CN102517391A - Method for detecting leopard bone component in mixture and primer applied - Google Patents
Method for detecting leopard bone component in mixture and primer applied Download PDFInfo
- Publication number
- CN102517391A CN102517391A CN2011104380523A CN201110438052A CN102517391A CN 102517391 A CN102517391 A CN 102517391A CN 2011104380523 A CN2011104380523 A CN 2011104380523A CN 201110438052 A CN201110438052 A CN 201110438052A CN 102517391 A CN102517391 A CN 102517391A
- Authority
- CN
- China
- Prior art keywords
- seq
- mixture
- nos
- leopard
- leopard bone
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a method for detecting a leopard bone component in a mixture and a primer applied. The method mainly comprises steps of: extracting a total DNA from a mixture to be measured; carrying out PCR amplification by a specific primer, the extracted total DNA serving as a template, wherein the specific primer is one pair, two pairs or three pairs of primer selected from the group of SEQ ID Nos.1 and 2, SEQ ID Nos.3 and 4 and SEQ ID Nos.5 and 6; and carrying out analysis and determination on an amplification result. The invention further provides a kit containing the above primer for detecting leopard bone component in the mixture and especially for detecting whether a mixture is leopard bone medicinal material or detecting leopard bone component in a traditional Chinese medicine preparation using a drug of leopard bone or a substitute. The primer of the present invention has high singularity and sensitivity.
Description
Technical field
The present invention relates to the particularly method of leopard bone composition in the medicinal material of applied molecular biology technology for detection mixture; Relate to particularly detect medicinal material, or the Chinese medicine preparation that is used as medicine with leopard bone or substitute in the method for leopard bone composition, and used Auele Specific Primer in this method.
Background technology
Leopard bone is called river four legs, money leopard bone, derives from the bone of felid leopard Panthera pardus L. and other leopards.Leopard bone is used as medicine and in China's tradition tcm-, has over thousands of year history, has dispelling wind and removing obstruction in the collateral, strengthening the tendons and bones effect, is used to treat diseases such as rheumatic arthralgia, soreness of the waist and knees.But mainly adopt traditional form method for the discriminating of leopard bone at present, rely on discriminating personnel experience, subjectivity is high, therefore needs a kind of discrimination method that can be accurate and effective.
On the other hand, vertebrates Mitochondrial Genome Overview size is about 16kb, is the closed hoop structure, in cell, is the multiple copied form and is present in (different and different according to cell type) in the plastosome.The animal mitochondria gene is conservative on evolving, and follows strict matrilinear inheritance characteristic, and therefore be widely used in originating from evolutionary analysis and species are identified.
Contain the leopard bone mixture of ingredients for example medicinal material, or the process of manufacture of the Chinese medicine preparation that is used as medicine with leopard bone etc. in; Part DNA in the leopard bone can remain in wherein usually; Therefore, the leopard bone composition in the mixture can obtain to identify from the DNA detection that it carries.
Yet; On the mixture investigative technique that particularly the leopard bone composition is identified in medicinal material, the Chinese medicine preparation; Because the leopard bone dna content is very low in the mixture; And the composition that contains multiple inhibition PCR reaction, therefore, the DNA that how can effectively extract wherein is the key that Protocols in Molecular Biology is identified the leopard bone composition; Simultaneously, the mixture that contains leopard bone particularly also has other more plant-animal species in the Chinese medicine preparation usually, how to design another key that leopard species specificity primer also becomes authenticate technology.
Summary of the invention
One object of the present invention is to provide a kind of Protocols in Molecular Biology that utilizes to detect the particularly method of leopard bone composition in medicinal material, the Chinese medicine preparation of mixture, to differentiate whether contain the leopard bone composition in the mixture accurately and efficiently.
Another object of the present invention is to provide a kind of Protocols in Molecular Biology that is used for to detect the particularly Auele Specific Primer in the method for medicinal material, Chinese medicine preparation leopard bone composition of mixture.
Another object of the present invention is to provide a kind of Protocols in Molecular Biology that is used for to detect mixture and particularly need differentiate whether be medicinal material, or the test kit of the Chinese medicine preparation leopard bone composition that is used as medicine with leopard bone or substitute of leopard bone, wherein comprise primer of the present invention.
For reaching above-mentioned purpose, on the one hand, the invention provides a kind of method of utilizing Protocols in Molecular Biology to detect leopard bone composition in the mixture, this method mainly comprises:
From testing mixture, extract total DNA;
With the total DNA that is extracted is template, utilizes Auele Specific Primer to carry out polymerase chain reaction (Polymerase Chain Reaction, PCR) amplification;
Amplification is carried out analysis and judgement.
As previously mentioned; Usually, the mixture that contains leopard bone particularly medicinal material, or the Chinese medicine preparation that is used as medicine with leopard bone in, the leopard bone component content is very low; And also contain other more plant-animal species; The composition that also possibly contain multiple inhibition PCR reaction, in the case, design leopard species specificity primer is one of key of molecular Biological Detection technology of the present invention.
According to specific embodiments of the present invention; This case contriver has extracted total DNA from leopard bone, according to leopard Mitochondrial DNA of announcing among the NCBI and nuclear dna sequence dna design primer, through amplification, order-checking; Submit blastn comparison, analysis etc. to, designed leopard species specificity primer of the present invention.The leopard species specificity primer that is designed is for being selected from a pair of, the two or three pairs of primers among following SEQID Nos.1 and 2 (among the present invention also with this primer to called after L1F/R), SEQ ID Nos.3 and 4 (among the present invention also with this primer to called after L2F/R) and the SEQ ID Nos.5 and 6 (among the present invention also with this primer to called after L3F/R):
L1F/R：5’-TTAGGGGTATGTTTAAT-3’(SEQ?ID?NO：1)
5’-TTCAGCCATAATTTACA-3’(SEQ?ID?NO：2)
L2F/R：5’-CCGCTTTCTCATCAGTT-3’(SEQ?ID?NO：3)
5’-CTCGTCCTACATGCATGTAT-3’(SEQ?ID?NO：4)
L3F/R：5’-GCCGCGATGTAAATTAT-3’(SEQ?ID?NO：5)
5’-AGGCTGTGGCCATAACC-3’(SEQ?ID?NO：6)。
As previously mentioned, the mixture that contains leopard bone usually particularly medicinal material, or the Chinese medicine preparation that is used as medicine with leopard bone in the content of leopard bone DNA composition be very low, how can effectively extract DNA wherein, be another key that the present invention detects leopard bone composition technology.According to specific embodiments of the present invention, in the method for the present invention, the said process of from testing mixture, extracting total DNA may further comprise the steps:
Testing mixture was handled 20～40 minutes through boiling method;
Add CTAB and extract 60 ℃～70 ℃ digestion of damping fluid 2～4 hours;
With the imitative method extracting of phenol;
Add the isopropanol precipitating enrichment DNA;
Utilize the PCR purification kit to carry out purifying, obtain the total DNA that is extracted.
According to specific embodiments of the present invention; Aforesaid method of the present invention is particularly suitable for the total DNA of leopard bone in medicinal material mixture that is used as medicine with leopard bone or the Chinese medicine preparation is extracted; Even leopard bone component content content is low to moderate 0.5wt% (except that indicating especially, content described in the present invention and ratio are weight content and ratio) in medicinal material mixture or the Chinese medicine preparation, or (for example contains other multiple plant-animal compositions in medicinal material or the Chinese medicine preparation; Tongrentang's restorative bolus contains 58 flavor medicines; TONGREN DAHUOLUO WAN contains 50 flavor medicines; Deng), also can effectively extract DNA wherein.According to specific embodiments of the present invention, in the above-mentioned process of from testing mixture, extracting total DNA:
It mainly is smudge cells that said boiling method is handled the testing mixture sample; Can in testing mixture, add an amount of water (usually as required during concrete operations; The testing sample of per 3～5g total solid content adds 10ml water); Boil normally and can under normal pressure, carry out (about 100 ℃), boiling time 20～40 minutes, preferred 30 minutes～40 minutes.
Adding CTAB extraction damping fluid in the said testing sample after boiling and carry out digestion process, mainly is the polysaccharide polyphenol class material that destroys in the mixture.According to preferred specific embodiments of the present invention, used CTAB extracts consisting of of damping fluid: 3%CTAB, 100mM Tris-HCl pH 8.0,20mM EDTA pH 8.0,2.5M NaCl.Most preferred digestion process condition is: equal-volume mixes, and 65 ℃, 3 hours.
The imitative method extracting of said phenol mainly is that protein, pigment etc. are dissolved in organic impurity in the removal mixture.The imitative extractive concrete operations of method of phenol can be carried out according to the routine operation in affiliated field.According to the preferred embodiments of the invention; Phenol described in the present invention is imitative, and method is extractive is operating as: after the postdigestive sample of CTAB damping fluid is cooled to room temperature, add equal-volume phenol/chloroform/primary isoamyl alcohol (25: 24: 1); Mixing, centrifugal 20 minutes of 12000rpm gets supernatant; Add equal-volume chloroform/primary isoamyl alcohol (24: 1) again, mixing, centrifugal 20 minutes of 12000rpm gets supernatant.
Among the present invention, mainly be the deposition enrichment DNA to the above-mentioned Virahol that in the supernatant that the imitative method extracting of phenol obtains, adds.According to the preferred embodiments of the invention, concrete operations are: add the Virahol of equal-volume precooling, and mixing, centrifugal 20 minutes of 4 ℃ of 12000rpm abandon supernatant, and deposition is washed with 75% alcohol.For ease of the subsequent purification step, can the extract after the washing be dissolved with an amount of distilled water.
The step that the said PCR of utilization purification kit carries out purifying mainly is to remove residual water-soluble impurities such as pigment among the DNA.The field was commonly used under the PCR purification kit can adopt is purchased product, and concrete operations can be carried out according to the specification sheets of purification kit.
According to specific embodiments of the present invention, when containing more polysaccharose substance in the testing mixture, in the process of extracting total DNA; In the supernatant that obtains through the imitative method extracting of phenol; Also can add the LiCl overnight treatment,, add the isopropanol precipitating enrichment DNA afterwards again to remove residual polysaccharose substance.In addition, for utilizing the purified total DNA that obtains of PCR purification kit, also can carry out agarose gel electrophoresis and detect the DNA extraction situation.
In a specific embodiments of the present invention; Chinese medicine preparation or the mixed medicinal materials of described testing mixture for being used as medicine with leopard bone or its substitute (the for example pseudo-article of Bailey Myospalax Born or other species) wherein except that leopard bone or its substitute, also contains other multiple plant-animal compositions; For example; Restorative bolus contains 58 flavor medicines, and DAHUOLUO WAN contains 50 flavor medicines etc., and method of the present invention is to be used for detecting this Chinese medicine preparation or whether mixed medicinal materials is really to be used as medicine with leopard bone.In this specific embodiments, for effectively extracting total DNA wherein, be to carry out according to following operation: the testing mixture sample is pulverized, added suitable quantity of water (usually, the testing sample of per 3～5g total solid content adds 10ml water), normal pressure boiled 30 minutes～40 minutes; Add in the testing sample after boiling processing equal-volume CTAB extract damping fluid (20mMEDTApH 8.0 for 3%CTAB, 100mM Tris-HCl pH8.0,2.5MNaCl), 65 ℃ of digestion process 3 hours; Be cooled to room temperature afterwards, add equal-volume phenol/chloroform/primary isoamyl alcohol (25: 24: 1), mixing, centrifugal 20 minutes of 12000rpm gets supernatant; Add equal-volume chloroform/primary isoamyl alcohol (24: 1) again, mixing, centrifugal 20 minutes of 12000rpm gets supernatant; Add 1/4 volume 10M LiCl, mix back 4 ℃ and spend the night; Sample is got the Virahol that supernatant adds the equal-volume precooling centrifugal 30 minutes of 4 ℃ of 12000rpm then, and 4 ℃ of 12000rpm centrifugal 20 minutes behind the mixing, abandon supernatant; With getting an amount of distilled water dissolving after the 75% alcohol washing precipitation three times; Dissolved DNA is through PCR purification kit purifying; (specifically can adopt health is century PCR product purification test kit 50T to the total DNA that obtains extracting, and article No. CW0521 is on the operation basis of its instructions direct; Can suitably increase decon damping fluid wash volumes and number of times, to reach better purification effect).DNA behind the purifying can use 0.7% agarose gel electrophoresis Detection and Extraction situation.According to this process for extracting of the present invention, even the leopard bone component content is low to moderate about 0.5% in the testing mixture, also can effectively extract its DNA, be used for follow-up pcr amplification.
According to specific embodiments of the present invention, Protocols in Molecular Biology of the present invention detects mixture particularly in medicinal material, the Chinese medicine preparation etc. in the method for leopard bone composition, and said pcr amplification reaction condition is following:
Reaction system is 15 μ l, 10 * PCR damping fluid, 1～5.5 μ l wherein, dNTPs (2.5mM) 0.5～1.8 μ l; Each 0.5～1.5 μ l of upstream and downstream primer (10 μ M); Taq archaeal dna polymerase (5U/ μ l) 0.2～1.2 μ l, dna profiling (50ng/ μ l) 0.8～3 μ l, aseptic ultrapure water mend to 15 μ l;
Amplification condition: 95 ℃ of preparatory sex change 5min; 95 ℃ of sex change 30s, 48～68 ℃ of annealing 30s, 72 ℃ are extended 30s, totally 35～40 circulations; Last 72 ℃ are extended 7～10min.
Among the present invention, be with described primer to being that template is carried out pcr amplification with the DNA that is extracted respectively, that is, and the substance pcr amplification.In the said pcr amplification reaction condition, preferred annealing temperature is 50 ℃～64 ℃.More preferably, wherein, said primer is 50 ℃ to the optimum annealing temperature of SEQ ID Nos.1 and 2, and said primer is 63 ℃ to the optimum annealing temperature of SEQ ID Nos.3 and 4, and said primer is 64 ℃ to the optimum annealing temperature of SEQ ID Nos.5 and 6.
According to specific embodiments of the present invention; Protocols in Molecular Biology of the present invention detects mixture particularly in medicinal material, the Chinese medicine preparation in the method for leopard bone composition; It is said that amplification is carried out analysis and judgement mainly is to carry out qualitative analysis; Method for qualitative analysis can be that those of ordinary skills are known, and for example, this analytic process can comprise the product that shows said amplification with gel electrophoresis; According to whether amplifying the purpose fragment, whether there to be corresponding leopard bone composition in the qualitative detection testing mixture.
Among the present invention, described testing mixture can be meant and contain any mixture that maybe possibly contain the leopard bone composition, comprise medicinal material, Chinese medicine preparation etc.Particularly, when needs differentiate whether a certain medicinal material is leopard bone, need differentiate that perhaps a certain Chinese medicine preparation is when being used as medicine with the leopard bone or the substitute of other species, detection method particularly suitable of the present invention.Be appreciated that; Do not contain leopard species other structural constituent except that leopard bone in the testing mixture that method of the present invention was suitable for; Perhaps get rid of other structural constituent that contains leopard through other method; That is, method of the present invention is that the special Chinese medicine preparation that is used as medicine or is used as medicine with the substitute of leopard bone with leopard bone that is directed against detects, and differentiates and wherein whether contains the leopard bone composition.
According to specific embodiments of the present invention, Protocols in Molecular Biology of the present invention detect mixture particularly in medicinal material, the Chinese medicine preparation method of leopard bone composition also comprise:
The amplification of testing mixture sample is contrasted with the result that extraction DNA from leopard bone carries out pcr amplification, and analysis and judgement surveys whether there is the leopard bone composition in the mixture.From leopard bone, extracting the concrete operations of DNA can carry out according to biological technical field extracts DNA from single species routine operation.
According to specific embodiments of the present invention; Protocols in Molecular Biology of the present invention detects mixture particularly in medicinal material, the Chinese medicine preparation in the method for leopard bone composition; Be with primer to SEQ ID Nos.1 and 2, SEQ ID Nos.3 and 4 and SEQ ID Nos.5 and 6 carry out pcr amplification respectively; If amplify one, two or three corresponding target fragments, then preliminary judgement is surveyed and is had the leopard bone composition in the mixture.Particularly with primer to SEQ ID Nos.1 and 2, SEQ ID Nos.3 and 4 and SEQ ID Nos.5 and 6 carry out pcr amplification respectively, the corresponding target fragment that all can increase is then surveyed and is had the leopard bone composition in the mixture.
On the other hand; The present invention also provides the primer of the method that is used for realizing detection mixture leopard bone composition according to the invention, and this primer comprises and being selected from: SEQ ID Nos.1 and 2, SEQ ID Nos.3 and 4 and SEQ ID Nos.5 and 6 in a pair of, two or three pairs of primers.
Above-mentioned primer of the present invention is right; Particularly need differentiate whether be whether to exist in the leopard bone composition in the medicinal material of leopard bone, the Chinese medicine preparation that is used as medicine with leopard bone or substitute to have application prospect detecting mixture; Can whether contain the leopard bone composition in the specific detection testing mixture, and detection sensitivity is high; When the leopard bone component content that comprises in the mixture is 0.5% (mass percent), also can effectively extract and detect specifically.
On the other hand, the present invention also provides a kind of test kit that detects leopard bone composition in the mixture, comprises primer of the present invention in this test kit, preferably also can further comprise corresponding PCR damping fluid, dNTPs, archaeal dna polymerase etc.Particularly, wherein said primer be primer of the present invention to SEQ ID Nos.1 and 2, SEQ ID Nos.3 and 4 and SEQ ID Nos.5 and 6 in a pair of, two or three pairs of primers.
Beneficial effect
In sum, the present invention has extracted total DNA from contain the leopard bone mixture of ingredients, has designed leopard species specificity primer, contains leopard bone or pseudo-article mixture of ingredients DNA with said leopard species specificity primer PCR amplification respectively.Amplimer that the present invention designed and amplification method have higher specificity; And detection sensitivity is high; Can be separately as a kind of method for quick be applied to contain leopard bone or pseudo-article mixture of ingredients particularly medicinal material, Chinese medicine preparation detect, exactly in the qualitative detection mixture leopard bone composition have a situation.
Description of drawings
Fig. 1 shows the agarose electrophoresis detected result of from different medicinal materials, extracting total DNA according to the method for the embodiment of the invention 1.Among the figure, M is 100bp DNALadder, swimming lane 1: Goral Horn powder, swimming lane 2: Cornu Saigae Tataricae powder, swimming lane 3: Bailey Myospalax Born, swimming lane 4: leopard bone.
Fig. 2 shows the agarose electrophoresis detected result of from some semifinished or finished goods Chinese medicine preparations, extracting total DNA.Wherein, swimming lane 1: Tongrentang's restorative bolus half patent medicine (leopard bone side); Swimming lane 2: Tongrentang's restorative bolus patent medicine (leopard bone side); Swimming lane 3: Tongrentang's restorative bolus half patent medicine (Bailey Myospalax Born substitutes the side); Swimming lane 4: Tongrentang's restorative bolus patent medicine (Bailey Myospalax Born substitutes the side); Swimming lane 5: Lingyang lung clearing ball half patent medicine (sheep's horn side); Swimming lane 6: Lingyang lung clearing ball patent medicine (sheep's horn side); Swimming lane 7: Lingyang lung clearing ball half patent medicine (Goral Horn side); Swimming lane 8: Lingyang lung clearing ball patent medicine (Goral Horn side); M is DL2000.
Fig. 3 shows that utilizing universal primer is the product sequencing result that template is carried out pcr amplification to SEQ ID Nos.7 and 8 with the DNA that from leopard bone, extracts.Among the figure, the top sequence is to do contrast with Sialon (Myospalax baileyi) sequence, and the below sequence is leopard (Panthera pardus) sequence.
Fig. 4 shows the special primer result who is used for the detection of leopard species according to leopard species specific molecular marker (SNP) characteristic Design.Wherein, the top sequence is leopard species sequences, and the below sequence is the Sialon sequence, indicates part in the square frame and is institute's designed primer part.
Fig. 5 is the agarose gel electrophoresis detected result with leopard species specificity primer PCR amplification different mixtures sample DNA of the present invention.Wherein, swimming lane 1 is a restorative bolus (leopard bone side), and swimming lane 2 is a TONGREN DAHUOLUO WAN (leopard bone side); Swimming lane 3 is restorative bolus (Bailey Myospalax Born substitutes the side), and swimming lane 4 is TONGREN DAHUOLUO WAN (Bailey Myospalax Born substitutes the side), and swimming lane 5 is the leopard bone medicinal material; Swimming lane 6 is pseudo-article medicinal material, and swimming lane 7 is a blank.
Embodiment
In order more to be expressly understood the present invention, further describe the present invention with reference to the following example and accompanying drawing at present.Embodiment only is used for explaining and does not limit the present invention in any way.
The experimental technique of unreceipted actual conditions is ordinary method and the normal condition that affiliated field is known among the embodiment, or the condition of advising according to manufacturers; The all commercially available acquisition of used various chemical reagent among the embodiment, each reagent is except that mark, all available from Beijing chemical reagents corporation; The primer entrusts Invitrogen company synthetic.
The leopard bone composition is identified in embodiment 1 restorative bolus (leopard bone side)
1, the extraction of the total DNA of leopard bone
This extraction step can carry out according to the routine operation in affiliated field.The concrete operations of present embodiment are following: leopard bone grinds to form fritter with mortar, and (48 hours rears of 10%EDTA solution (pH 7.0) can be used for DNA extraction through the EDTA decalcification earlier.Add 1ml lysate A (10mM Tris-HCl pH8.0,0.1MEDTApH8.0,0.5%SDS, 200 μ g/ml Proteinase Ks) in the 200 μ g samples (leopard bone after the decalcification, first starting weight), 55 ℃ of digestion are spent the night.The centrifugal 15min of sample digestion 12000rpm gets supernatant and carries out the imitative extracting of phenol.Use 2 times of volume absolute ethyl alcohol deposit D NA afterwards, wash deposition twice with 75% ethanol again, an amount of 50 μ l distilled waters dissolving.Sample DNA is through PCR purification kit (health is century PCR product purification test kit 50T, article No. CW0521, concrete operations are carried out to specifications) purifying, the DNA extraction sample.Detect through 0.7% agarose gel electrophoresis, the result sees also shown in Figure 1.
In addition, be that the raw material extraction obtains DNA according to the method described above with the Bailey Myospalax Born.Be raw material with Goral Horn, sheep's horn respectively in addition,, extract respectively and obtain DNA according to traditional method.The agarose gel electrophoresis detection of the DNA that each raw material extracted sees also shown in Figure 1.
2, the extraction of total DNA in the restorative bolus (leopard bone side)
Selecting 3 batches of (10 balls/batch) Tongrentang's restorative bolus patent medicine (leopard bone side) for use is testing sample.Every duplicate samples is got said restorative bolus (leopard bone side) patent medicine (58 flavor) 4g (about 1 ball), and wherein the leopard bone composition accounts for 0.5% (mass percent).With pill chopping, after fully dissolving with the 10ml distilled water, 100 ℃ of water-baths 30 minutes, ice bath cooled off in 10 minutes, and centrifugal 20 minutes of 4 ℃ of 12000rpm get supernatant; Add equal-volume (10ml) CTAB and extract damping fluid (3%CTAB, 100mM Tris-HCl pH 8.0,20mM EDTA pH 8.0,2.5M NaCl), 65 ℃ of water-baths 3 hours; Sample adds equal-volume phenol/chloroform/primary isoamyl alcohol (25: 24: 1) after being cooled to room temperature, slowly puts upside down mixing, and centrifugal 20 minutes of 12000rpm gets supernatant; Add equal-volume chloroform/primary isoamyl alcohol (24: 1), slowly put upside down mixing, centrifugal 20 minutes of 12000rpm gets supernatant; Add 1/4 volume 10M LiCl, slowly put upside down mixing and spend the night for back 4 ℃; Centrifugal 30 minutes of 4 ℃ of 12000rpm of sample get the Virahol that supernatant adds the equal-volume precooling, and slowly centrifugal 20 minutes of 4 ℃ of 12000rpm behind the mixing abandon supernatant; With getting an amount of distilled water dissolving after the 75% alcohol washing precipitation three times.Dissolved DNA through the PCR purification kit (health is century PCR product purification test kit 50T, article No. CW0521, operation is to specifications carried out, and increase decon damping fluid wash volumes to 350 μ l, washing times increases to purifying 2 times, obtains the DNA of purifying.The DNA of purifying is through 0.7% agarose gel electrophoresis Detection and Extraction situation, the result see also Fig. 2 (3 batches totally 30 routine sample extraction electrophorogram is similar basically as a result, only schematically provide a wherein routine situation among the figure).
In addition, respectively with Tongrentang's restorative bolus half patent medicine (leopard bone side) (3 batches, 10 balls/batch, every ball is a routine sample; About 4g), restorative bolus half patent medicine (Bailey Myospalax Born substitute side) (3 batches, 10 balls/batch, every ball is a routine sample, about 4g), (3 batches of restorative bolus patent medicine (Bailey Myospalax Born substitutes just); 10 balls/batch, every ball is a routine sample, about 4g), Lingyang lung clearing ball patent medicine (Goral Horn side) (3 batches, 5 balls/batch; Every ball is a routine sample, about 4g), Lingyang lung clearing ball half patent medicine (Goral Horn side) (3 batches, 5 balls/batch, every ball is a routine sample; About 4g), Lingyang lung clearing ball patent medicine (sheep's horn side) (3 batches, 5 balls/batch, every ball is a routine sample; About 4g), Lingyang lung clearing ball half patent medicine (sheep's horn side) (3 batches, 5 balls/batch, every ball is a routine sample; About 4g) is testing sample, according to the method described above, extracts respectively and obtained total DNA; The agarose gel electrophoresis of various testing samples detects and sees also (same, electrophorogram is similar basically as a result because the many cases of every kind of sample are extracted, and only schematically provides a wherein routine situation among the figure) shown in Figure 2.
Among the present invention, described " leopard bone side " is meant in this Chinese medicine it is with leopard bone be used as medicine (for example, described restorative bolus (leopard bone side) is meant in this restorative bolus it is to be used as medicine with leopard bone really) really; Described " Bailey Myospalax Born substitutes the side " is meant with the Chinese medicine of corresponding leopard bone side and compares, and difference mainly is it wherein is to substitute leopard bone with Bailey Myospalax Born to be used as medicine, and other component is basic identical; Do not contain other leopard structural constituent except that leopard bone in the said restorative bolus;
Described " sheep's horn side " is meant in this Chinese medicine is to be used as medicine with sheep's horn; Described " Goral Horn side " is meant with the Chinese medicine of corresponding sheep's horn side and compares, and difference mainly is it wherein is to be used as medicine with Goral Horn but not to be used as medicine with sheep's horn, and other component is basic identical; Do not contain leopard or Sialon structural constituent in the said Lingyang lung clearing ball.
3, species specificity primer and PCR reaction conditions
(1) design of leopard Auele Specific Primer:
According to leopard Mitochondrial Genome Overview sequence (NC_010641) that provides on the NCBI and close species plastosome complete sequence, through DNAstar at cytb zone design universal primer cytbF/R.Primer information is seen shown in the table 1, utilizes this primer to SEQ ID Nos.7 and 8, is masterplate to the DNA that extracts the purifying that obtains in aforementioned " 1, the total DNA of leopard bone extraction " process; (reaction system is 15 μ l to carry out pcr amplification; 10 * PCR damping fluid (commercially produced product includes Tris-HCl pH8.5100mM, KCl 500mM, MgCl215mM), 1.5 μ l wherein, dNTPs (2.5mM) 1.5 μ l; Each 0.5 μ l of upstream and downstream primer (10 μ M); Taq archaeal dna polymerase (5U/ μ l) 0.3 μ l, dna profiling (50ng/ μ l) 1 μ l, aseptic ultrapure water is mended to 15 μ l.Amplification condition: 95 ℃ of preparatory sex change 5min; 95 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 30s, 40 circulations; 72 ℃ are extended 10min), amplified production is submitted the online comparison of blastn (http://blast.ncbi.nlm.nih.gov/Blast.cgi) to through dna sequencing (sequencing result is referring to Fig. 3); Analyze, obtain leopard species specific molecular markers (SNP), utilize the SNP that exists in the leopard cytb sequence; Design the special primer that the leopard species detect that is used for of the present invention; Design of primers result is referring to shown in Figure 4, and wherein, the top sequence is the leopard sequence; The below sequence is the Sialon sequence, indicates part in the square frame and is institute's designed primer part.
Table 1 is used for the primer information of leopard Cytb district amplification
(2) referring to shown in Figure 4, leopard Auele Specific Primer title and sequence that the present invention designed are following:
L1F/R：5’-TTAGGGGTATGTTTAAT-3’(SEQ?ID?NO：1)
5’-TTCAGCCATAATTTACA-3’(SEQ?ID?NO：2)
L2F/R：5’-CCGCTTTCTCATCAGTT-3’(SEQ?ID?NO：3)
5’-CTCGTCCTACATGCATGTAT-3’(SEQ?ID?NO：4)
L3F/R：5’-GCCGCGATGTAAATTAT-3’(SEQ?ID?NO：5)
5’-AGGCTGTGGCCATAACC-3’(SEQ?ID?NO：6)。
(3) PCR reaction system and reaction conditions
DNA with the testing sample that extracted in aforementioned " 2, the extraction of total DNA in the restorative bolus (leopard bone side) " is a template, utilize primer SEQ ID Nos.1 and 2, SEQ ID Nos.3 and 4 and SEQ ID Nos.5 and 6 carry out pcr amplification respectively.The PCR reaction system is 15 μ l, wherein 10 * PCR damping fluid (Tris-HCl pH8.5100mM, KCl 500mM, MgCl
215mM) 1.5 μ l, dNTPs (2.5mM) 1.5 μ l, each 0.5 μ l of upstream and downstream primer (10 μ M), Taq archaeal dna polymerase (5U/ μ l) 0.3 μ l, dna profiling (50ng/ μ l) 1 μ l, aseptic ultrapure water is mended to 15 μ l.Amplification condition: 95 ℃ of preparatory sex change 5min; 95 ℃ of 30s, annealing temperature 30s, 72 ℃ of 30s, 40 circulations; 72 ℃ are extended 10min.
Each primer sees table annealing temperature, and pcr amplification gained fragment is through order-checking, the length of surveying and concrete sequence as shown in the table:
| The primer title | Annealing temperature | Expanding fragment length |
| L1F/R | 50℃ | 124bp(SEQ?ID?NO：9) |
| L2F/R | 63℃ | 120bp(SEQ?ID?NO：10) |
| L3F/R | 64℃ | 174bp(SEQ?ID?NO：11) |
L1：
TTAGGGGTATGTTTAATCCTACAAATTCTCACCGGCCTCTTTCTAGCCATACATTATACATCAGACACAGCAACCGCTTTCTCATCAGTTACCCATATCTGCCGCGATGTAAATTATGGCTGAA(SEQ?ID?NO：9)
L2：
CCGCTTTCTCATCAGTTACCCATATCTGCCGCGATGTAAATTATGGCTGAATTATCCGGTATCTACACGCCAATGGAGCCTCCATATTCTTTATCTGCCTATACATGCATGTAGGACGAG(SEQ?ID?NO：10)
L3：
GCCGCGATGTAAATTATGGCTGAATTATCCGGTATCTACACGCCAATGGAGCCTCCATATTCTTTATCTGCCTATACATGCATGTAGGACGAGGAATATACTATGGCTCCTACACTTTCTCAGAGACATGGAACATTGGAGTCGTATTATTGTTCACGGTTATGGCCACAGCCT(SEQ?ID?NO：11)
(4) agarose gel electrophoresis detects
Prepare 2% sepharose; With appearance on the pcr amplification product of 5 μ l above-mentioned (3) and 1 μ l sample-loading buffer (0.25% tetrabromophenol sulfonphthalein, the 40% sucrose) mixing; 1 * TAE is an electrophoretic buffer, 5V/cm electrophoresis 20 minutes, gel put into 1 μ g/mlEB dyeing after 20 minutes uv lamp observe down and take pictures.The result sees Fig. 5 (with a duplicate samples experimental result is example, and all the other are same), and leopard species specificity primer can amplify the purpose fragment from corresponding patent medicine.
The discriminating of leopard bone composition in embodiment 2 TONGREN DAHUOLUO WANs (leopard bone side)
Select 3 batches of (10 balls/batch) TONGREN DAHUOLUO WAN patent medicine (leopard bone side) for use---totally five ten flavor medicines; Wherein the leopard bone composition accounts for 0.8% (mass percent) as testing sample; Extract total DNA, and respectively with described primer to SEQID Nos.1 and 2, SEQ ID Nos.3 and 4 and SEQ ID Nos.5 and 6 carry out the substance pcr amplification respectively.Testing sample total DNA extraction process and pcr amplification and to the analytic process of amplification with embodiment 1.
The result is referring to Fig. 5 (is example with a duplicate samples experimental result, all the other with), utilizes DNA extraction method of the present invention and the leopard species specificity primer that designed can effectively amplify the purpose fragment from corresponding patent medicine.
Among Fig. 5, swimming lane 1 is represented the restorative bolus (leopard bone side) of embodiment 1; Swimming lane 2 is represented the TONGREN DAHUOLUO WAN (leopard bone side) of embodiment 2; Swimming lane 3 representatives are the detected result of testing sample with restorative bolus (Bailey Myospalax Born substitutes the side); Swimming lane 4 representatives are the detected result of testing sample with TONGREN DAHUOLUO WAN (Bailey Myospalax Born substitutes the side); Swimming lane 5 representative with the total DNA that from the leopard bone medicinal material, extracts among the embodiment 1 be template, utilize primer of the present invention to SEQ ID Nos.1 and 2, SEQ ID Nos.3 and 4 and SEQ ID Nos.5 and 6 carry out the amplified production detected result of substance pcr amplification respectively; Swimming lane 6 representative with the total DNA that from puppet article medicinal material, extracts according to the method for embodiment 1 be template, utilize primer of the present invention to SEQ ID Nos.1 and 2, SEQ ID Nos.3 and 4 and SEQ ID Nos.5 and 6 carry out the amplified production detected result of substance pcr amplification respectively; Swimming lane 7 is a blank.
As shown in Figure 5; The leopard species specificity primer of the present invention's design can effectively amplify the purpose fragment from leopard bone side; But can from substitute side (pseudo-article side), not amplify the result, leopard bone positive control, negative control and blank result show that amplification is genuine and believable simultaneously.
Among the present invention; Utilize the method for embodiment 1; Tongrentang's restorative bolus half patent medicine (leopard bone side), Tongrentang's restorative bolus patent medicine (Bailey Myospalax Born substitutes the side), Tongrentang's restorative bolus half patent medicine (Bailey Myospalax Born substitutes the side), TONGREN DAHUOLUO WAN half patent medicine (leopard bone side), TONGREN DAHUOLUO WAN half patent medicine (Bailey Myospalax Born substitutes the side), TONGREN DAHUOLUO WAN patent medicine (Bailey Myospalax Born substitutes the side), Tongrentang's Lingyang lung clearing ball half patent medicine (sheep's horn side), Tongrentang's Lingyang lung clearing patent medicine (sheep's horn side), Lingyang lung clearing ball half patent medicine (Goral Horn side), Lingyang lung clearing ball patent medicine (Goral Horn side) with different batches is testing sample respectively; Extract total DNA respectively; And increase with Auele Specific Primer of the present invention; Whether there is the sheep's horn composition in the qualitative evaluation sample, concrete detected result such as following table:
Claims (10)
1. method that detects leopard bone composition in the mixture, this method mainly comprises:
From testing mixture, extract total DNA;
With the total DNA that is extracted is template, utilizes Auele Specific Primer to carry out pcr amplification; Said Auele Specific Primer is for to be selected from: SEQ ID Nos.1 and 2, SEQ ID Nos.3 and 4 and SEQ ID Nos.5 and 6 in a pair of, two or three pairs of primers;
Above-mentioned amplification is carried out analysis and judgement.
2. method according to claim 1, wherein, the said process of from testing mixture, extracting total DNA comprises the steps:
Testing mixture was handled 20～40 minutes through boiling method;
Add CTAB and extract 60 ℃～70 ℃ digestion of damping fluid 2～4 hours;
With the imitative method extracting of phenol;
Add the isopropanol precipitating enrichment DNA;
Utilize the PCR purification kit to carry out purifying, obtain the total DNA that is extracted.
3. method according to claim 1 and 2, wherein, said pcr amplification reaction condition is following:
Reaction system is 15 μ l, 10 * PCR damping fluid, 1～5.5 μ l wherein, dNTPs (2.5mM) 0.5～1.8 μ l; Each 0.5～1.5 μ l of upstream and downstream primer (10 μ M); Taq archaeal dna polymerase (5U/ μ l) 0.2～1.2 μ l, dna profiling (50ng/ μ l) 0.8～3 μ l, aseptic ultrapure water mend to 15 μ l;
Amplification condition: 95 ℃ of preparatory sex change 5min; 95 ℃ of sex change 30s, 48～68 ℃ of annealing 30s, 72 ℃ are extended 30s, 35～40 circulations; Last 72 ℃ are extended 7～10min;
Preferably, said SEQ ID Nos.1 and 2 annealing temperature are 57 ℃, and said SEQ ID Nos.3 and 4 annealing temperature are 57 ℃, and said SEQ ID Nos.5 and 6 annealing temperature are 57 ℃.
4. method according to claim 1, wherein, the said process that above-mentioned amplification is carried out analysis and judgement comprises the product that shows said amplification with gel electrophoresis.
5. method according to claim 1, wherein, said testing mixture differentiates whether be the medicinal material of leopard bone, the Chinese medicine preparation that perhaps is used as medicine with leopard bone or substitute for needing.
6. method according to claim 1, this method also comprises:
The amplification of testing mixture sample is contrasted with the result that extraction DNA from leopard bone carries out pcr amplification, and analysis and judgement surveys whether there is the leopard bone composition in the mixture.
7. according to claim 1 or 6 described methods; Wherein, With SEQ ID Nos.1 and 2, SEQ ID Nos.3 and 4 and SEQ ID Nos.5 and 6 carry out pcr amplification respectively, amplify one, two or three corresponding target fragments, then survey and have the leopard bone composition in the mixture.
8. be used for realizing the primer of the method for each said detection mixture leopard bone composition of claim 1～7, this primer comprises and being selected from: SEQ ID Nos.1 and 2, SEQ ID Nos.3 and 4 and SEQ ID Nos.5 and 6 in a pair of, two or three pairs of primers.
9. whether the described primer of claim 8 exists the application in the leopard bone composition in detecting mixture; Preferably, said testing mixture differentiates whether be the medicinal material of leopard bone, the Chinese medicine preparation that perhaps is used as medicine with leopard bone or substitute for needing.
10. test kit that detects leopard bone composition in the mixture, this test kit comprises the described primer of claim 8, preferably also further comprises PCR damping fluid, dNTPs and archaeal dna polymerase.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110438052 CN102517391B (en) | 2011-12-23 | 2011-12-23 | Method for detecting leopard bone component in mixture and primer applied |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110438052 CN102517391B (en) | 2011-12-23 | 2011-12-23 | Method for detecting leopard bone component in mixture and primer applied |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102517391A true CN102517391A (en) | 2012-06-27 |
| CN102517391B CN102517391B (en) | 2013-08-28 |
Family
ID=46288454
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110438052 Active CN102517391B (en) | 2011-12-23 | 2011-12-23 | Method for detecting leopard bone component in mixture and primer applied |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102517391B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103131781A (en) * | 2013-02-28 | 2013-06-05 | 中国科学院成都生物研究所 | PCR detection method of DNA of biological counterfeit drug in Chinese patent drug |
| CN104059978A (en) * | 2014-06-27 | 2014-09-24 | 安徽师范大学 | Multi-polymerase chain reaction (PCR) primer and method for identifying clouded leopard and application of primer or method in identification of clouded leopard |
| CN104059979A (en) * | 2014-06-27 | 2014-09-24 | 安徽师范大学 | Multiplex PCR (polymerase chain reaction) primers and method for identifying Panthera pardus, and application thereof in identifying Panthera pardus |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101845508A (en) * | 2010-06-12 | 2010-09-29 | 徐君怡 | PCR detection primer, kit and detection method for tiger-derived and leopard-derived DNA |
-
2011
- 2011-12-23 CN CN 201110438052 patent/CN102517391B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101845508A (en) * | 2010-06-12 | 2010-09-29 | 徐君怡 | PCR detection primer, kit and detection method for tiger-derived and leopard-derived DNA |
Non-Patent Citations (3)
| Title |
|---|
| 唐晓晶: "DNA分子标记在中药材鉴定中的应用研究", 《中国优秀博硕士学位论文全文数据库(硕士) 医药卫生科技辑》 * |
| 徐君怡等: "PCR方法特异性鉴定狮源性制品", 《中国动物检疫》 * |
| 徐君怡等: "虎制品的SYBR Green I实时荧光PCR特异性鉴定", 《东北林业大学学报》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103131781A (en) * | 2013-02-28 | 2013-06-05 | 中国科学院成都生物研究所 | PCR detection method of DNA of biological counterfeit drug in Chinese patent drug |
| CN103131781B (en) * | 2013-02-28 | 2015-10-28 | 中国科学院成都生物研究所 | The PCR detection method of biological species adulterant DNA in Chinese patent medicine |
| CN104059978A (en) * | 2014-06-27 | 2014-09-24 | 安徽师范大学 | Multi-polymerase chain reaction (PCR) primer and method for identifying clouded leopard and application of primer or method in identification of clouded leopard |
| CN104059979A (en) * | 2014-06-27 | 2014-09-24 | 安徽师范大学 | Multiplex PCR (polymerase chain reaction) primers and method for identifying Panthera pardus, and application thereof in identifying Panthera pardus |
| CN104059978B (en) * | 2014-06-27 | 2016-04-13 | 安徽师范大学 | For the identification of the multiple PCR primer of clouded leopard and method and their application in qualification clouded leopard |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102517391B (en) | 2013-08-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| do Carmo Bittencourt-Oliveira et al. | Cylindrospermopsin in water supply reservoirs in Brazil determined by immunochemical and molecular methods | |
| CN103898235A (en) | DNA (deoxyribonucleic acid) barcoding based molecular identification method of leech | |
| CN101586161A (en) | Primer, method and kit for detecting animal clonorchiasis sinensis specificity | |
| CN103074433A (en) | Turtle shell DNA detection kit and identification method | |
| CN102517391B (en) | Method for detecting leopard bone component in mixture and primer applied | |
| CN104498599A (en) | Microsporidium molecule universal detection primers and kit thereof | |
| CN102424844B (en) | Method for detecting capra hircus horn ingredients in mixture and primers used in same | |
| CN101942510B (en) | Multiple PCR method for rapidly identifying four varieties of sea cucumbers | |
| CN104745689A (en) | Primers, probe and kit used for detecting bordetella pertussis | |
| CN102424846B (en) | Method for detecting Osteon Myospalacem Baileyi in mixture and primers used thereby | |
| CN103834735B (en) | Nucleotide sequence and molecular probe for identifying dendrobium officinale and applications of molecular probe | |
| CN104611324A (en) | Whole blood sample fast pyrolysis kit and detection method thereof | |
| CN102424845B (en) | Method for detecting saiga tatarica horn ingredients in mixture and primers used in same | |
| CN103409515B (en) | Kit used for species identification of channel catfish and application method of kit | |
| CN104593486A (en) | Primer, probe and kit all used for detecting blood fluke | |
| CN102586478B (en) | One-step multiplex reverse transcription-polymerase chain reaction (RT-PCR) method for detecting turnip mosaic virus and special primers for method | |
| CN104593485A (en) | Primer, probe and kit all used for detecting pneumocystis | |
| CN102796826A (en) | Kit capable of quickly detecting real properties of leather and detecting method of kit | |
| CN108588243A (en) | Quickly differentiate specific primer, multiple PCR detection kit and its detection method of adventive Pomacea canaliculata | |
| CN105039331B (en) | A kind of peronophythora litchi LAMP primer and its quick determination method and application | |
| CN107365766A (en) | Mechanical crushing method extraction mycotic spore RNA method | |
| CN102653800B (en) | PCR (Polymerase Chain Reaction) primer and method for detecting cucumber green mottle mosaic virus (CGMMV) | |
| CN102776268A (en) | Kit and method for detection of transgenic maize Mon89034 and derivative varieties thereof through gene amplification at constant temperature | |
| CN104745690A (en) | Primers, probe and kit used for detecting Klebsiella pneumoniae carbapenemase (KPC) genes | |
| CN108823207A (en) | A kind of Bn-miR43 of ramie and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |