CN102453718A

CN102453718A - Plant bidirectional promoter BIGDB2

Info

Publication number: CN102453718A
Application number: CN201010521550XA
Authority: CN
Inventors: 谢旗; 夏然
Original assignee: Institute of Genetics and Developmental Biology of CAS
Current assignee: Institute of Genetics and Developmental Biology of CAS
Priority date: 2010-10-27
Filing date: 2010-10-27
Publication date: 2012-05-16
Anticipated expiration: 2030-10-27
Also published as: CN102453718B

Abstract

The invention discloses a plant bidirectional promoter BIGDB2. The nucleotide sequence of the promoter is shown as a sequence 1 in a sequence table. Experiments prove that: the BIGDB2 can promote glucuronidase (GUS) expression after being inserted into the space between GUS and luciferase (LUC) in a vector pMOA34-G/L, and the BIGDB2 can also promote the GUS expression after being inserted into the space between the GUS and the LUC in the pMOA34-G/L reversely, so that the BIGDB2 has a bidirectional promoting function in arabidopsis thaliana.

Description

One kind of plant bidirectional promoter BIGDB2

Technical field

The present invention relates to clone and the application of a kind of plant bidirectional promoter BIGDB2.

Background technology

Making plant obtain new proterties through the importing foreign gene can genetic stability be the final purpose of plant genetic engineering also.Caulimovirus CaMV 35S promoter is used by people as stable, exogenous promoter efficiently always widely.Yet in the transgenic process, because the appearance of Tumor-necrosis factor glycoproteins can cause the gene silencing phenomenon, especially carry out a plurality of genes when importing, this phenomenon can be more serious, thereby had a strong impact on the acquisition of transfer-gen plant and offspring's stability.And carrying out two or more genes when importing, and need the identity of these expression of gene amounts, expression time and position usually, and then guarantee that transgene exercises normal function, use 35S promoter to be difficult to the requirement that reaches such.These all are problem demanding prompt solutions in the plant genetic engineering.

The gene silencing phenomenon people that cause for transgenic have had more deep understanding; Cause that transgene silencing has multiple factor; Wherein topmost is exactly the generation of Tumor-necrosis factor glycoproteins; When especially a plurality of genes imported, the more artificial situation that has caused a plurality of 35S promoters to insert did not still have effective solution so far to this.Development along with genomics; Multiple biological gene group order-checking is accomplished; It is found that the existence of bidirectional promoter through bioinformatic analysis; This carries out transgeneic procedure for we utilize the bidirectional promoter of plant self, thereby avoid polygene to insert the gene silencing phenomenon that causes possibility is provided.

Summary of the invention

The object of the present invention is to provide a kind of dna fragmentation, derive from Arabidopis thaliana.

The nucleotide sequence of dna fragmentation provided by the invention is following 1) or 2) or 3):

1) nucleotide sequence shown in the sequence 1 in the sequence table;

2) under the rigorous condition of height with said 1) nucleotide sequence hybridization and have the nucleotide sequence of promoter activity;

3) with said 1) nucleotide sequence have the homology more than 65% and have the nucleotide sequence of promoter activity.

Sequence 1 in the sequence table is made up of 319 deoxyribonucleotides, is the intergenic sequence of arabidopsis gene AT4G12600 and AT4G12590.

The rigorous condition of above-mentioned height is meant, with Hybond membrane place prehybridization solution (the 0.25mol/L sodium phosphate buffer, pH7.2,7%SDS) in, 65 ℃ of prehybridization 30min; Abandon prehybridization solution, add hybridization solution (0.25mol/L sodium phosphate buffer, pH7.2,7%SDS, isotope-labeled nucleotide fragments), 65 ℃ of hybridization 12hr; Abandon hybridization solution, (20mmol/L sodium phosphate buffer, pH7.2 5%SDS), wash film 2 times for 65 ℃, each 30min to add film washing liquid I; (20mmol/L sodium phosphate buffer, pH7.2 1%SDS), wash film 30min for 65 ℃ to add film washing liquid II.

Dna fragmentation of the present invention (promoter active fragment) also comprise with from the segmental nucleotide sequence complementary nucleotide sequence of sequence in the sequence table 1.Term used herein " complementary " mean follow that basepairing rule produces meaning.

Those of ordinary skills can adopt known method at an easy rate, and the method for orthogenesis and point mutation is for example suddenlyd change to the nucleotide sequence of regulation and control fragment of the present invention.Those are through manually modified; Has the nucleotide sequence 70% that separates the regulation and control fragment that obtains with the present invention or the Nucleotide of higher homology; As long as kept expressing the promoter activity of target gene, all be to be derived from nucleotide sequence of the present invention and to be equal to sequence of the present invention.

Term used herein " homology " refers to the sequence similarity with the natural acid sequence." homology " comprises that the nucleotide sequence with regulation and control fragment of the present invention has preferably 75% or higher, more preferably 85% or higher, even more preferably 90% or higher, and most preferably 95% or the nucleotide sequence of higher identity.Homology can be with the naked eye or computer software estimate.The software that uses a computer, the homology between two or more sequences can be used per-cent (%) expression, and it can be used for estimating the homology between the correlated series.

The recombinant vectors that contains above-mentioned dna fragmentation also belongs within protection scope of the present invention.

Above-mentioned recombinant vectors is that above-mentioned dna fragmentation inserts the recombinant vectors that the MCS of carrier pMOA34-G/L is processed;

Above-mentioned carrier pMOA34-G/L inserts the carrier that the MCS of pMOA34 carrier obtains respectively with gus gene and LUC gene.

The transgenic cell line that contains above-mentioned dna fragmentation also belongs within protection scope of the present invention.

The reorganization bacterium that contains above-mentioned dna fragmentation also belongs within protection scope of the present invention.

Above-mentioned dna fragmentation is also belonging within protection scope of the present invention as the application in the promotor.

Say that further above-mentioned promotor is a bidirectional promoter.

Above-mentioned application specifically can be that above-mentioned dna fragmentation is in the application of driving purposes gene in plant interior expression.

Above-mentioned plant is dicotyledons or monocotyledons, like Arabidopis thaliana or tobacco.

Experiment showed, insert BIGDB2 of the present invention between GUS and the LUC among the carrier pMOA34-G/L after, BIGDB2 can start GUS to express; Can start GUS equally after oppositely inserting BIGDB2 between GUS and the LUC among the pMOA34-G/L and express, explain that BIGDB2 has the two-way startup function in Arabidopis thaliana.

Description of drawings

Fig. 1 is a pMOA34-G/L-BIGDB2 plant binary carrier collection of illustrative plates.

Fig. 2 is a transgenic arabidopsis GUS coloration result, and A is the cotyledon period seedling, and B is the seedling of two true leaves, and C is an inflorescence.

Fig. 3 is a transgenic arabidopsis GUS analytical results.

Embodiment

Below in conjunction with specific embodiment the present invention is described further, but the present invention is not limited to following examples.

Among the following embodiment,, be ordinary method like no specified otherwise.

The acquisition of embodiment 1, promotor and detection thereof

One, the acquisition of promotor

According to the result of bioinformatic analysis, there are some potential two-way startup subsequences in the arabidopsis gene group.With the arabidopsis thaliana genomic dna is template, utilize forward primer (BIGDB2-F:5 '-GAGCTCTAGA GCGGC CGCTCTAAACCCTAATTATCTCTCTTTCTCGTC-3 ') and reverse primer (BIGDB2-R:5 '-ACGC GTCGACCCCGGGCTTCTTCTTCGTCTACGAGAGTTCTTTG-3 ') amplification; Amplified production carries out agarose electrophoresis to be separated; Reclaim and be connected on pEASY-T1 (the full formula King Company) cloning vector; Among the transformed into escherichia coli XL1-BLUE (Agilent Technologies-Stratagene Products), confirm that after order-checking cloning vector is correct, the nucleotide sequence of amplified production (called after BIGDB2) is shown in sequence in the sequence table 1.

Two, the structure of recombinant expression vector

1, the structure of the intermediate carrier of tape label gene (pMOA34-G/L)

With pCambia1300-221 (CAMBIA company) carrier is masterplate, utilizes primer GUS-F:5 '-ACGC GTCG ACATGTTACG TCCTGTAGAAACCCCAAC-3 ' and GUS-R:5 '-CAGCCG ACCGGTTCATTGTTTGCCTCC CTGCTGC-3 ' amplifies the gus gene of 1812bp; After order-checking; Be connected to through SalI and AgeI double digestion that (document of putting down in writing this material is Barrell, P.J.and Conner, A.J. (2006) Minimal T-DNA vectors suitable for agricultural deployment of transgenic plants on the pMOA34 carrier; The public can obtain with developmental biology institute from Chinese Academy of Sciences's heredity), be built into the pMOA34-G intermediate carrier.

The product LUC gene of pGL3-Enhancer Vector (Promaga company) behind XbalI (mend flat) and XhoI double digestion and intermediate carrier pMOA34-G are connected with carrier behind the XhoI double digestion through SpeI (mend and put down), and the expression vector pMOA34-G/L of two marker gene GUS and LUC is carried in acquisition.

2, the structure of expression vector pMOA34-G/L-BIGDB2

Verify the plant expression vector pMOA34-G/L that the step 1 of correct cloning vector and step 2 obtains with SalI and NotI double digestion step 1, reclaim after the T4DNA ligase enzyme connects and obtain pMOA34-G/L-BIGDB2 plant expression vector (Fig. 1).

3, the structure of expression vector pMOA34-G/L-BIGDB2 (oppositely)

With BIGDB2 sequence reverses its direction among the pMOA34-G/L-BIGDB2, be built into pMOA34-G/L-BIGDB2 (oppositely) carrier.

Cloning vector to have the correct sequence of BIGDB2 gene in the step 1 is a template, utilizes primer BIGDB2-F2:5 '-GAGC GTCGACTCTAAACCCTAATTATCTCTCTTTCTCGTC-3 ' and BIGDB2-R2:5 '-ACGC GCGGCCGCCTTCTTCTTCGTCTACGAGAGTTCTTTG-3 '; Obtain the reverse fragment of BIGDB2; After order-checking, be connected to the plant expression vector pMOA34-G/L that the step 1 of step 2 obtains, obtain pMOA34-G/L-BIGDB2 (oppositely) plant expression vector with SalI and NotI double digestion.

Three, transform plant and cultivation

1, imports Agrobacterium

The method that transforms through electric shock imports the pMOA34-G/L-BIGDB2 positive colony in the step 2 among the Agrobacterium EHA105; Picking reorganization Agrobacterium mono-clonal bacterium colony changes in the 3-4ml LB nutrient solution and (contains 100 μ g/ml spectinomycins and 50 μ g/ml Rifampins), and 28 ℃ are shaken bacterium and spend the night.The bacterium liquid that cultivation obtains is transferred in 500ml LB (containing 100 μ g/ml spectinomycins and 50 μ g/ml Rifampins), and 28 ℃ are shaken bacterium and spend the night.When bacterium liquid OD600 value is 1.0, collect bacterium liquid and go into centrifuge tube, 4000rpm, 20min collect thalline.With the resuspended thalline of freshly prepared following solution: solvent is a water, and solute is polyoxyethylene nonylphenol (NP-40) and sucrose, wherein, the concentration of polyoxyethylene nonylphenol (NP-40) (Fluka 74385) be 0.05% with the mass percentage concentration of sucrose be 5%.

2, arabidopsis thaliana transformation

Choose the healthy and strong plant of the environmental Arabidopis thaliana (the Biological resources center (ABRC) of Ohio State Univ-Columbus USA) of wild-type col-0 of bolting phase, the Agrobacterium that step 1 is obtained through vacuum infiltration method imports during Arabidopis thaliana spends, and covers 1 day with plastic film, keeps moistening.The Arabidopis thaliana plant that to handle then is put under 22～25 ℃ the illumination condition and makes its normal growth.Results seed, drying conditions are preserved for use down.

Four, genetic expression detects

1, the expression analysis of GUS, LUC in the transgenic arabidopsis

Choose in the step 3 10 not transgenic arabidopsis seeds of homophyletic system; On the 1/2MS substratum, sprout and growth; Seedling and the inflorescence of getting cotyledon period seedling, two true leaves respectively carry out the GUS staining analysis; The GUS dyeing process is referring to Jefferson RA, Kavanagh TA, Bevan MW (1987) GUS fusions:b-glucuronidase as a sensitive and veratile gene fusion maker in higher plants.EMBO J 6:3901-7; Analytical results such as Fig. 2, gus gene obtains expressing in the transfer-gen plant.

Choosing gus gene has the transgenic arabidopsis of expression, sprays the method for substrate through blade and carries out the LUC luminescence analysis, and the result does not observe fluorescence as scheduled.Insensitive for the LUC that detects tissue expression beyond the blade in view of the LUC luminescence analysis method that we select, we with BIGDB2 sequence reverses its direction among the pMOA34-G/L-BIGDB2, are built into pMOA34-G/L-BIGDB2 (oppositely) carrier in step 2.Change the mediation of this plant expression vector through agrobacterium tumefaciens (Agrobacterium tumefaciens) bacterial strain EHA105 over to Arabidopis thaliana; After obtaining the transgenic arabidopsis plant; Carry out the GUS staining analysis, analytical results such as Fig. 3, gus gene obtains expressing in the transfer-gen plant.

Claims

1. dna fragmentation, its nucleotide sequence is following 1) or 2) or 3) or 4):

1) nucleotide sequence shown in the 1-319 position of sequence 1 in the sequence table;

2) nucleotide sequence shown in the sequence 1 in the sequence table;

3) under the rigorous condition of height with said 1) or 2) nucleotide sequence hybridization and have the nucleotide sequence of promoter activity;

4) with said 1) or 2) nucleotide sequence have the homology more than 65% and have the nucleotide sequence of promoter activity.

2. dna fragmentation as claimed in claim 1 is characterized in that: said nucleotide sequence 3) be and said 1) nucleotide sequence have the homology more than 90% and have the nucleotide sequence of promoter activity.

3. the recombinant vectors that contains claim 1 or 2 described dna fragmentations.

4. recombinant vectors as claimed in claim 3 is characterized in that: said recombinant vectors is the recombinant vectors that the MCS of claim 1 or 2 described dna fragmentations insertion carrier pMOA34-G/L is processed;

Said carrier pMOA34-G/L inserts the carrier that the MCS of pMOA34 carrier obtains respectively with gus gene and LUC gene.

5. the transgenic cell line that contains claim 1 or 2 described dna fragmentations.

6. the reorganization bacterium that contains claim 1 or 2 described dna fragmentations.

7. claim 1 or 2 described dna fragmentations are as the application in the promotor.

8. application as claimed in claim 7 is characterized in that: said promotor is a bidirectional promoter.

9. like claim 7 or 8 described application, it is characterized in that: said application is that claim 1 or 2 described dna fragmentations are in the application of driving purposes gene in plant interior expression.

10. according to the arbitrary described application of claim 7-9, it is characterized in that: said plant is dicotyledons or monocotyledons, is preferably Arabidopis thaliana.