance analysis of table 7 paste-forming rate

The variance analysis of table 8 emodin content

From intuitive analysis, factor taking paste-forming rate as Index Influence extraction effect order is D > A > C > B, the results of analysis of variance shows: D factor has the impact of utmost point significance to experimental result, with A ₁b ₃c ₃d ₃combination is best.Factor taking emodin content as Index Influence extraction effect order as: D > B > C > A, the results of analysis of variance shows: D factor has a significant impact experimental result, with A ₃b ₃c ₃d ₃combination is best, because A factor is little on result of the test impact, therefore based on the above results, with A ₁b ₃c ₃d ₃combination is best, and Rhizoma Polygoni Cuspidati and Radix Sophorae Tonkinensis medical material add 8 times of amount 60% ethanol, reflux, extract, 3 times, each 120 minutes.

For confirming quality and the stability of this technique, according to screened optimum condition, to A ₁b ₃c ₃d ₃process certification three times, the results are shown in Table 9.

Table 9 demonstration test result

Above result shows, the extraction process reasonable of Rhizoma Polygoni Cuspidati, Radix Sophorae Tonkinensis.

2, Rhizoma Coptidis extraction process by water research

The examination of 2.1 water absorption rates

Take Rhizoma Coptidis 50g, add 10 times of water gagings and be dipped to the heart, filter, record water absorption rate, the results are shown in Table 10.

Table 10 water absorption rate measurement result

Above result shows, the water absorption rate of Rhizoma Coptidis is 188%, should additionally add approximately 1.9 times of water gagings to supply the water absorption of medical material while therefore extraction for the first time.

2.2 experimental technique

The factor that affects Chinese crude drug water extraction effect mainly contains: pulverizing medicinal materials granularity, extraction temperature, soak time, amount of water, decocting time, decoction number of times etc.This research is mainly respectively established three levels to soak time, amount of water, decocting time, four factors of decoction number of times, according to L ₉(3 ⁴) orthogonal table arrangement test, factor level is in table 11.Because main effective ingredient in Rhizoma Coptidis is berberine hydrochloride, therefore taking the content of berberine hydrochloride as examination index, because paste-forming rate is the material base of performance curative effect, therefore, be that index is evaluated with the yield of dry cream equally.

Table 11 Rhizoma Coptidis factor level table

Take Rhizoma Coptidis 100g, extract by orthogonal test condition, filter, merging filtrate, for subsequent use.

The assay method of each evaluation index

1. the assay of berberine hydrochloride

The assay of berberine hydrochloride: adopt high performance liquid chromatography.

Chromatographic condition: Agilent 1100 type high performance liquid chromatographs, VWD UV-detector, chromatographic column Agilent Eclipse XDB-C18 post (4.6 × 150mm, 5um); Mobile phase is methanol-0.033mol/L potassium dihydrogen phosphate (30: 70); Flow velocity: 1ml/min; 25 DEG C of column temperatures; Ultraviolet detection wavelength: 265nm.

The preparation of reference substance solution: get berberine hydrochloride reference substance 5.25mg (lot number 110713-200208), in 50ml volumetric flask, add dissolve with methanol and add methanol and be diluted to scale, shake up, obtain the emodin reference substance solution of 0.105mg.

The preparation of need testing solution: get the extracting solution under orthogonal test item, measure cumulative volume, therefrom a certain amount of medicinal liquid of accurate absorption, in 50ml measuring bottle, adds methanol and is diluted to scale, shakes up, and filters, and to obtain final product.

The drafting of standard curve: according to high performance liquid chromatography " annex VID test of Chinese Pharmacopoeia 2005 version, accurate berberine hydrochloride reference substance solution 2,4,6,8, the 10 μ l that draw inject high performance liquid chromatograph respectively, measure peak area according to above-mentioned chromatographic condition, taking peak area integrated value (Y) as vertical coordinate, (μ is g) abscissa to the content (X) of berberine hydrochloride reference substance, regression equation is: Y=4638.95X-427.72535, r=0.99957

Algoscopy: accurate reference substance solution 5, the 10 μ l of absorption and need testing solution 10 μ l inject high performance liquid chromatograph respectively, measure, and calculate the content of berberine hydrochloride with two points external standard method.

In amount (the mg)/orthogonal test of the content of berberine hydrochloride=record berberine hydrochloride by the amount (mg) * 100% of medical material

2. the yield of dry cream

It is a certain amount of that precision measures under orthogonal test item extracting solution, puts in the evaporating dish that is dried to constant weight, in water-bath after evaporate to dryness, is dried to constant weight in 105 DEG C, moves in exsiccator, and cooling 30 minutes, rapid accurately weighed weight, calculated yield of extract.

Orthogonal experiments and analysis in table 12,13,14.

Table 12 orthogonal experiments

The variance analysis of table 13 paste-forming rate

The variance analysis of table 14 content of berberine hydrochloride

From intuitive analysis, factor taking paste-forming rate as Index Influence extraction effect order is D > C > B > A, the results of analysis of variance shows: D factor has the impact of utmost point significance to experimental result, with A ₂b ₃c ₃d ₃combination is best.Factor taking content of berberine hydrochloride as Index Influence extraction effect order is D > A > B > C, the results of analysis of variance shows: D factor has the impact of utmost point significance to experimental result, A factor has appreciable impact to experimental result, with A ₂b ₂c ₂d ₃combination is best, because B, C factor affect not quite experimental result, therefore based on the above results, selects A ₂b ₂c ₂d ₃technique, Rhizoma Coptidis adds 8 times of water gagings, soaks 45min, decocts each 60 minutes 3 times.

For confirming quality and the stability of this technique, according to screened optimum condition, to A ₂b ₂c ₂d ₃process certification three times, the results are shown in Table 15.

Table 15 Extraction Process of Rhizoma Coptis demonstration test

Above result shows: the water extraction process of Rhizoma Coptidis is stablized, reasonable.

3, Penthorum chinense is put forward technical study

The examination of 3.1 water absorption rates

Take Penthorum chinense 50g, add 10 times of water gagings and be dipped to the heart, filter, record water absorption rate, the results are shown in Table 16.

Table 16 water absorption rate measurement result

Above result shows, the water absorption rate of Penthorum chinense is 149.33%, should additionally add approximately 1.5 times of water gagings to supply the water absorption of medical material while therefore extraction for the first time.

3.2 experimental technique

The factor that affects Chinese crude drug water extraction effect mainly contains: pulverizing medicinal materials granularity, extraction temperature, soak time, amount of water, decocting time, decoction number of times etc.This research is mainly respectively established three levels to soak time, amount of water, decocting time, four factors of decoction number of times, according to L ₉(3 ⁴) orthogonal table arrangement test, factor level is in table 17.Because main effective ingredient in Penthorum chinense is a small amount of alkaloid and flavone, therefore I am using the ethanol-soluble extractives of extracting solution as the examination index of evaluating extraction effect, because paste-forming rate is the material base of performance curative effect, be also that index is evaluated with the yield of dry cream simultaneously.Adopt the mode of comprehensive grading to carry out overall merit to ethanol-soluble extractives and dry cream yield, because ethanol-soluble extractives and dry cream yield have greater significance in Penthorum chinense extracts, therefore ethanol-soluble extractives and dry cream yield respectively account for 50% of comprehensive grading.

Table 17 Penthorum chinense extraction factor water-glass

Take Penthorum chinense medical material 100g, extract by orthogonal test condition, filter, merging filtrate, for subsequent use.

The assay method of each evaluation index

1. ethanol-soluble extractives is measured

Get the extracting solution under orthogonal test item, measure cumulative volume, the therefrom accurate extracting solution that is approximately equivalent to 10g medical material of drawing, in evaporating dish, water-bath is concentrated near dry, add appropriate kieselguhr to mix thoroughly, be transferred in 250ml conical flask, precision adds ethanol 100ml, weighed weight, supersound process 30 minutes, taking-up lets cool, weighed weight, add ethanol and supply the weight of less loss, shake up, filter, precision measures subsequent filtrate 50ml in the evaporating dish of dry constant weight, water-bath is waved most ethanol and is concentrated into dry, be dried to constant weight in 105 DEG C, move in exsiccator, cooling 30 minutes, rapid accurately weighed weight, calculate ethanol-soluble extractives content.

2. the yield of dry cream

It is a certain amount of that precision measures under orthogonal test item extracting solution, puts in the evaporating dish that is dried to constant weight, in water-bath after evaporate to dryness, is dried to constant weight in 105 DEG C, moves in exsiccator, and cooling 30 minutes, rapid accurately weighed weight, calculated yield of extract.

Orthogonal experiments and analysis in table 18,19.

Table 18 orthogonal experiments

Note: comprehensive grading=paste-forming rate * 50/18.62+ ethanol-soluble extractives * 50/8.47

Table 19 variance analysis

From intuitive analysis, the factor order that affects extraction effect is: D > C > A > B, the results of analysis of variance shows: D factor has the impact of utmost point significance to experimental result, and C factor has appreciable impact to result, with A ₂b ₃c ₃d ₃combination is best, and Penthorum chinense medical material adds 10 times of water gagings, soaks 45min, decocts each 90 minutes 3 times.

For confirming quality and the stability of this technique, according to screened optimum condition, to A ₂b ₃c ₃d ₃process certification three times, the results are shown in Table 20.

Table 20 demonstration test

Above demonstration test shows: the extraction process of Penthorum chinense is stablized, reasonable.

4, impurity removal process

The remove impurity of 4.1 alcohol extracts

Rhizoma Polygoni Cuspidati and Radix Sophorae Tonkinensis alcohol extract impurity are less, therefore directly select to filter the solid impurity of removing in medicinal liquid.

The remove impurity of 4.2 Rhizoma Coptidis aqueous extracts

In Rhizoma Coptidis decocting liquid because the alkaloids such as berberine are soluble in hot water, therefore and method centrifugal to Rhizoma Coptidis aqueous extract employing insulation carried out remove impurity, high speed centrifugation remove impurity is a kind of physical separation method, separation degree is directly related with centrifuge speed, rotating speed is higher, and to remove impurity more, for ensureing curative effect, control the quality of the pharmaceutical preparations, centrifugal rotational speed is investigated.

Experimental technique: get a certain amount of Rhizoma Coptidis, complying with screened process conditions extracts, filter while hot, get certain volume filtrate number part, centrifugal with the rotating speed of 4000,6000,8000,12000 revs/min respectively, get again each centrifugal liquid and measure respectively content of berberine hydrochloride and dry cream yield, the results are shown in Table 21.

The comparison of table 21 different rotating speeds impurity-eliminating effect

Above result shows: in the time that rotating speed 6000 turns above, paste-forming rate declines several unchanged, and content of berberine hydrochloride is also several unchanged, and therefore selecting rotating speed is 6000r/min.

The remove impurity of 4.3 Penthorum chinense aqueous extracts

List of references, the remove impurity of Penthorum chinense mostly is alcohol deposition method, therefore adopts alcohol deposition method to carry out remove impurity to it, and during to precipitate with ethanol when relative density and precipitate with ethanol determining alcohol examine or check.

4.3.1 the examination of precipitate with ethanol relative density

Get Penthorum chinense a certain amount of, extract by the preferred extraction process of orthogonal test, get certain volume number part, being concentrated into respectively relative density is 1.05-1.1,1.1-1.15,1.15-1.18, adds ethanol to reaching 60% containing alcohol amount, stirs, leave standstill 24h, filter, measure ethanol-soluble extractives and the dry cream yield of filtrate, the results are shown in Table 22.

The examination of table 22 precipitate with ethanol relative density

Above result shows: relative density on precipitate with ethanol after the impact of ethanol-soluble extractives and dry cream yield little, but relative density is larger fewer by alcohol amount, from cost-saving angle, while selecting precipitate with ethanol, relative density is 1.15-1.18.

4.3.2 the examination of determining alcohol when precipitate with ethanol

Get a certain amount of Penthorum chinense, extract by the preferred technique of orthogonal test, being concentrated into relative density is 1.15-1.18, add ethanol to reaching respectively 50%, 60%, 70% containing alcohol amount, stir, leave standstill 24h, filter, measure ethanol-soluble extractives and the dry cream yield of filtrate, the results are shown in Table 23.

Table 23 precipitate with ethanol determining alcohol examination result

Above result shows: when precipitate with ethanol, determining alcohol is not too large on the impact of result, but determining alcohol ethanol-soluble extractives is compared with high and paste-forming rate is moderate while reaching 60%, while therefore selecting precipitate with ethanol, determining alcohol is 60%.

4.5 concentration technology researchs

4.5.1 alcohol extract concentration technology research

Rhizoma Polygoni Cuspidati, Radix Sophorae Tonkinensis alcohol extract need to reclaim ethanol after filtering, reconcentration is to the clear paste of certain relative density, we adopt the method (80 DEG C of temperature, vacuum-0.08～-0.1Mpa) of decompression recycling ethanol to reclaim ethanol, and then it is for subsequent use under the condition of vacuum-0.08～-0.1Mpa, to be concentrated into the clear paste of relative density 1.03～1.05 (60 DEG C).And emodin content before and after concentrated is examined or check, result is as follows:

Changes of contents after table 24 alcohol extract recovery ethanol concentrating under reduced pressure

Result shows, adopts above condition to carry out concentrating under reduced pressure, and loss of effective components is little.

4.5.2 the concentration technology of Rhizoma Coptidis aqueous extract

The centrifugal rear employing concentrating under reduced pressure of Rhizoma Coptidis aqueous extract, controls 80 DEG C of thickening temperatures, vacuum-0.08～-0.1Mpa, and the clear paste that medicinal liquid is concentrated into relative density 1.03～1.05 (60 DEG C) is for subsequent use.Measure concentrated front and back content of berberine hydrochloride and change, result is as follows:

The variation of content before and after table 25 Rhizoma Coptidis aqueous extract is concentrated

Result shows, adopts above condition to carry out concentrating under reduced pressure, and loss of effective components is little.

4.5.3 the concentration technology of Penthorum chinense extracting solution

After Penthorum chinense aqueous extract precipitate with ethanol, need to reclaim ethanol, reconcentration is to the clear paste of certain relative density, we adopt the method (80 DEG C of temperature, vacuum-0.08～-0.1Mpa) of decompression recycling ethanol to reclaim ethanol, and then it is for subsequent use under the condition of vacuum-0.08～-0.1Mpa, to be concentrated into the clear paste of relative density 1.03～1.05 (60 DEG C).Result is as follows:

Ethanol-soluble extractives measurement result before and after table 26 Penthorum chinense is concentrated

Above result shows, before and after concentrated, ethanol-soluble extractives content is several unchanged, therefore under 80 DEG C of temperature, vacuum-0.08～-0.1Mpa, reclaim ethanol, and it is for subsequent use under the condition of vacuum-0.08～-0.1Mpa, to be concentrated into the clear paste of relative density 1.03～1.05 (60 DEG C).

Below further prove beneficial effect of the present invention by the test of pesticide effectiveness.

Test example 1 pharmaceutical composition anti-hepatitis virus experiment of the present invention

1, experiment material

1.1 medicine

1.1.1 tested medicine

Pharmaceutical composition extractum of the present invention: 1g extract powder is equivalent to crude drug in whole 6.8g, is prepared by embodiment 1.Lot number 081101.Quantity 32g crude drug in whole/day, by the general body weight of adult, about 60kg calculates, and people is approximately 0.533g crude drug in whole/kg with dosage.When experiment, adopt with batch extract powder, get this product grind after adding distil water be made into 53.4,106.5,213g (crude drug in whole) dl ^-1three kinds of concentration liquids respectively for little, in, heavy dose of group, matched group is to distilled water.Experiment mice, rat be little, in, heavy dose is set to 2.67g crude drug in whole/kg, 5.33g crude drug in whole/kg, 10.7g crude drug in whole/kg (be equivalent to respectively to intend recommend clinical dosage 5 times, 10 times and 20 times).

1.1.2 positive drug

Silybin meglumine tablets, Xieli Pharmaceutical Co., Ltd., Hunan produces, lot number 20081201;

Lamivudine, GlaxoSmithKline PLC

XIAOYAN LIDAN PIAN, Shenzhen TongAn Pharmaceutical Co., Ltd. produces, lot number 100801;

SHENGMAI ZHUSHEYE, SZYY Group Pharmaceutical Limited. produces, lot number 10072302.

1.2 animal

SD rat, Da Shuo bio tech ltd, Chengdu provides, and dispensing feedstuff.The quality certification number: scxk (river) 2008-24.

KM mice, body weight 20 ± 2g, Da Shuo bio tech ltd, Chengdu provides, and dispensing feedstuff.The quality certification number: scxk (river) 2008-24.

Feeding environment, meets SPF level barrier system, credit number 057.20 ± 2 DEG C of receptacle temperature, relative humidity (60 ± 15) %.Laboratory animal divides cage to feed by sex, and every cage is raised with 5 of sex rat/mouse at most.

1.3 reagent and instrument

Acetone: Chengdu Ke Long chemical reagent factory, lot number 20080613;

Sodium sulfide: Beibei, chongqing chemical reagent factory, lot number 041023;

Formaldehyde: Chengdu Noah's ark chemical reagent factory, lot number 20080623;

Sodium chloride injection (0.9%), Kelun Pharm Ind Co., Ltd., Sichuan, lot number M090611.

Precision balance: Switzerland prunus mume (sieb.) sieb.et zucc. Teller-Tuo benefit AB204-E type precise electronic balance

Visible uv-spectrophotometric instrument: T6 new century, Beijing Puxi General Instrument Co., Ltd

Electronic balance: ACS-3H-B type, Jin Li electronic scale company limited of Zhongshan city produces

2, vitro Drug antivirus action of the present invention

2.1 medicine preparations

Take 5 grams of pharmaceutical composition extract powders of the present invention, be dissolved in culture fluid with two subunit sulfoxides, sterile distilled water is diluted to variable concentrations, and each dilution factor is respectively 5mg/ml, 2.5mg/ml, 1.25mg/ml, 625 μ g/ml, 312 μ g/ml, 156 μ g/ml, 78 μ g/ml, 39 μ g/ml, 20 μ g/ml, 10 μ g/ml containing crude drug amount.

2.2 toxicity trial

By the digestion of HepG2.2.15 cell routine, making cell concentration is 1.0 × 10 ⁵the cell suspension of individual/ml, is inoculated in 96 orifice plates, and every hole 100ul is placed in 37 DEG C, 5%CO ₂, in the incubator of 95% humidity, cultivate 24h, be grouped into 3 concentration lamivudines (300 μ g/ml, 200 μ g/ml, 100 μ g/ml), 10 concentration pharmaceutical composition (5mg/ml of the present invention, 2.5mg/ml, 1.25mg/ml, 625 μ g/ml, 312ug/ml, 156ug/ml, 78ug/ml, 39ug/ml, 20ug/ml, 10ug/ml), 0.1% 2 subunit sulfoxide (DMSO), blank group, every group 4 multiple holes, within 48 hours, change liquid once, respectively at the 48th hour, 96 hours, within 192 hours, carry out cytotoxicity experiment, read OD value by microplate reader, wavelength 450/650nm.Be calculated as follows medicine half toxic concentration (TC50).

Half toxic concentration (TC50) computing formula: TC50=Antilog[B+ (50-< 50% inhibition percentage)/(> 50% inhibition percentage-< 50% inhibition percentage) × C], C=A-B in formula, A=log (> 50% drug level), B=log (< 50% drug level).

Three concentration lamivudines, 0.1%DMSO are to the equal no cytotoxicity of 2.2.15 cell, but pharmaceutical composition of the present invention has certain cytotoxicity and the enhancing of increasing along with concentration, the TC of pharmaceutical composition of the present invention to cell ₅₀2.113mg/ml.

The antivirus test of 2.3 pharmaceutical compositions of the present invention

By cell suspension inoculation in 24 orifice plates, be divided into DMSO group, lamivudine group (200ug/ml), 4 drug regimen substrate concentration groups of the present invention (312ug/ml, 156ug/ml, 78ug/ml, 39ug/ml), every group 4 multiple hole, every hole 600ul, within 48 hours, change liquid once, difference collecting cell supernatant and cell while changing liquid ,-80 DEG C frozen, to be measured.

2.3.1 supernatant HBsAg, HBeAg detect

Adopt enzyme-linked immunologic detecting kit (China of Shanghai section is biological) to detect supernatant HBsAg, HBeAg, strictly press the operation of test kit description.Inhibition percentage=(the OD of medicine to HBsAg/HBeAg _{control wells}-OD _{experiment hole})/OD _{control wells}× 100.50% inhibition concentration (TC50) is concentration when HBsAg, HBeAg suppression ratio are 50%.

HBeAg, HBsAg to 2.2.15 emiocytosis is inhibited for medicine of the present invention, and pharmaceutical composition of the present invention is proportionate to HBeAg, HBsAg suppression ratio and drug level and administration time, in the time of same concentration, pharmaceutical composition of the present invention is better than HBsAg to HBeAg inhibitory action, and in the time of d6,312 μ g/ml pharmaceutical composition of the present invention is better than lamivudine group (P < 0.01) to HBeAg, HBsAg inhibitory action.Specifically see Fig. 1,2.

2.3.2 in culture supernatant, HBVDNA detects

Adopt fluorescent quantificationally PCR detecting kit (reaching peace gene) to detect HBVDNA in supernatant, strictly press the operation of test kit description.Medicine suppression ratio=(matched group HBV DNA copy number-experimental group HRVDNA copy number)/matched group HBV DNA copy number x100% to HBV DNA.

Pharmaceutical composition of the present invention can reduce extracellular HBVDNA level to some extent, its suppression ratio and drug level and administration time are proportionate, in the time of d6,312ug/ml pharmaceutical composition of the present invention is better than lamivudine (P < 0.01) to extracellular HBVDNA inhibitory action, specifically sees Fig. 3.

2.3.3 in cell, HBVDNA detects

Adopt DNA extraction test kit (day root biochemistry) to extract total DNA in cell, adopt fluorescent quantificationally PCR detecting kit (reaching peace gene) to detect HBVDNA in cell, strictly press the operation of test kit description.Medicine suppression ratio=(matched group HBV DNA copy number-experimental group HRVDNA copy number)/matched group HBV DNA copy number x100% to HBV DNA.

Evaluate clinical drug application prospect, TI=TC with therapeutic index (TI) ₅₀/ IC ₅₀, TI > 2 is effective low toxicity, and 2 > TI > 1 are that poor efficiency is poisonous, and TI < 1 is toxic effect.Taking the drug effect TI of the 6th day as standard.

Pharmaceutical composition of the present invention can reduce HBVDNA level in cell to some extent, its suppression ratio and drug level and administration time are proportionate, but pharmaceutical composition of the present invention and lamivudine comparison, the two not statistically significant (P > 0.05), is specifically shown in Fig. 4.

2.4 pharmaceutical composition antiviral effect in vitro mechanism of the present invention

By concentration 1.0 × 10 ⁵the cell suspension inoculation of/ml is in 12 orifice plates, be divided into DMSO group, lamivudine group (200ug/ml), 2 drug regimen substrate concentration groups of the present invention (312ug/ml, 78ug/ml), every group 4 multiple hole, every hole 1000ul changes liquid once in 48 hours, difference collecting cell supernatant and cell while changing liquid,-80 DEG C frozen, to be measured.

2.4.1 the fluorescence quantitative PCR detection of OAS, PKRmRNA in cell

According to the Internet Biological Information Resources Aided Design primer sequence be: OASF:CAAGGTGGTAAAGGGTGGCT; OASR:CAAACTTCACGGAAAATGCTCT, 191bp; PKRF:TAACGAGAAGGCGGAGCG; PKRR:CCATTTGGATGAAAAGGCACT, 197bp; Trizol one-step method is extracted cell total rna, getting 2 μ g cell total rnas is that template is carried out reverse transcription, and performing PCR when reaction, getting the cDNA that 1 μ l reverse transcription obtains is template, testing gene primer concentration increases by 30pmol/50 μ l system, and pcr amplification condition is 94 DEG C of 4min; 94 DEG C of 0.5min; 60 DEG C of 0.5min; 72 DEG C of 0.5min, circulate 35 times; 72 DEG C of detection signals.

Pharmaceutical composition of the present invention can increase OAS, PKRmRNA level in cell, and with lamivudine group comparison, high and low concentration pharmaceutical composition group of the present invention difference has statistical significance (P < 0.05), specifically sees Fig. 5.

2.4.2 in cell, OAS, PKR albumen WesternBlot detect

Protein cleavage liquid cracking 30min for cell to be measured, 4 DEG C of centrifugal 20min of 13000r/min, get the supernatant that contains 50 μ g total proteins with 12%SDS-PAGE gel electrophoresis, spend the night after transferring film, room temperature sealing 4h on shaking table, film is placed in containing the confining liquid of 1: 500 primary antibodie or 1: 3000 internal reference primary antibodie and hatches 3h, Tris alkali-sodium chloride-polysorbas20 washing liquid (TBST) is washed film 3 times, within 1: 5000, concentration adds the anti-1.5h of hatching of goat-anti rabbit two, TBST washes film 3 times, chemical illuminating reagent is added on film, expose in darkroom immediately, develop a film, film is scanned, then use the gray value of UVP gel images processing system Labworks4.6 software analysis object band.

Pharmaceutical composition of the present invention can increase OAS, PKR protein level in cell, and with lamivudine group comparison, high concentration medicine group of the present invention difference has statistical significance (P < 0.01), specifically sees Fig. 6,7.

The hepatoprotective effect research of test example 2 pharmaceutical compositions of the present invention

Experiment material is with test example 1.

1, the impact of pharmaceutical composition of the present invention on carbon tetrachloride induced mice acute liver damage

60 of kunming mices, male and female half and half, be divided at random 6 groups, every group 10, be made as respectively blank group, model control group, large, medium and small three the dosage groups of tested medicine (2.67g, 5.33g, 10.7g crude drug in whole/kg are equivalent to respectively 5,10,20 times of quantity) and silibinin group (0.15g/kg).Administration group is with the 0.1ml/10g body weight drug solution of the above-mentioned dosage of gavage respectively, and blank and model control group are given isopyknic normal saline.Every day 1 time, successive administration 7 days.1h each Mus lumbar injection CCL except blank group after last medicine ₄0.1ml/10g, got blood after 16 hours, and separation of serum is measured ALT, AST by improvement reitman-frankel method.

The results are shown in Table 27, lumbar injection CCL ₄can cause mice serum ALT and AST value significantly increases, the large, medium and small dosage group of pharmaceutical composition of the present invention ALT, AST content all have decline in various degree, have significant difference.Show that pharmaceutical composition of the present invention causes acute liver to carbon tetrachloride and has good protective effect.

Table 27 pharmaceutical composition of the present invention is to CCl ₄the impact of induced mice acute hepatic injury model

Group	Dosage (g/kg)	Number of animals (only)	ALT(karU)	AST(karU)
					Blank	-	10	50.8±18.63**	83.7±19.25**
Pharmaceutical composition of the present invention	2.67	10	140.5±53.9	131.9±27.9*
					Pharmaceutical composition of the present invention	5.33	10	127.5±42.6*	134.8±29.0
Pharmaceutical composition of the present invention	10.67	10	114.5±32.2**	117.7±21.7**
					Silibinin	0.15	10	116.1±41.5*	99.5±17.7**
Model contrast	-	10	176.4±55.6	161.4±34.1

Note: compare * P < 0.05 with model, * * P < 0.01

2, the impact of pharmaceutical composition of the present invention on D-galactosamine induced mice acute liver damage

60 of kunming mices, male and female half and half, be divided at random 6 groups, every group 10, be made as respectively blank group, model control group, large, medium and small three the dosage groups of tested medicine (2.67g, 5.33g, 10.7g crude drug in whole/kg are equivalent to respectively 5,10,20 times of quantity) and silibinin group (0.15g/kg).Administration group is with the 0.1ml/10g body weight drug solution of the above-mentioned dosage of gavage respectively, and blank and model control group are given isopyknic normal saline.Every day 1 time, successive administration 7 days.After last medicine, 1h each Mus lumbar injection 600mg/kg D-galactosamine normal saline solution except blank group, got blood after 16 hours, and separation of serum is measured ALT, AST by improvement reitman-frankel method.

The results are shown in Table 28; lumbar injection D-galactosamine can cause mice serum ALT and AST value significantly increases; the big or middle dosage group of pharmaceutical composition of the present invention ALT, AST are obviously low compared with model group, show that pharmaceutical composition of the present invention causes acute liver to D-galactosamine and has protective effect to a certain degree.

The impact of table 28 pharmaceutical composition of the present invention on D-galactosamine induced mice acute hepatic injury model

Group	Dosage (g/kg)	Number of animals (only)	ALT(karU)	AST(karU)
					Blank	-	10	26.2±7.61**	78.5±12.3**
Pharmaceutical composition of the present invention	2.67	10	113.0±30.8	143.1±38.1
					Pharmaceutical composition of the present invention	5.33	10	106.0±17.2*	145.0±33.9
Pharmaceutical composition of the present invention	10.67	10	100.0±18.5*	135.2±25.9*
					Silibinin	0.15	10	94.5±31.9*	113.5±32.6**
Model contrast	-	10	141.5±49.4	170.4±31.6

Note: compare * P < 0.05 with model, * * P < 0.01

3, the impact of pharmaceutical composition of the present invention on rat chronic hepatic injury due to carbon tetrachloride

60 of SD rats, male and female half and half, be divided at random 6 groups, every group 10, be made as respectively blank group, model control group, large, medium and small three the dosage groups of tested medicine (2.67g, 5.33g, 10.7g crude drug in whole/kg are equivalent to respectively 5,10,20 times of quantity) and silibinin group (0.15g/kg).Administration group is with the 1ml/100g body weight drug solution of the above-mentioned dosage of gavage respectively, and blank and model control group are given isopyknic normal saline.Every day 1 time, successive administration 90 days.Administration is each Mus subcutaneous injection of carbon tetrachloride 2 times weekly except blank group simultaneously, continuous 3 months.After off-test, get blood, separation of serum, measures ALT, AST by improvement reitman-frankel method.

The impact of table 29 pharmaceutical composition of the present invention on rat chronic liver injury model due to CCl4

Group	Dosage (g/kg)	Number of animals (only)	ALT(karU)	AST(karU)
					Blank	-	10	26.5±8.18**	73.6±18.2**
Pharmaceutical composition of the present invention	2.67	10	77.5±20.2	111.8±21.2
					Pharmaceutical composition of the present invention	5.33	10	75.1±17.5	109.0±21.4
Pharmaceutical composition of the present invention	10.67	10	68.2±18.5*	103.0±16.8*
					Silibinin	0.15	10	64.7±18.8*	94.7±12.3**
Model contrast	-	10	83.8±14.5	125.9±27.8

Note: compare * P < 0.05 with model, * * P < 0.01

By known to table 29; subcutaneous injection of carbon tetrachloride 2 times weekly; within continuous 3 months, can cause rat blood serum ALT and AST value significantly increases, pharmaceutical composition of the present invention has certain protective effect to the rat chronic hepatic injury due to carbon tetrachloride, and ALT, AST are obviously reduced compared with animal pattern.In pathologic finding display model group liver, pseudolobuli extensively forms, and medicine group has some improvement.

The Study immune regulation of test example 3 pharmaceutical compositions of the present invention

Experiment material is with test example 1.

1, pharmaceutical composition of the present invention is engulfed the impact of chicken red blood cell ability on Turnover of Mouse Peritoneal Macrophages

50 of kunming mices, male and female half and half, be divided at random 5 groups, every group 10, be made as respectively blank group, large, medium and small three the dosage groups of tested medicine (2.67g, 5.33g, 10.7g crude drug in whole/kg are equivalent to respectively 5,10,20 times of quantity) and SHENGMAI ZHUSHEYE group (20ml/kg).Administration group is with the 0.1ml/10g body weight drug solution of the above-mentioned dosage of gavage respectively, and blank group is given isopyknic normal saline.Every day 1 time, successive administration 7 days.The each Mus lumbar injection 5% chicken red blood cell 0.4ml of 1h after last medicine, puts to death intraperitoneal injection of saline 2ml after 8 hours, after gently rubbing for several times, extract peritoneal fluid 1ml, drip and be applied on clean slide, be put in the enamel tray that is lined with wet gauze, be placed in 37 DEG C of incubators 30 minutes, take out slide, with normal saline rinsing, dry, fix 5 minutes with acetone-methanol solution (1: 1), with 4% Ji Mu Sa-Rui Teshi liquid dyeing 5 minutes, distilled water rinsing, dried again.Under oily mirror, count 200 of macrophage numbers for every, be calculated as follows its phagocytic index and phagocytic percentage.

Phagocytic percentage=(engulfing macrophage/200 macrophage of chicken red blood cell) * 100%

Chicken red blood cell sum/200 macrophage of phagocytic index=engulfed

Table 30 pharmaceutical composition of the present invention is engulfed the impact of chicken red blood cell ability on Turnover of Mouse Peritoneal Macrophages

Note: with relatively * P < 0.05 of blank, * * P < 0.01, * * * P < 0.001

The results are shown in Table 30, result shows in pharmaceutical composition of the present invention, heavy dose of group Turnover of Mouse Peritoneal Macrophages phagocytic rate, phagocytic index are significantly increased compared with matched group, illustrate that pharmaceutical composition of the present invention can strengthen the phagocytosis of Turnover of Mouse Peritoneal Macrophages to chicken red blood cell, shows to have the function of certain enhancing immunity.

2, pharmaceutical composition of the present invention causes mice hemolytic antibody to cyclophosphamide and generates low impact

60 of kunming mices, male and female half and half, be divided at random 6 groups, every group 10, be made as respectively blank group, model control group, large, medium and small three the dosage groups of tested medicine (2.67g, 5.33g, 10.7g crude drug in whole/kg are equivalent to respectively 5,10,20 times of quantity) and SHENGMAI ZHUSHEYE group (20ml/kg).Administration group is with the 0.1ml/10g body weight drug solution of the above-mentioned dosage of gavage respectively, and blank and model control group are given isopyknic normal saline.Every day 1 time, successive administration 7 days.In addition all the other each group subcutaneous injection cyclophosphamide 20mg/kg except Normal group, 1 time/2 days, totally 3 times; After first administration 1h, every Mus is with 5% Sanguis Gallus domesticus ball 0.2ml lumbar injection immunity, each Mus was got blood 20ul in eye socket on 1, added 1ml normal saline, then added 4% chicken erythrocyte 0.5ml, 10% guinea pig serum 0.5ml, in 37 DEG C of water-baths, hatch 40min, ice bath cessation reaction, in the centrifugal 10min of 2000rpm, gets supernatant 1ml, add 3ml Dou Shi liquid, mix, after 10min, return to zero with Dou Shi liquid in 540nm, measure each pipe trap.

From table 31, Normal group has notable difference (P < 0.001) with model group ratio, and model group moulding success is described; The big or middle dosage group of pharmaceutical composition of the present invention and model group comparison, its trap significantly increases, and shows that pharmaceutical composition of the present invention causes mice hemolytic antibody to cyclophosphamide and lowly has obvious antagonism.

Table 31 pharmaceutical composition of the present invention is on the low impact of caused by cyclophosphamide mice Hemolysin formation

Note: compare * P < 0.05 with model, * * P < 0.01, * * * P < 0.001

The choleretic effect research of test example 4 pharmaceutical compositions of the present invention

Experiment material is with test example 1.

50 of SD rats, male and female half and half, be divided at random 5 groups, every group 10, be made as respectively blank group, large, medium and small three the dosage groups of tested medicine (2.67g, 5.33g, 10.7g crude drug in whole/kg are equivalent to respectively 5,10,20 times of quantity) and XIAOYAN LIDAN PIAN group (6/kg).Fasting be can't help water 12 hours, with after 10% chloral hydrate (3ml/kg) intraperitoneal injection of anesthesia, faces upward position and fixes, along abdomen median line otch 2cm, find stomachus pyloricus, upset duodenum finds the bile duct of white flexible in descendant duodenum mesentery.Under bile duct, wear 2 rhizoid lines, ligation pars papillaris, makes one " V " shape otch to liver direction, inserts plastic tube (having as seen faint yellow bile to flow out), and ligation is fixed, and collects bile.Postoperatively close stomach wall with hemostasis clamp, saline gauze covers; Postoperative stablizing 20 minutes, first collect 30 minutes bile as administration before data, then respectively organize rat by respectively administration of duodenum, administration group is filled with respectively the drug solution with above-mentioned dosage with 1ml/100g body weight, blank group is given isopyknic normal saline.Within after administration every 30 minutes, collect bile 1 time, totally 3 times, record choleresis.

The results are shown in Table 32, result shows, pharmaceutical composition of the present invention has certain promotion bile secretion effect.

The impact of table 32 pharmaceutical composition of the present invention on rat bile secretory volume

Note: compare * P < 0.05 with model, * * P < 0.01

The clinical trial of test example 5 medicine therapeutic virus hepatitis B of the present invention

A: function: eliminating damp-heat, removing toxic substances pain relieving, dissipating blood stasis protect the liver.Cure mainly Type B viral hepatitis, traditional Chinese medical science dampness-heat in the liver and gallbladder folder stasis of blood type, disease is seen distending pain over the hypochondrium and twinge, irritated irritability, visible jaundice or without jaundice, bitter taste is indigestion and loss of appetite, vomiting and nausea abdominal distention, fatigue and weakness, yellow fur or yellow greasy, wiry and frequent pulse etc.

B: diagnostic criteria:

(1) Western medicine diagnose standard

1. clinical main manifestations be weak, loss of appetite, feel sick, vomiting, hepatomegaly and liver function injury, some patients were can have jaundice and heating, inapparent infection is also more common.

2. etiological diagnosis has following any 1 positive, and diagnosable is existing disease HBV infection: the serum HbsAg positive; The serum HBV DNA positive; The anti-HBc IgM of serum titre is high, and anti-HbcIgG is negative or low-level.

(2) the dialectical standard of traditional Chinese medical science dampness-heat in the liver and gallbladder folder stasis of blood type

3. primary symptom: yellow skin and eye, yellow distinct, the pain over the hypochondriac region, the vexed abdominal distention of gastral cavity, dysphoria with smothery sensation, xerostomia and hardship, yellowish or reddish urine, red tongue, yellow and greasy fur.

4. time disease: inappetence, nausea and vomiting, sleepy weak, skin pruritus, constipation or thin, stringy and rolling pulse number.

C: curative effect of disease criterion (combining " viral hepatitis is prevented and treated scheme " formulation of revision with reference in JIUYUE, 2000 Chinese Medical Association infectious disease with parasitic disease credit meeting, the Xi'an meeting of hepatopathy association)

(1) effective: transference cure, liver spleen recovers normal or retraction, and without tenderness and kowtow pain, liver function recovery is normal, and HBV DNA, HbeAg, the equal the moon of HbsAg turn.Above indices is stablized more than 6 months.

(2) effective: symptom obviously alleviates or disappears, and hepatosplenomegaly is stable and constant, without obvious tenderness and kowtow pain, liver function test recover normally or the front exceptional value for the treatment of decline more than 50%, HBV DNA, HbeAg, HbsAg have 1 the moon to turn.

D a: daily dose: group 1: Rhizoma Polygoni Cuspidati 15g, Radix Sophorae Tonkinensis 6g, Penthorum chinense 24g, Rhizoma Coptidis 5g; Group 2: Rhizoma Polygoni Cuspidati 12g, Radix Sophorae Tonkinensis 6g, Penthorum chinense 12g, Rhizoma Coptidis 2g; Group 3: Rhizoma Polygoni Cuspidati 12g, Radix Sophorae Tonkinensis 3g, Penthorum chinense 9g, Rhizoma Coptidis 5g; Group 4: Rhizoma Polygoni Cuspidati 9g, Radix Sophorae Tonkinensis 4.5g, Penthorum chinense 18g, Rhizoma Coptidis 3.5g; Be prepared into capsule by the method for embodiment 1, oral, one time 3,3 times on the one, 3 months courses for the treatment of.

Result of the test:

Effective 28 examples of group 1:60 example account for 77.8%, and effective 4 examples account for 4.8%

Effective 62 examples of group 2:72 example account for 86.1%, and effective 8 examples account for 11.1%

Effective 21 examples of group 3:58 example account for 63.8%, and effective 3 examples account for 5.2%

Effective 43 examples of group 4:66 example account for 65.2%, and effective 3 examples account for 4.5%

From the above results, each proportioning group all has effect for the treatment of hepatitis B, wherein to organize drug effect the best of 2.

Above-mentioned effect experiment and clinical test results explanation: the test of (one) extracorporeal antivirus effect shows that pharmaceutical composition of the present invention can reduce HBVDNA in extracellular HBsAg, HBeAg, HBV DNA and cell in various degree, this effect has time and drug level dependency, and pharmaceutical composition of the present invention can increase the mRNA level of OAS, PKR in cell, strengthen OAS, PKR protein level.Show that pharmaceutical composition of the present invention inside and outside all has anti-certain anti-HBV effect.(2) pharmaceutical composition of the present invention can obviously suppress Serum ALT and AST value that carbon tetrachloride causes acute liver and increases; D-galactosamine is caused to the Serum ALT of acute liver and AST value to be increased and also has remarkable inhibition; Can make Serum ALT and the AST value of rat chronic hepatic injury due to carbon tetrachloride increase obvious reduction, pathological section shows to improve hepatic injury.Show that pharmaceutical composition of the present invention has significant hepatoprotective effect.(3) pharmaceutical composition of the present invention is engulfed chicken red blood cell ability to Turnover of Mouse Peritoneal Macrophages and is significantly increased, and Turnover of Mouse Peritoneal Macrophages phagocytic rate, phagocytic index are significantly increased compared with matched group; Cyclophosphamide is caused to mice hemolytic antibody and generate the effect that is lowly significantly improved.Show that pharmaceutical composition of the present invention has good raising immunity function.(4) pharmaceutical composition of the present invention improves to rat bile secretory volume, shows that pharmaceutical composition of the present invention has certain choleretic effect.

Claims (8)

1. a pharmaceutical composition of preventing and treating hepatitis B, is characterized in that: it is the preparation being prepared from by the crude drug of following weight proportion:

12 parts of Rhizoma Polygoni Cuspidati, 6 parts of Radix Sophorae Tonkinensiss, 12 parts of Penthorum chinense, 2 parts of Rhizoma Coptidis.

2. pharmaceutical composition according to claim 1, it is characterized in that: it is to be active component by the raw material medicated powder of Rhizoma Polygoni Cuspidati, Radix Sophorae Tonkinensis, Penthorum chinense, Rhizoma Coptidis or extractive with organic solvent, adds pharmaceutically acceptable adjuvant or complementary composition to be prepared into pharmaceutically conventional preparation.

3. pharmaceutical composition according to claim 2, is characterized in that: described preparation is decoction, powder, pill, granule, tablet, capsule, oral liquid or drop pill.

4. pharmaceutical composition according to claim 3, is characterized in that: in described capsule, every contains Rhizoma Polygoni Cuspidati with emodin C ₁₅h ₁₀o ₅meter, must not be less than 4.50 mg.

5. a method of preparing the pharmaceutical composition described in claim 1-4 any one, it comprises the steps:

(1) get the crude drug of recipe quantity, pulverize, medicated powder is for subsequent use; Or

(2) get the crude drug of recipe quantity, add water or organic solvent extraction, the active component that extracts gained is for subsequent use;

(3) get the medicated powder of step (1) gained or the active component of step (2) gained, add pharmaceutically conventional adjuvant or complementary composition, be prepared into pharmaceutically conventional preparation.

6. the preparation method of pharmaceutical composition according to claim 5, is characterized in that: described preparation is capsule, and its preparation method is:

A, get 6 parts of 12 parts of Rhizoma Polygoni Cuspidati and Radix Sophorae Tonkinensiss, add the 60%-80% ethanol of 6-8 times of medical material weight, reflux, extract, 1-3 time, each 60-120min, merges alcohol extract, filters, decompression recycling ethanol, concentrated, concentrated solution is for subsequent use;

B, get 12 parts of Penthorum chinense, add 6-10 times of medical material weight water, soak 30-45min, decocts 1-3 time, each 60-90min, merge extractive liquid,, after concentrating under reduced pressure, adds ethanol to reaching 60% containing alcohol amount, precipitate with ethanol, filtration, decompression recycling ethanol, concentrates, and concentrated solution is for subsequent use;

C, get 2 parts of Rhizoma Coptidis, add 6-10 times of medical material weight water, soak 30-60min, decocts 1-3 time, each 40-80min, merging Rhizoma Coptidis extract, after remove impurity, concentrates, and concentrated solution is for subsequent use;

D, merge above-mentioned each concentrated solution, adopt conventional method of granulating to granulate, encapsulated, to obtain final product.

7. the preparation method of pharmaceutical composition according to claim 6, is characterized in that: the preparation method of described capsule is:

A, get 6 parts of 12 parts of Rhizoma Polygoni Cuspidati and Radix Sophorae Tonkinensiss, add 60% ethanol of 8 times of medical material weight, reflux, extract, 3 times, each 120min, merges alcohol extract, filters, under 80 DEG C of temperature, vacuum-0.08 ~-0.1Mpa, reclaim ethanol, the clear paste that is concentrated into 60 DEG C of surveys 1.03 ~ 1.05 of relative density is for subsequent use;

B, get 12 parts of Penthorum chinense, add 10 times of medical material weight water, soak 45min, decoct 3 times, each 90min, merges Penthorum chinense extracting solution, and under 80 DEG C of temperature, vacuum-0.08 ~-0.1Mpa, being concentrated into relative density is 1.15-1.18, add ethanol to reaching 60% containing alcohol amount, stir, leave standstill 24h, filter, under 80 DEG C of temperature, vacuum-0.08 ~-0.1Mpa, reclaim ethanol, the clear paste that is concentrated into 60 DEG C of surveys 1.03 ~ 1.05 of relative density is for subsequent use;

C, get 2 parts of Rhizoma Coptidis, add 8 times of medical material weight water, soak 45min, decoct 3 times, each 60 minutes, merge Rhizoma Coptidis extract, taking rotating speed as 6000 r/min are centrifugal, the clear paste that is concentrated into 60 DEG C of surveys 1.03 ~ 1.05 of relative density under 80 DEG C of temperature, vacuum-0.08 ~-0.1Mpa is for subsequent use;

D, merge above-mentioned each clear paste, be that under 90 ~ 100 DEG C of conditions, spraying is dry in 180 ~ 200 DEG C of inlet temperature, leaving air temp, collect spray powder, in relative humidity lower than 60.5%, dry granulation under the condition that temperature is 18～22 DEG C, principal pressure 4.5～5.5Mpa, lateral pressure 0.25Mpa, sieves, and collects the granule of 40 ~ 60 mesh sieves, encapsulated, to obtain final product.

8. the pharmaceutical composition described in claim 1-4 any one protects the liver, strengthens the purposes in the medicine of immunity or function of gallbladder promoting, prevention or treatment hepatitis B in preparation.